ID: 1070761148

View in Genome Browser
Species Human (GRCh38)
Location 10:79025136-79025158
Sequence GAGCTGTCCTTGGGCATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070761148_1070761161 27 Left 1070761148 10:79025136-79025158 CCAGTGATGCCCAAGGACAGCTC No data
Right 1070761161 10:79025186-79025208 CCTCGTTGTCCTTAGCAAGTGGG No data
1070761148_1070761151 -4 Left 1070761148 10:79025136-79025158 CCAGTGATGCCCAAGGACAGCTC No data
Right 1070761151 10:79025155-79025177 GCTCCTCTTACACCCATCCCTGG No data
1070761148_1070761159 26 Left 1070761148 10:79025136-79025158 CCAGTGATGCCCAAGGACAGCTC No data
Right 1070761159 10:79025185-79025207 CCCTCGTTGTCCTTAGCAAGTGG No data
1070761148_1070761162 28 Left 1070761148 10:79025136-79025158 CCAGTGATGCCCAAGGACAGCTC No data
Right 1070761162 10:79025187-79025209 CTCGTTGTCCTTAGCAAGTGGGG No data
1070761148_1070761163 29 Left 1070761148 10:79025136-79025158 CCAGTGATGCCCAAGGACAGCTC No data
Right 1070761163 10:79025188-79025210 TCGTTGTCCTTAGCAAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070761148 Original CRISPR GAGCTGTCCTTGGGCATCAC TGG (reversed) Intergenic
No off target data available for this crispr