ID: 1070766482

View in Genome Browser
Species Human (GRCh38)
Location 10:79059485-79059507
Sequence GAGACTGCCCACTGCGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070766471_1070766482 11 Left 1070766471 10:79059451-79059473 CCAAACAGGGGCGATAAAGGCTC No data
Right 1070766482 10:79059485-79059507 GAGACTGCCCACTGCGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070766482 Original CRISPR GAGACTGCCCACTGCGGGAG GGG Intergenic