ID: 1070754454

View in Genome Browser
Species Human (GRCh38)
Location 10:78983026-78983048
Sequence CGTGGCAGCCTTGGGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070754445_1070754454 24 Left 1070754445 10:78982979-78983001 CCTGGAAGGCAGAGCTCCACTGA No data
Right 1070754454 10:78983026-78983048 CGTGGCAGCCTTGGGGTAACTGG No data
1070754447_1070754454 -5 Left 1070754447 10:78983008-78983030 CCTCCAGAGCACCTGTCACGTGG No data
Right 1070754454 10:78983026-78983048 CGTGGCAGCCTTGGGGTAACTGG No data
1070754449_1070754454 -8 Left 1070754449 10:78983011-78983033 CCAGAGCACCTGTCACGTGGCAG No data
Right 1070754454 10:78983026-78983048 CGTGGCAGCCTTGGGGTAACTGG No data
1070754446_1070754454 8 Left 1070754446 10:78982995-78983017 CCACTGAAACTGTCCTCCAGAGC No data
Right 1070754454 10:78983026-78983048 CGTGGCAGCCTTGGGGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070754454 Original CRISPR CGTGGCAGCCTTGGGGTAAC TGG Intergenic
No off target data available for this crispr