ID: 1070770038

View in Genome Browser
Species Human (GRCh38)
Location 10:79076984-79077006
Sequence GTGGGTCATTTGCTCTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070770038_1070770043 12 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770043 10:79077019-79077041 GCCTTCACTTCCTCTGTGTATGG No data
1070770038_1070770049 22 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770049 10:79077029-79077051 CCTCTGTGTATGGGGAAGCAGGG No data
1070770038_1070770047 21 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770047 10:79077028-79077050 TCCTCTGTGTATGGGGAAGCAGG No data
1070770038_1070770050 25 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG No data
1070770038_1070770051 28 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770051 10:79077035-79077057 TGTATGGGGAAGCAGGGAGGTGG No data
1070770038_1070770046 14 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770046 10:79077021-79077043 CTTCACTTCCTCTGTGTATGGGG No data
1070770038_1070770045 13 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770045 10:79077020-79077042 CCTTCACTTCCTCTGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070770038 Original CRISPR GTGGGTCATTTGCTCTGCAA AGG (reversed) Intronic
902264472 1:15252133-15252155 GGGGCTCATCTGCTCTGCAATGG - Intronic
904481566 1:30797275-30797297 GTGGGTACCTGGCTCTGCAAAGG - Intergenic
907877507 1:58506488-58506510 GTGGGTCTTTTTCTAAGCAATGG - Intronic
910449716 1:87332481-87332503 CTGGGTCATTAGATGTGCAAAGG + Intronic
912067260 1:105758823-105758845 GTGGGTCATTTGCAGTGGATTGG - Intergenic
916484833 1:165249467-165249489 GAGGGGCAGCTGCTCTGCAAAGG - Exonic
922565325 1:226597837-226597859 GTGGGTCAGCTGCACTGCCAGGG + Intronic
1063253957 10:4305851-4305873 GTGGGACAGTGGCACTGCAAGGG - Intergenic
1064708420 10:18096793-18096815 GTTGGTGAATTTCTCTGCAAAGG + Intergenic
1067232602 10:44422692-44422714 TTGGGTGATTTGGTCTGGAAGGG - Intergenic
1067455768 10:46418470-46418492 AGGGCTCATTTGCTCTGAAATGG - Intergenic
1067631434 10:47966169-47966191 AGGGTTCATTTGCTCTGAAATGG + Intergenic
1068717144 10:60200885-60200907 GTGGGTCATTTTCTTTGCCCTGG + Intronic
1070770038 10:79076984-79077006 GTGGGTCATTTGCTCTGCAAAGG - Intronic
1071062253 10:81585955-81585977 GTGGCACATTTGGTTTGCAAAGG - Intergenic
1072167075 10:92824151-92824173 CTGGGCCATGTGCTATGCAAAGG - Intergenic
1075798403 10:125136676-125136698 GTGAGTCACATTCTCTGCAAGGG - Intronic
1080109464 11:28549084-28549106 GGGGCTCAGTTGCTCTCCAAGGG + Intergenic
1083571935 11:63765729-63765751 GTGGGCCAGCTGCTCTGCCAAGG - Intronic
1085794237 11:79522701-79522723 TTGAGTCATTTTCTCTGGAAGGG - Intergenic
1085803850 11:79616728-79616750 TTGGGTCATATGTTCTGAAAAGG + Intergenic
1087783598 11:102328811-102328833 TTGGGTCATTTTCATTGCAATGG + Intronic
1089322008 11:117632726-117632748 GTGGGTCAGTTGCCCTGGAAGGG + Intronic
1089918176 11:122180066-122180088 GTGTCTCATTTGCTTTGCAAGGG - Intergenic
1091774635 12:3176346-3176368 GAGGGGCATGTGCTCTGCACAGG + Intronic
1097356711 12:58610478-58610500 GCGGGCCTTTTGCTCTGGAAAGG - Intronic
1098643340 12:72866063-72866085 GTGGGTCATTTGCAATCCAAAGG - Intergenic
1098659461 12:73074100-73074122 CTCTGTTATTTGCTCTGCAAAGG + Intergenic
1100096764 12:91048818-91048840 ATGGGTCAGGTGCTCTTCAAGGG + Intergenic
1100405035 12:94265291-94265313 GTGGGTCATTTACAATGAAACGG + Intronic
1103204587 12:119118627-119118649 GTGGGCCATTGCCTCTACAAAGG - Intronic
1106948418 13:34854884-34854906 GAGGGGCATTGGCTTTGCAACGG - Intergenic
1107048644 13:36023466-36023488 GTGGGTCATTTGCTCTTTTCAGG + Intronic
1108847383 13:54694249-54694271 TTGGATCCTTTGCTCTACAAAGG + Intergenic
1114850387 14:26376418-26376440 GCAGGTCATATGCTCTGCGAAGG - Intergenic
1116108672 14:40546283-40546305 CTGGGTCATTTGCATAGCAAAGG - Intergenic
1120781380 14:88489166-88489188 GTCACTCATTTGCTCAGCAAAGG - Intronic
1123778934 15:23606430-23606452 GTGGATCATGTGGTCTCCAATGG + Intronic
1133859631 16:9582136-9582158 CTGATTCATTTGCTCTGAAAAGG + Intergenic
1135565150 16:23506283-23506305 GTGGGCCATTGGTGCTGCAATGG - Intronic
1140559385 16:75960311-75960333 GTGGGTCATTTGCTGAGAATGGG - Intergenic
1141748494 16:85942419-85942441 GTGGGTTTTGTGCTCTGTAAAGG + Intergenic
1142343118 16:89536872-89536894 GAGGGTCATTCGCTCTGCTGGGG + Intronic
1144728912 17:17515517-17515539 GTGGGTCATTTGCTCAGAGTCGG + Intronic
1146197644 17:30826786-30826808 GTTGGTCATCTGGTCAGCAAAGG + Intergenic
1146411595 17:32590345-32590367 GGTGATCATTTGCTCTGCCAGGG + Intronic
1148620675 17:49032260-49032282 AGGGGACATTTTCTCTGCAAGGG - Intronic
1150442519 17:65202877-65202899 GTGGGTCCTTTCATCTGCACTGG + Intronic
1150711973 17:67538772-67538794 GTGTGTCTTTTGCTATGCAAAGG - Intronic
1151857625 17:76733653-76733675 GCTGGTCATTTCCTTTGCAAAGG + Exonic
1152427656 17:80226956-80226978 GTGGGTTCTTTGCTCTTCAGAGG + Intronic
1153673041 18:7430574-7430596 GGGGGTCATAAGCTCTTCAAGGG - Intergenic
1158883500 18:61804054-61804076 GTGGGAAACTGGCTCTGCAATGG - Intergenic
1161335260 19:3709511-3709533 CTGGGTCATTTGCTCCCAAATGG + Intronic
1167070835 19:47221328-47221350 TTGGCTCATTTGCTCTTCACGGG + Exonic
931590902 2:63882239-63882261 GTGGCTCATTTACTTTACAATGG - Intronic
933946613 2:87291762-87291784 GTGGGGCAGTTGCTGGGCAAAGG + Intergenic
936333579 2:111569779-111569801 GTGGGGCAGTTGCTGGGCAAAGG - Intergenic
937551002 2:123091797-123091819 GTGAGACATTTGCTCAGTAAAGG - Intergenic
942180892 2:173379539-173379561 GTGGGTCAGTGGCTTTACAAGGG - Intergenic
945157083 2:206850146-206850168 GTTGGGCATGAGCTCTGCAAGGG + Intergenic
945187654 2:207156011-207156033 GTGGAGCAATTGCCCTGCAAGGG - Intronic
945192364 2:207202670-207202692 GTGCCTGATTTGCACTGCAACGG - Intergenic
945411782 2:209518209-209518231 GTGGTTACTTTGCTCTGCAATGG + Intronic
946966280 2:225041611-225041633 GTGGGTCATTAGGTCTCCAGCGG - Intronic
947429850 2:230017699-230017721 TTGTTTCCTTTGCTCTGCAAAGG - Intergenic
1168954734 20:1826973-1826995 TTGACTCAATTGCTCTGCAATGG - Intergenic
1170017125 20:11794066-11794088 GTGTGTGATTTGGTTTGCAATGG + Intergenic
1171166418 20:22975759-22975781 ATGGATCTTTGGCTCTGCAAAGG - Intergenic
1172681008 20:36715275-36715297 GAGGGTCATCTGGTCTGTAACGG + Intronic
1179038495 21:37781250-37781272 GCAGCTCATATGCTCTGCAAAGG - Intronic
1179312285 21:40207308-40207330 TTCAGTCATCTGCTCTGCAATGG - Intronic
1180835907 22:18929313-18929335 TTGAGTCCTTTGCCCTGCAAGGG - Intronic
1182567972 22:31213519-31213541 GTGGGTCACTTCCTCAGCAAGGG + Intronic
1184047088 22:41978176-41978198 GGGGGTCAGCTGCTCTGCATGGG + Intronic
1203285998 22_KI270734v1_random:154612-154634 TTGAGTCCTTTGCCCTGCAAGGG - Intergenic
949126875 3:455894-455916 GTGTCTCATTTCCTCTGGAAAGG + Intergenic
953765652 3:45739275-45739297 GTGTGTCAAGTGCTCTGGAATGG + Intronic
962685491 3:137843542-137843564 GTGGCTCATTTTCTCTGCAAAGG - Intergenic
966791945 3:183680002-183680024 GTGGGTCATTTTTCCTTCAAAGG - Exonic
970912177 4:21289921-21289943 TTGCTTCATTTCCTCTGCAAGGG - Intronic
975229429 4:71914108-71914130 TTGGGTCTTATGTTCTGCAAAGG - Intergenic
975937175 4:79596200-79596222 GTGGGTTAGTTGCTTTGAAAGGG + Intergenic
975957151 4:79855122-79855144 GTGGTTCAGTTACTCAGCAAAGG + Intergenic
984864810 4:184272374-184272396 CTGGGTCATTTCCTCAGCACTGG + Intergenic
986501400 5:8403706-8403728 CTGTGACAATTGCTCTGCAATGG - Intergenic
986848803 5:11786033-11786055 GTGAGCCATGTGCTCTGCACTGG - Intronic
996415840 5:123209232-123209254 TAGGGTCCTTGGCTCTGCAAGGG - Intergenic
997227184 5:132217835-132217857 GTCAGTCATGTGCCCTGCAAGGG + Exonic
1000454238 5:161429415-161429437 TTAGCTCATTTTCTCTGCAATGG - Intronic
1001743504 5:174072236-174072258 GTGGGGCATGTGCTCTAGAAGGG - Intronic
1003132553 6:3407692-3407714 TTGGGACATTTTCACTGCAATGG + Intronic
1007164894 6:39822176-39822198 CGGGGGCATTTGCTCTGCAGAGG - Intronic
1008015112 6:46509880-46509902 ATGGGTCATTTGGACTCCAAAGG + Intergenic
1008901237 6:56618832-56618854 GTGGGTCATCTGCTCCTCTATGG + Intronic
1020968360 7:14901756-14901778 TTTGGTCATTTGCTTTACAATGG + Intronic
1021822819 7:24515242-24515264 TGGGGTGATTTGCTCTGCAGTGG - Intergenic
1022791497 7:33693563-33693585 GGGGTTCATCTGCACTGCAATGG + Intergenic
1023504094 7:40881936-40881958 GAGGGTCATTTGGTTTGCTAAGG + Intergenic
1023929092 7:44694030-44694052 GTGGGTCAGATGCTCTGCCCAGG - Intronic
1027807128 7:82841962-82841984 GTGGGTGATTCACTCTGGAAGGG - Intronic
1031909951 7:127505540-127505562 GAGGGTCATGAGCTCTTCAAAGG + Intergenic
1033403882 7:141053436-141053458 CTGGGTTATTTTCTCTTCAAGGG - Intergenic
1036781071 8:11648104-11648126 GTGGGTCATTTGGTATGGATTGG - Intergenic
1038631784 8:29252150-29252172 GTGGGGAATTTGCCCTGGAAAGG - Intronic
1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG + Intronic
1044898188 8:96915491-96915513 GTAGCTCATTTGCTCTACATGGG - Intronic
1049136065 8:140901445-140901467 TTGTGTCTTTTGCTCTGCAGAGG - Intronic
1058680080 9:107433072-107433094 GTGGGATATTTGCTTTTCAAGGG - Intergenic
1059797085 9:117709606-117709628 ATGGATCATGTTCTCTGCAATGG + Intronic
1186538906 X:10379523-10379545 GGGTGTCGTTTTCTCTGCAAGGG + Intergenic
1194663261 X:96649259-96649281 TTGGGTCATTTGCTCAACACTGG - Intergenic
1197067042 X:122245834-122245856 GTGGCTTATTTGTTCTACAAAGG + Intergenic
1201429004 Y:13886924-13886946 GAGGATCATTTGATCTGAAAAGG - Intergenic
1202182984 Y:22155423-22155445 GTGGGTAATTTTCTCTTCATGGG - Intergenic
1202208375 Y:22430978-22431000 GTGGGTAATTTTCTCTTCATGGG + Intergenic