ID: 1070762853

View in Genome Browser
Species Human (GRCh38)
Location 10:79035555-79035577
Sequence CTCCCCAAATGGGTGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070762853_1070762858 2 Left 1070762853 10:79035555-79035577 CCACTCAACACCCATTTGGGGAG No data
Right 1070762858 10:79035580-79035602 CCCATTCTGTGCCCAGCCCTGGG No data
1070762853_1070762862 7 Left 1070762853 10:79035555-79035577 CCACTCAACACCCATTTGGGGAG No data
Right 1070762862 10:79035585-79035607 TCTGTGCCCAGCCCTGGGGTGGG No data
1070762853_1070762861 6 Left 1070762853 10:79035555-79035577 CCACTCAACACCCATTTGGGGAG No data
Right 1070762861 10:79035584-79035606 TTCTGTGCCCAGCCCTGGGGTGG No data
1070762853_1070762860 3 Left 1070762853 10:79035555-79035577 CCACTCAACACCCATTTGGGGAG No data
Right 1070762860 10:79035581-79035603 CCATTCTGTGCCCAGCCCTGGGG No data
1070762853_1070762867 29 Left 1070762853 10:79035555-79035577 CCACTCAACACCCATTTGGGGAG No data
Right 1070762867 10:79035607-79035629 GCATACAAATCACAAATGAATGG No data
1070762853_1070762856 1 Left 1070762853 10:79035555-79035577 CCACTCAACACCCATTTGGGGAG No data
Right 1070762856 10:79035579-79035601 ACCCATTCTGTGCCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070762853 Original CRISPR CTCCCCAAATGGGTGTTGAG TGG (reversed) Intergenic
No off target data available for this crispr