ID: 1070751811

View in Genome Browser
Species Human (GRCh38)
Location 10:78968315-78968337
Sequence GCCCATCGTGGACCAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070751802_1070751811 24 Left 1070751802 10:78968268-78968290 CCTAATTCTCAGGGGCTACCAAA No data
Right 1070751811 10:78968315-78968337 GCCCATCGTGGACCAGACCCAGG No data
1070751805_1070751811 -1 Left 1070751805 10:78968293-78968315 CCTAGCTCCAGAACTGCCCAAGG No data
Right 1070751811 10:78968315-78968337 GCCCATCGTGGACCAGACCCAGG No data
1070751803_1070751811 6 Left 1070751803 10:78968286-78968308 CCAAAGCCCTAGCTCCAGAACTG No data
Right 1070751811 10:78968315-78968337 GCCCATCGTGGACCAGACCCAGG No data
1070751807_1070751811 -8 Left 1070751807 10:78968300-78968322 CCAGAACTGCCCAAGGCCCATCG No data
Right 1070751811 10:78968315-78968337 GCCCATCGTGGACCAGACCCAGG No data
1070751804_1070751811 0 Left 1070751804 10:78968292-78968314 CCCTAGCTCCAGAACTGCCCAAG No data
Right 1070751811 10:78968315-78968337 GCCCATCGTGGACCAGACCCAGG No data
1070751801_1070751811 25 Left 1070751801 10:78968267-78968289 CCCTAATTCTCAGGGGCTACCAA No data
Right 1070751811 10:78968315-78968337 GCCCATCGTGGACCAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070751811 Original CRISPR GCCCATCGTGGACCAGACCC AGG Intergenic
No off target data available for this crispr