ID: 1070769965

View in Genome Browser
Species Human (GRCh38)
Location 10:79076495-79076517
Sequence CTGTAAAGACACATGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070769965_1070769974 28 Left 1070769965 10:79076495-79076517 CCCAGCAGCATGTGTCTTTACAG 0: 1
1: 0
2: 3
3: 28
4: 233
Right 1070769974 10:79076546-79076568 TAAAACAGGGCCGGGCACAGTGG No data
1070769965_1070769973 20 Left 1070769965 10:79076495-79076517 CCCAGCAGCATGTGTCTTTACAG 0: 1
1: 0
2: 3
3: 28
4: 233
Right 1070769973 10:79076538-79076560 GAGAGAAGTAAAACAGGGCCGGG No data
1070769965_1070769970 14 Left 1070769965 10:79076495-79076517 CCCAGCAGCATGTGTCTTTACAG 0: 1
1: 0
2: 3
3: 28
4: 233
Right 1070769970 10:79076532-79076554 GAATTTGAGAGAAGTAAAACAGG No data
1070769965_1070769971 15 Left 1070769965 10:79076495-79076517 CCCAGCAGCATGTGTCTTTACAG 0: 1
1: 0
2: 3
3: 28
4: 233
Right 1070769971 10:79076533-79076555 AATTTGAGAGAAGTAAAACAGGG No data
1070769965_1070769972 19 Left 1070769965 10:79076495-79076517 CCCAGCAGCATGTGTCTTTACAG 0: 1
1: 0
2: 3
3: 28
4: 233
Right 1070769972 10:79076537-79076559 TGAGAGAAGTAAAACAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070769965 Original CRISPR CTGTAAAGACACATGCTGCT GGG (reversed) Intronic
900990058 1:6094495-6094517 CTGGACACACACATGCTGCGCGG - Intronic
907488558 1:54794049-54794071 CTGTTAAAACACAGGTTGCTGGG - Intronic
910097766 1:83543155-83543177 ATGGAAACACACTTGCTGCTAGG - Intergenic
911413767 1:97544478-97544500 CTTTAAAAACACATATTGCTAGG - Intronic
914331754 1:146678251-146678273 CAGTACAGAAACATGCTGCACGG + Intergenic
914509830 1:148321674-148321696 CTGAAAAGACACATGTGGCAGGG + Intergenic
915063644 1:153207084-153207106 CTGTACAGACTCAGGCTGGTGGG - Intergenic
915089038 1:153409031-153409053 CTGTAAAGACCATTGATGCTAGG + Intergenic
918159489 1:181884266-181884288 CTGTAAAGACCATTGATGCTAGG + Intergenic
919117073 1:193294064-193294086 CTGTGAAGACACATGCTGGTTGG - Intergenic
922216779 1:223526430-223526452 CTGTAAGGACACATCCTGGGTGG + Intergenic
924382789 1:243479908-243479930 TTATTAAAACACATGCTGCTGGG + Intronic
1063030942 10:2233157-2233179 TTATAAAGACACTTGCTGCTGGG - Intergenic
1063635496 10:7778442-7778464 CTGAAAAGACACAAGCTGGCTGG + Intronic
1063732883 10:8719799-8719821 CTTCAAAGACAAAGGCTGCTAGG + Intergenic
1063913022 10:10851853-10851875 CTGTAATGACTTATGCTGTTAGG - Intergenic
1064110104 10:12531157-12531179 CTGTGAAGGCATATGCTGCCTGG - Intronic
1065049870 10:21780649-21780671 CTGTAAAGACCATTGATGCTAGG + Intronic
1067451192 10:46383084-46383106 TTGGAAAGACACTTGCTGCATGG + Intronic
1067571361 10:47373681-47373703 CTGTACACAGCCATGCTGCTGGG + Intronic
1067586050 10:47476667-47476689 TTGGAAAGACACTTGCTGCATGG - Intronic
1068184379 10:53565542-53565564 CTGTAAAGCCATCTGCTCCTGGG - Intergenic
1068603604 10:58981104-58981126 CTGTAAATAAAAAAGCTGCTTGG + Intergenic
1068876745 10:62005155-62005177 ATGAAAATACACATTCTGCTGGG + Intronic
1069407103 10:68113398-68113420 GTTTAAAGACACATGTAGCTAGG + Intronic
1069854073 10:71429787-71429809 TTTTAGAGACACATGCTGGTGGG + Intronic
1070385123 10:75917334-75917356 CTGCCGAGACCCATGCTGCTTGG - Intronic
1070769965 10:79076495-79076517 CTGTAAAGACACATGCTGCTGGG - Intronic
1071349851 10:84729183-84729205 TTGTAAAGACCAATGATGCTAGG + Intergenic
1071507346 10:86240752-86240774 CTGGAAAGCCACATGTTGTTAGG - Intronic
1072336326 10:94402000-94402022 CTGTGATGAAACATGGTGCTAGG + Intergenic
1072876741 10:99181101-99181123 CTATAAAGACACACGCGGCCGGG + Intronic
1074068403 10:110040135-110040157 CTGCAAATACTCATGCTGTTAGG + Intronic
1074222476 10:111451702-111451724 CTGGAAAGTCACATGCTCTTAGG + Intergenic
1074941978 10:118245124-118245146 AAGTAAAGACCCAGGCTGCTGGG + Intergenic
1076201946 10:128566157-128566179 TCCTAAAGACACATGCTACTTGG - Intergenic
1076237740 10:128878704-128878726 CTGAAAAGAAACTTGCAGCTGGG - Intergenic
1076779603 10:132716969-132716991 CTGAGAAGGCACATACTGCTGGG + Intronic
1079482144 11:20892614-20892636 CTGTGAAGACACATGCGGCCGGG + Intronic
1079851826 11:25544678-25544700 CAGTAAATACACTTGCTTCTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086723433 11:90149735-90149757 TTGTAAAAACACCTACTGCTGGG - Intronic
1091604400 12:1937701-1937723 CTGAAAAGAAACACTCTGCTCGG - Intergenic
1091635047 12:2190727-2190749 CTGTGAAGCCACCAGCTGCTGGG - Intronic
1092354768 12:7785471-7785493 CTATAAAAACACAAGCAGCTAGG - Intergenic
1092660171 12:10730317-10730339 CAGTAAAGACACGTACTGTTTGG + Intergenic
1093909951 12:24735219-24735241 TTGTAAATATACATGCTCCTGGG + Intergenic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1097347284 12:58507214-58507236 CTATATAGACACATGATGATTGG - Intergenic
1097422462 12:59397164-59397186 GTGTAAAGAAACCTACTGCTCGG + Intergenic
1098566693 12:71945261-71945283 CTGTAAAGAAATATGATACTTGG + Intronic
1098670735 12:73227255-73227277 CTGGATTCACACATGCTGCTAGG + Intergenic
1099885032 12:88518635-88518657 CTCTAAAAACCCATGCTTCTTGG - Intronic
1100220165 12:92496365-92496387 TTGTTAAAACACAGGCTGCTGGG + Intergenic
1100559420 12:95733201-95733223 CTGTAAAATCACCAGCTGCTAGG + Intronic
1101594111 12:106148520-106148542 CTGTAAAGCATCATGCTGATGGG - Intergenic
1101832319 12:108268581-108268603 CTGCAAAGTCACATGATGCAGGG - Intergenic
1101922981 12:108947884-108947906 CTGTGAAGGCAGATGGTGCTGGG + Intronic
1102386249 12:112512923-112512945 CTTTAAAGAGAAATGCTGCTGGG - Intergenic
1103389640 12:120562567-120562589 CTGTAAAGACACATACGGCCAGG - Intronic
1103968117 12:124652944-124652966 CTGCAAAGACAGCTGCTGCCAGG - Intergenic
1104554015 12:129783580-129783602 CTGAAGAGACAAATGCCGCTGGG + Intronic
1105059901 12:133139744-133139766 CTAGAAAGACACTTGCTGGTTGG + Intronic
1106390403 13:29329907-29329929 TTATAAAGACACATGCAGCTAGG - Intronic
1107345098 13:39451677-39451699 CAGTAGAGACATATGCTGATAGG - Intronic
1107370540 13:39742157-39742179 CTGTAAAGACCATTGATGCTGGG + Intronic
1109679068 13:65722779-65722801 CTGTAGAGACCAGTGCTGCTGGG - Intergenic
1113078994 13:106496789-106496811 CTGTAAAGAGATAGGCTGCCAGG + Intronic
1113647453 13:112009011-112009033 CTGCAAAGATACCTGCTGCATGG - Intergenic
1114202872 14:20539227-20539249 CCATAAAAACACATGCAGCTAGG - Intergenic
1117637751 14:57763991-57764013 CTGTTGAAACACATGCTGTTGGG + Intronic
1119896614 14:78225059-78225081 CTATAAAGACACATGCGGCCGGG - Intergenic
1121084716 14:91137112-91137134 CTGAACAGACACGTTCTGCTGGG - Intronic
1202937991 14_KI270725v1_random:110251-110273 ATATAAAGACACATGATTCTTGG - Intergenic
1124059505 15:26276599-26276621 ATGTAAAGACACTTGTTGCCAGG + Intergenic
1124133087 15:27007376-27007398 CTATAAAGACACATGCATGTGGG - Intronic
1125193501 15:37020356-37020378 CTGAAAATACACAAGCTGGTTGG + Intronic
1126980301 15:54234875-54234897 CTGCAAAGATACAAGCTTCTAGG - Intronic
1127255932 15:57293366-57293388 CTGTAAATACACAGACTTCTGGG - Intronic
1127726940 15:61759605-61759627 TTGTAACCACACATGCAGCTGGG - Intergenic
1129207547 15:74045902-74045924 CTGTTAAAACACAGACTGCTGGG - Exonic
1130105412 15:80925154-80925176 CTTTAAAGAGACAAGTTGCTTGG + Intronic
1130112371 15:80976435-80976457 CTGGGAAGACTCATGCAGCTGGG + Exonic
1131443423 15:92475971-92475993 CTCTACAGACACAGGCTGCAGGG + Intronic
1132060771 15:98690756-98690778 CTGGAAGGAGACATGCTGATGGG - Intronic
1133676156 16:8074772-8074794 CTGTGCAGAAACTTGCTGCTGGG - Intergenic
1133818921 16:9219247-9219269 CTGTAAAATCACATGATCCTAGG - Intergenic
1133892712 16:9895983-9896005 CGATAAAGACACTTGCTCCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135820847 16:25684582-25684604 CTGTAAAGACACATGCGGCCAGG + Intergenic
1136648624 16:31645752-31645774 ATTTAAACACTCATGCTGCTTGG + Intergenic
1136948486 16:34686108-34686130 ATATAAAGACACATGATTCTTGG + Intergenic
1138823851 16:60294522-60294544 TTGTAAAAACACATGTTGCTGGG + Intergenic
1140001798 16:71032652-71032674 CAGTACAGAAACATGCTGCACGG - Intronic
1140696636 16:77541162-77541184 CTTTAAAGACACAAGGGGCTTGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141974534 16:87506683-87506705 CAGTAAAGCAACATGATGCTGGG - Intergenic
1144082545 17:11777989-11778011 ATGTAAAGAGACATGAAGCTGGG + Intronic
1144224612 17:13132769-13132791 CTTTAAAGACAAAAGGTGCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149869207 17:60167771-60167793 CTGGGAAGACACATGGAGCTAGG - Intronic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151379201 17:73713222-73713244 CTGTAAAAACCCACGTTGCTGGG + Intergenic
1152301331 17:79496686-79496708 CTCTAATGACACATCCTGCCAGG - Intronic
1153143572 18:2002369-2002391 CTTTTCTGACACATGCTGCTTGG - Intergenic
1153764634 18:8363851-8363873 CTGTAAAGAAACATGCAGCCTGG - Intronic
1153955534 18:10092773-10092795 CTCTTAAGACCCATGATGCTTGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156532402 18:37830851-37830873 CTGTAAAGACCATTGATGCTAGG - Intergenic
1161085910 19:2334776-2334798 CTCTAGAGACACATCCGGCTGGG + Intronic
1163416023 19:17187021-17187043 CTATAAAGACAAACGGTGCTGGG - Intronic
1165824666 19:38698907-38698929 TTGTCAAAACACATGGTGCTTGG + Intronic
927563868 2:24093910-24093932 CTACAAAGACACATGCAGCCAGG - Intronic
928396870 2:30949427-30949449 CTTTAAAGATACATCCTGCTGGG - Intronic
929888685 2:45901614-45901636 ATGGAAAGAAATATGCTGCTGGG + Intronic
930349131 2:50227019-50227041 CTTTCATGACACTTGCTGCTCGG + Intronic
930516552 2:52414667-52414689 CTGCAGAGACACATCCTGATTGG - Intergenic
931249770 2:60519704-60519726 CTGTTCTGACACATGCAGCTGGG + Intronic
932616520 2:73234782-73234804 CTGTAAAGACGTGTGCTTCTTGG + Intronic
935045539 2:99478746-99478768 CTGTTAAAACACAAGATGCTGGG + Intronic
935939385 2:108222311-108222333 CTGTCAAAACACAGGTTGCTGGG - Intergenic
937688725 2:124728393-124728415 CAGTGAAGCCACATGATGCTAGG + Intronic
938732213 2:134155470-134155492 CTGTAAAGTGGCATGCTGATAGG + Intronic
938746473 2:134283141-134283163 CAGTACAGACTCAGGCTGCTGGG + Intronic
940591205 2:155730147-155730169 CTGTAGAAACAGATGCTGATAGG + Intergenic
941321941 2:164066464-164066486 TTGTAAAGACACATATTGCATGG + Intergenic
943457909 2:188130331-188130353 TTATAAAGACACATGCTGCCTGG + Intergenic
949071977 2:242030896-242030918 CTGCCATGACACCTGCTGCTCGG + Intergenic
1170484635 20:16804041-16804063 CTTTAAAAACTCCTGCTGCTGGG - Intergenic
1173311462 20:41899819-41899841 ATGTAGATACACATGGTGCTGGG + Intergenic
1173661447 20:44737054-44737076 CTGTAAAGACACAGATGGCTGGG + Intergenic
1174551910 20:51368299-51368321 CTTTAAAGACACTTGTTGTTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1177216013 21:18130011-18130033 CTGGAAAGAAACAAGCTTCTTGG - Intronic
1178247766 21:30970642-30970664 AGGTAAAGATAAATGCTGCTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178574231 21:33770712-33770734 ATGTAATGATACATGCTGCAAGG - Intronic
1178923443 21:36755799-36755821 CTGTTATGACACAGGGTGCTGGG + Intronic
1180598884 22:17000726-17000748 TTGTAAAGACCCTTGATGCTAGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182036855 22:27205668-27205690 CTGAGAAGACAAATGCTGCTGGG - Intergenic
1182197230 22:28530962-28530984 CTGTAAAGACCATTGATGCTAGG + Intronic
949904298 3:8845773-8845795 ATGGAAAGACACAGGATGCTGGG - Intronic
952431074 3:33223368-33223390 CTGTCAAGCCACATGCTTCTAGG + Intergenic
953253360 3:41265996-41266018 CTGTGCATACACATTCTGCTGGG - Intronic
953665432 3:44922706-44922728 CTGTTAAGACACGGGCTGCTGGG + Intronic
953879729 3:46685435-46685457 CAGTAAAGGGGCATGCTGCTGGG - Intronic
954814712 3:53271405-53271427 CGGTATAAACACGTGCTGCTGGG - Intergenic
954828137 3:53393183-53393205 TTGTAAAGACCCCTGATGCTAGG + Intergenic
955146543 3:56325629-56325651 CTATAAAGACAGATGCTGTATGG + Intronic
955174527 3:56600440-56600462 CTATAAAGATACATGCAGCCGGG - Intronic
955752740 3:62199036-62199058 GTGGAAAGCCACATGCTGATGGG + Intronic
959041158 3:101424379-101424401 ATGCACAGTCACATGCTGCTGGG - Intronic
960631299 3:119734075-119734097 TTGTTAAGACACATGCAGCTGGG + Intronic
962419515 3:135215740-135215762 TTGTAAAGACACAGACTGCTAGG + Intronic
965318881 3:167226779-167226801 AAGTAAAGACACATGATGGTTGG - Intergenic
965743077 3:171897217-171897239 CTGAAAGGCCACATGCTGCAGGG - Intronic
966157899 3:176936851-176936873 CTATAAAGACACATGCGGCCAGG - Intergenic
968254858 3:197259998-197260020 CTTTACAGACCCTTGCTGCTGGG + Intronic
969965546 4:10990924-10990946 CTGTAATAACACATGCTGTATGG - Intergenic
970985181 4:22148343-22148365 TTGTAAAGACAATTGATGCTAGG + Intergenic
971603772 4:28630916-28630938 CTGAACAGACACATCTTGCTAGG + Intergenic
973695781 4:53489342-53489364 ATCTAAAGATACATGCTTCTGGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974126833 4:57707035-57707057 GTGTGACCACACATGCTGCTGGG - Intergenic
975053349 4:69894428-69894450 GTATATTGACACATGCTGCTCGG + Intergenic
975664656 4:76723033-76723055 CTGTTATGACACATGTTGCATGG - Intronic
977630504 4:99237674-99237696 CTGTAAAGACCACTGATGCTAGG - Intergenic
977768774 4:100831853-100831875 CTGTAACCACACCTACTGCTGGG + Intronic
979384937 4:120053701-120053723 CTGTGACTACACAGGCTGCTTGG + Intergenic
980084117 4:128373849-128373871 TTGTAAAGACACATGCTTTGTGG + Intergenic
980138690 4:128889078-128889100 CTGTGAAAACACAGACTGCTGGG + Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981218034 4:142194936-142194958 CTGAAAAGAAAAATGATGCTGGG + Intronic
983420187 4:167506955-167506977 CTGTACACCCACATGCTGGTAGG + Intergenic
985208358 4:187565538-187565560 CTTTAAGGCCACCTGCTGCTGGG + Intergenic
985352210 4:189076564-189076586 CTAGAAAGACACAAGTTGCTAGG + Intergenic
985739949 5:1609438-1609460 CTGCCATGACACCTGCTGCTCGG - Intergenic
988210966 5:28202697-28202719 CAGTAAAGCCACTTGCCGCTGGG - Intergenic
989546586 5:42681639-42681661 CTATAAATACACATGCGGCCGGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995459948 5:112392128-112392150 CTGTAAAGACCACTGATGCTAGG + Intronic
995467346 5:112464822-112464844 CTGTAAAGACCACTGATGCTAGG - Intergenic
997887256 5:137641323-137641345 TTGTGAAAACACAAGCTGCTGGG + Intronic
998437946 5:142129355-142129377 CAGTAAAGCCAAATGCTCCTGGG - Intronic
998690706 5:144584461-144584483 CTGAAGTGACAGATGCTGCTGGG - Intergenic
999430269 5:151519912-151519934 TTTTAAAGAGACATGCTCCTGGG - Intronic
999501239 5:152148572-152148594 TTGAAAAGACACATTCGGCTGGG + Intergenic
1001301985 5:170540257-170540279 CTGTAGAGACAGCAGCTGCTAGG + Intronic
1001707367 5:173751205-173751227 TTGTAAAGACAAATGCTACATGG - Intergenic
1002315422 5:178340309-178340331 CTGTTCTGACACATGCTTCTTGG - Intronic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1002667071 5:180832828-180832850 TTGTTAAAACACAGGCTGCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005785174 6:29237563-29237585 CTGTAAAGACACATGTGGCCAGG - Intergenic
1007825960 6:44600756-44600778 CTGTAAAGACACCTGCTTTTTGG + Intergenic
1007844943 6:44746106-44746128 CTATAAAAACACATGCAGCCGGG - Intergenic
1008957810 6:57235023-57235045 GTGTGATGACACATGCTACTTGG + Intergenic
1009870539 6:69447897-69447919 CTGCTGAGACATATGCTGCTAGG - Intergenic
1014914587 6:127130736-127130758 CGGTATGGACAAATGCTGCTTGG + Intronic
1015532948 6:134239573-134239595 CTGTAAAATCACAAGCTGATGGG - Intronic
1016311747 6:142740611-142740633 CAATAAAAACAAATGCTGCTGGG - Intergenic
1016898321 6:149075665-149075687 CTGAAAATACACATTCTCCTGGG + Exonic
1018045815 6:159965545-159965567 CTGTAAAGTCAAATACTGCAGGG - Intergenic
1018285981 6:162238263-162238285 CAGTACAGAAACATGCTGCATGG + Intronic
1018865130 6:167740668-167740690 CTTTTAAAACACATGCTGTTGGG - Intergenic
1020557484 7:9689176-9689198 CTGTAAATACACCTGGTCCTGGG + Intergenic
1021625370 7:22588016-22588038 TTGTAAAAACACAAGTTGCTGGG + Intronic
1022647468 7:32244725-32244747 CTGTAAAGAAACCTGATGCATGG + Intronic
1026224209 7:68426564-68426586 CTGTAAAGTCAGATGCTTCTGGG - Intergenic
1026821599 7:73553288-73553310 CAGGAGAGACACCTGCTGCTGGG + Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029990566 7:104959226-104959248 CTATAAAGACACATGTGGCTGGG + Intergenic
1031479127 7:122257201-122257223 CTGTACAGACAGATCTTGCTGGG + Intergenic
1036457473 8:8922554-8922576 CTGTAAAGAAACACCCGGCTGGG - Intergenic
1037146891 8:15583019-15583041 ATGTAAAGATACATGTAGCTAGG + Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1038877497 8:31567403-31567425 CTGTAAAGACCATTGATGCTAGG + Intergenic
1038897528 8:31802619-31802641 CTGTAAAACCACATCCTACTGGG + Intronic
1043981883 8:86652043-86652065 CTGTACAGTAACATGCTCCTAGG - Intronic
1044402615 8:91789818-91789840 TTGTAAAGACACTTGATGCTAGG + Intergenic
1045167498 8:99623243-99623265 GAGTAAAGACTCAAGCTGCTGGG - Intronic
1050929913 9:11310105-11310127 CTGCAAATACCCATGCTGATTGG - Intergenic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1055447248 9:76395161-76395183 CTGTAAATACGCACGCTCCTAGG + Intergenic
1055635066 9:78268949-78268971 CTGTAAAGAAACCTGCGGCCAGG - Intronic
1056742081 9:89266185-89266207 TGTTAAAGACACATGCTGCCAGG + Intergenic
1057238637 9:93388606-93388628 CTGTAAAGACATATGATGTTGGG + Intergenic
1058775154 9:108276017-108276039 CTGTAAAGAAATATACTCCTTGG - Intergenic
1059070473 9:111130520-111130542 CTCTTAAGACTCATGCTGTTTGG - Intergenic
1059245756 9:112848463-112848485 CTGCAAAGCCACATGCTGGAAGG + Intronic
1059595569 9:115716576-115716598 CTGTAAGTACACTTGCTGCTTGG - Intergenic
1059843547 9:118245628-118245650 CTATGAAGACACAGGCAGCTTGG - Intergenic
1060034940 9:120247191-120247213 CCGTAAAAACACATACAGCTAGG + Intergenic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186454678 X:9701875-9701897 CTGTCATGAAACACGCTGCTGGG + Intronic
1187754212 X:22502357-22502379 CTGTAAAGAAACTTTCTGCATGG - Intergenic
1188323362 X:28768291-28768313 CTATAAACACATCTGCTGCTTGG + Intronic
1188590117 X:31823270-31823292 CTGGAAAGACACATGCTGACAGG - Intronic
1188666765 X:32832676-32832698 GTGTAAAAGCACATGCTGCAGGG - Intronic
1188757574 X:33982719-33982741 ATGTAAATATATATGCTGCTTGG + Intergenic
1190158047 X:48009405-48009427 CTGTGAGGACACAATCTGCTTGG - Exonic
1190173818 X:48132289-48132311 CTGTGAGGACACAATCTGCTTGG - Exonic
1191049995 X:56181551-56181573 CTGTAAAGACCACTGATGCTAGG - Intergenic
1192878811 X:75260160-75260182 TTGTAAAGACAATTGATGCTAGG + Intergenic
1193442413 X:81558921-81558943 CTGTAAAGACACATGCAGACTGG + Intergenic
1194049886 X:89055418-89055440 CTGCAAAGACAAATGTTGGTAGG + Intergenic
1194868970 X:99103346-99103368 ATGTAAAGACATATGATGTTTGG + Intergenic
1196034714 X:111131719-111131741 CTGTAAACAAACATCCTGTTTGG - Intronic
1196236773 X:113290920-113290942 CTGTAATGACTAATGGTGCTGGG + Intergenic
1196281924 X:113832167-113832189 CTGAAATGACACATCCTGTTAGG - Intergenic
1197313156 X:124931027-124931049 CAGTCAAGACACCTGCTGCTGGG - Intronic
1199274364 X:145924161-145924183 CTATAAAGGCACATGTTGTTGGG - Intergenic
1199911631 X:152293713-152293735 TTGTAAAGACAATTGATGCTAGG - Intronic
1200863914 Y:8022261-8022283 CTGTATAGTGACATGTTGCTAGG - Intergenic
1200902980 Y:8451791-8451813 CTGTATAGTGACATGTTGCTAGG + Intergenic
1201561300 Y:15320392-15320414 CTGTAAAGACCATTGATGCTAGG - Intergenic
1201721354 Y:17101036-17101058 CTGTAAACTCAGATGCTTCTTGG - Intergenic
1202057983 Y:20855834-20855856 CTGTAAAGACCATTGATGCTAGG - Intergenic
1202254647 Y:22908531-22908553 CTGTATAGTGACATGTTGCTAGG + Intergenic
1202407638 Y:24542280-24542302 CTGTATAGTGACATGTTGCTAGG + Intergenic
1202463143 Y:25127801-25127823 CTGTATAGTGACATGTTGCTAGG - Intergenic