ID: 1070764149

View in Genome Browser
Species Human (GRCh38)
Location 10:79047028-79047050
Sequence CTTAGGGCAGGAACACGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070764149_1070764160 3 Left 1070764149 10:79047028-79047050 CCCTCCCGTGTTCCTGCCCTAAG No data
Right 1070764160 10:79047054-79047076 CCCAAGGTAAGAGACAGACCTGG No data
1070764149_1070764163 7 Left 1070764149 10:79047028-79047050 CCCTCCCGTGTTCCTGCCCTAAG No data
Right 1070764163 10:79047058-79047080 AGGTAAGAGACAGACCTGGGAGG No data
1070764149_1070764162 4 Left 1070764149 10:79047028-79047050 CCCTCCCGTGTTCCTGCCCTAAG No data
Right 1070764162 10:79047055-79047077 CCAAGGTAAGAGACAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070764149 Original CRISPR CTTAGGGCAGGAACACGGGA GGG (reversed) Intergenic
No off target data available for this crispr