ID: 1070764217

View in Genome Browser
Species Human (GRCh38)
Location 10:79047304-79047326
Sequence CTCCTCCAGCAGCCCAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070764217_1070764222 -10 Left 1070764217 10:79047304-79047326 CCTACACTGGGCTGCTGGAGGAG No data
Right 1070764222 10:79047317-79047339 GCTGGAGGAGTCCAGGGGCCGGG No data
1070764217_1070764224 3 Left 1070764217 10:79047304-79047326 CCTACACTGGGCTGCTGGAGGAG No data
Right 1070764224 10:79047330-79047352 AGGGGCCGGGATCTCTGTCCTGG No data
1070764217_1070764228 15 Left 1070764217 10:79047304-79047326 CCTACACTGGGCTGCTGGAGGAG No data
Right 1070764228 10:79047342-79047364 CTCTGTCCTGGGCAGGAGCCAGG No data
1070764217_1070764227 8 Left 1070764217 10:79047304-79047326 CCTACACTGGGCTGCTGGAGGAG No data
Right 1070764227 10:79047335-79047357 CCGGGATCTCTGTCCTGGGCAGG No data
1070764217_1070764225 4 Left 1070764217 10:79047304-79047326 CCTACACTGGGCTGCTGGAGGAG No data
Right 1070764225 10:79047331-79047353 GGGGCCGGGATCTCTGTCCTGGG No data
1070764217_1070764229 20 Left 1070764217 10:79047304-79047326 CCTACACTGGGCTGCTGGAGGAG No data
Right 1070764229 10:79047347-79047369 TCCTGGGCAGGAGCCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070764217 Original CRISPR CTCCTCCAGCAGCCCAGTGT AGG (reversed) Intergenic
No off target data available for this crispr