ID: 1070754877

View in Genome Browser
Species Human (GRCh38)
Location 10:78985739-78985761
Sequence GCTGTATTGGGACCAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070754872_1070754877 5 Left 1070754872 10:78985711-78985733 CCAGTGATGGTGGCACACGGCAA No data
Right 1070754877 10:78985739-78985761 GCTGTATTGGGACCAAGCCCAGG No data
1070754867_1070754877 18 Left 1070754867 10:78985698-78985720 CCATGGGGTGAGCCCAGTGATGG No data
Right 1070754877 10:78985739-78985761 GCTGTATTGGGACCAAGCCCAGG No data
1070754866_1070754877 27 Left 1070754866 10:78985689-78985711 CCAGAATGGCCATGGGGTGAGCC No data
Right 1070754877 10:78985739-78985761 GCTGTATTGGGACCAAGCCCAGG No data
1070754865_1070754877 28 Left 1070754865 10:78985688-78985710 CCCAGAATGGCCATGGGGTGAGC No data
Right 1070754877 10:78985739-78985761 GCTGTATTGGGACCAAGCCCAGG No data
1070754871_1070754877 6 Left 1070754871 10:78985710-78985732 CCCAGTGATGGTGGCACACGGCA No data
Right 1070754877 10:78985739-78985761 GCTGTATTGGGACCAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070754877 Original CRISPR GCTGTATTGGGACCAAGCCC AGG Intergenic
No off target data available for this crispr