ID: 1070770040

View in Genome Browser
Species Human (GRCh38)
Location 10:79077002-79077024
Sequence GAAGGCAGGACCAAGTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 212}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070770040_1070770051 10 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770051 10:79077035-79077057 TGTATGGGGAAGCAGGGAGGTGG No data
1070770040_1070770052 30 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770052 10:79077055-79077077 TGGCCTTCTCACCCCACCCTAGG No data
1070770040_1070770045 -5 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770045 10:79077020-79077042 CCTTCACTTCCTCTGTGTATGGG No data
1070770040_1070770050 7 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG No data
1070770040_1070770043 -6 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770043 10:79077019-79077041 GCCTTCACTTCCTCTGTGTATGG No data
1070770040_1070770049 4 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770049 10:79077029-79077051 CCTCTGTGTATGGGGAAGCAGGG No data
1070770040_1070770046 -4 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770046 10:79077021-79077043 CTTCACTTCCTCTGTGTATGGGG No data
1070770040_1070770047 3 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770047 10:79077028-79077050 TCCTCTGTGTATGGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070770040 Original CRISPR GAAGGCAGGACCAAGTCAGT GGG (reversed) Intronic
903064594 1:20692123-20692145 GGAGGCAGGGCCAAATCACTTGG - Intronic
903806477 1:26009332-26009354 GAGGGCAGGAAGAAGGCAGTGGG + Intergenic
908185471 1:61648780-61648802 GAAGGAAGGATCAACTCTGTGGG + Intergenic
908642787 1:66243822-66243844 GAAGGCAGATCCAAGTGAGCAGG + Intronic
911039406 1:93579823-93579845 GAGAGCAGAACCATGTCAGTGGG - Intronic
911503582 1:98720006-98720028 GAAGGCAGCATCAAATCACTAGG - Intronic
913140915 1:115940699-115940721 AAAGGCAGGAGCAAGTGAGAGGG + Intergenic
915830857 1:159128608-159128630 GAAGGAAGGACAAAGGCAGAGGG - Intronic
915978062 1:160403418-160403440 GAAGTCAGGAGCAAGACAATGGG - Intronic
916144138 1:161725125-161725147 GTAAGCAGGACCCAGTCAGGAGG + Intronic
919451202 1:197775130-197775152 GACTGCAGGACCAAGTGAGTGGG - Exonic
920246365 1:204590525-204590547 AAAAGCAGGACCAAGAGAGTCGG + Intergenic
920534967 1:206731442-206731464 GGAGGCAGGGCCAAGGCTGTGGG + Intronic
923092856 1:230752958-230752980 CAAACCAGGACCATGTCAGTGGG - Intronic
924587929 1:245376312-245376334 GTAGGCAGGACACAGTCAATGGG + Intronic
1064479879 10:15728907-15728929 GAAGGCTTGACCAAGACAGCAGG - Intergenic
1065448162 10:25824264-25824286 GAAGACAGAACCAAGTCATGAGG + Intergenic
1067227775 10:44386591-44386613 AAGAGCAGGGCCAAGTCAGTGGG - Intergenic
1070587711 10:77779244-77779266 GAACGCAAGTCCATGTCAGTAGG - Intergenic
1070716084 10:78722352-78722374 GAAAGCAGGAGCAAGGCTGTGGG - Intergenic
1070770040 10:79077002-79077024 GAAGGCAGGACCAAGTCAGTGGG - Intronic
1071188538 10:83073827-83073849 GAAGCCAGAAACAAGACAGTTGG - Intergenic
1077917204 11:6619123-6619145 GAAGCTAGGACCAGGACAGTGGG + Intronic
1078140372 11:8688144-8688166 GAAGGCAGAACCAAGAAAATGGG + Exonic
1079111251 11:17606351-17606373 GAAGGCAGGACCCAGGAAATTGG - Intronic
1079240828 11:18721200-18721222 GAACGCGGGACCAAGACGGTGGG - Intronic
1079496753 11:21052891-21052913 GTAGGCAGGACCAAATCAGGTGG + Intronic
1080136080 11:28856855-28856877 GAAGGCAGAACCAAGCCATTAGG + Intergenic
1081402660 11:42661349-42661371 GAAGCCAGAACCAAGTCACATGG + Intergenic
1081486128 11:43530840-43530862 GAGGGCTGGACCAGGACAGTAGG - Intergenic
1086825180 11:91487591-91487613 GAAGGCAGCAGATAGTCAGTTGG + Intergenic
1087095661 11:94314987-94315009 GAAGACAGCACCAAGTCATGAGG - Intergenic
1087866600 11:103235783-103235805 GAAGAATGGACCAAGTCAGCTGG + Exonic
1094223694 12:28023124-28023146 GAAAGCAGGAGCAAGAGAGTGGG + Intergenic
1094573800 12:31665323-31665345 GAAGAAAGGACCTAGTCATTTGG - Intronic
1096786560 12:54020144-54020166 GCAGGAAGGACCACGTCAGCAGG - Intronic
1097993073 12:65856895-65856917 CAAGGTAGGATGAAGTCAGTGGG - Exonic
1098238297 12:68440152-68440174 CAAAGCAGGACCAAGGCATTAGG - Intergenic
1099447416 12:82768792-82768814 TAAGGCAGAACCAAGTGAGAGGG + Intronic
1101085589 12:101232469-101232491 GAAATCAGGACCAAGAGAGTTGG + Intergenic
1101232329 12:102754168-102754190 GAAGCCAGGACTAAGCCAGCAGG - Intergenic
1101563518 12:105882628-105882650 GAGGGCAGGACCGAATCAGAAGG + Intergenic
1104339183 12:127931209-127931231 GAAAGCAGGAGCAAGAGAGTTGG - Intergenic
1106586797 13:31064362-31064384 CAAGGCAGGAACAAAGCAGTTGG - Intergenic
1107286811 13:38802475-38802497 GAAGGCAGGGCTATCTCAGTGGG + Intronic
1109748338 13:66656239-66656261 GAAAGCAGTAGCAGGTCAGTGGG - Intronic
1110199704 13:72834228-72834250 GAAGGCAGGACCAAAACATAGGG - Intronic
1111452203 13:88433976-88433998 GAGGGCAGGAGAAAGTCAGAGGG + Intergenic
1114059702 14:19007903-19007925 CAAGGCAGGACAAACTCACTTGG + Intergenic
1114060519 14:19012817-19012839 CAAGGCAGGACAAACTCACTGGG + Intergenic
1114101736 14:19387161-19387183 CAAGGCAGGACAAACTCACTGGG - Intergenic
1114102843 14:19393848-19393870 CAAGGCAGGACAAACTCACTTGG - Intergenic
1114493815 14:23119174-23119196 GAGGGCAGGCCCAGGTCAGGAGG - Exonic
1114604908 14:23988737-23988759 GAAGGCAAGCCCCAGTCAGGCGG + Intronic
1114610358 14:24036284-24036306 GAAGGCAAGCCCCAGTCAGGCGG + Intergenic
1118016603 14:61667376-61667398 GAAGGCTGGAGCAAGCCTGTCGG + Intergenic
1118780355 14:69003743-69003765 GCAGGCAGGGCCGAGTCACTGGG - Intergenic
1122546917 14:102528123-102528145 GATGGCAGGACCCAGTCTCTGGG - Intergenic
1122690498 14:103529911-103529933 GTAGGCATGAGCAAGTCAGGAGG - Intronic
1122829708 14:104389771-104389793 GCAGGCAGGGCCAAGGCAGGTGG - Intergenic
1123449611 15:20351640-20351662 CAAGGGAGGCCCAAGGCAGTGGG + Intergenic
1123852468 15:24373877-24373899 GTAGGCAGGATCATGTCATTTGG + Intergenic
1125736555 15:41930777-41930799 GAAAGAAAGACCCAGTCAGTGGG + Intronic
1127288710 15:57552099-57552121 GAGGGCAGGACCAAGGCATGTGG - Intergenic
1127688711 15:61373657-61373679 GGATGAATGACCAAGTCAGTAGG - Intergenic
1128199542 15:65792588-65792610 GAAGGAAGAAACAGGTCAGTTGG - Intronic
1128698922 15:69789825-69789847 GAGGGCGGGACCAAGGCACTAGG - Intergenic
1129237739 15:74233930-74233952 GAAGGAAAGGCCAAGTCAGGAGG + Intergenic
1129270035 15:74414755-74414777 GAGAGCAGGCCCAGGTCAGTGGG + Intronic
1129271553 15:74421796-74421818 GAAGGCAGCACCAAGCCATCAGG + Intronic
1130752140 15:86723826-86723848 GGTGGCAGGACCAATGCAGTGGG + Intronic
1130797541 15:87225951-87225973 GAAGGAAGGCCCAAGTTAATTGG + Intergenic
1131064425 15:89424645-89424667 GAAGGGAGGAGGAAGTCAGGAGG + Intergenic
1131271977 15:90953118-90953140 GAGGAGTGGACCAAGTCAGTTGG - Intronic
1133026352 16:2990520-2990542 GAAGGCAGGAGGGAGTCAGGAGG - Intergenic
1133413628 16:5589055-5589077 GATGGCAGGGCCAAGGCAGTGGG + Intergenic
1134783545 16:16920572-16920594 CAATTCAGGAACAAGTCAGTTGG + Intergenic
1136078774 16:27837971-27837993 AAAGGCAGGAAGAAGACAGTAGG - Intronic
1136120185 16:28127861-28127883 GGAGGCAGGACCAGGTGATTTGG - Intronic
1139513250 16:67439189-67439211 GGAGGCAGTAGCCAGTCAGTTGG + Intronic
1139656678 16:68391677-68391699 GATGGCAGGGCCAAGGCAGTGGG + Intronic
1140650760 16:77085519-77085541 GATGGAAGGACCAACTGAGTAGG + Intergenic
1141370908 16:83485593-83485615 GTAGGCAGGAACAAGTCAAAGGG - Intronic
1143427380 17:6850782-6850804 GAAGGCAGGAGCAAGGAAGAGGG - Intergenic
1143736442 17:8914890-8914912 GAAGGCTGGACCAATTTTGTAGG + Intronic
1145406054 17:22595236-22595258 GAAGGCAGGAGCACATCAGTGGG + Intergenic
1146633641 17:34488261-34488283 ACAGGGAGCACCAAGTCAGTAGG + Intergenic
1147540000 17:41349337-41349359 GACTTCAGGACCAAGTGAGTGGG - Exonic
1147547064 17:41409847-41409869 GACTTCAGGACCAAGTGAGTTGG - Intergenic
1148151105 17:45396802-45396824 AAAGGCAGGACTGAGTCAGGAGG + Intronic
1148895586 17:50837372-50837394 GAAGGCAGGACCAAGGACGCTGG - Intronic
1149812579 17:59691919-59691941 GAAGGCAAGCCAAATTCAGTAGG - Intronic
1150384601 17:64748577-64748599 GAAGAGAGGAGCAAGTAAGTAGG + Intergenic
1150454303 17:65294536-65294558 GCAGGCAGGACCAAGTGTGAAGG + Intergenic
1151959443 17:77397892-77397914 CAAGGCAGGCCCAAGGCAGGCGG - Intronic
1152339021 17:79714251-79714273 CAAGGGAGGCCCAAGGCAGTGGG - Intergenic
1156490856 18:37495193-37495215 GAAGCCAGGCTCAAGTCAGTGGG + Intronic
1156831175 18:41493219-41493241 AAAGGGAGGACCAAGGCAGAGGG + Intergenic
1157270825 18:46274803-46274825 GAAGGCTGAATCAAGGCAGTGGG + Intergenic
1159096296 18:63906201-63906223 GAAGGCAGCACCAAGCCATAAGG - Intronic
1159275473 18:66215047-66215069 AAAGGCAGGACAATGTCAGAAGG - Intergenic
1159492430 18:69154607-69154629 GAAGGGAGGAACAAGTCACATGG + Intergenic
1160179373 18:76620500-76620522 GAAGGCCGGACGACGTCTGTTGG - Intergenic
1161125326 19:2552960-2552982 GAAGGCAGCCCCAAGCCAGCAGG + Intronic
1163598015 19:18231701-18231723 GGAGGGAGAACCAAGTCAGCTGG - Intronic
1165767548 19:38360699-38360721 GAAGGCAGGGCCAGGTGAGCTGG - Intronic
1166217461 19:41344877-41344899 GAAGGCAGGAGAGAGACAGTGGG + Intronic
1166279577 19:41782641-41782663 GAAGGCAGGACCAGGTGCGGTGG + Intergenic
1166751215 19:45164793-45164815 GAGGGCAAGACCAAGAGAGTGGG - Intronic
1166943509 19:46383385-46383407 GAAGGCAGGGCAGACTCAGTGGG - Intronic
925157233 2:1657520-1657542 GAGGGCAGGTCCCAGTCAGGAGG - Intronic
926662367 2:15481760-15481782 GAAGGCAGGAGAAGGTCAGTGGG - Intronic
927678113 2:25121781-25121803 GAAATCAAGACCAAGTGAGTAGG + Exonic
928234634 2:29529073-29529095 GAAGGCAGGGGAAAGGCAGTTGG - Intronic
931172792 2:59822480-59822502 GGAGGCAGGATCAAGCCAGTAGG - Intergenic
932310009 2:70732147-70732169 GAAGGCAGGACAAAGTGAGTGGG + Intronic
932419753 2:71594624-71594646 GAAGGGAGCACCAGGGCAGTGGG - Intronic
932689063 2:73897059-73897081 GAAGGCAGGGGGAAGGCAGTGGG - Exonic
932837254 2:75049382-75049404 GGAGGCAGGTCAAAGGCAGTGGG + Exonic
933158903 2:79002807-79002829 GAAGACAGCACCAAGTCATGAGG + Intergenic
933731031 2:85456412-85456434 GAAGGCAGGAGGAGGTGAGTAGG - Intergenic
938222222 2:129580233-129580255 GAAAGCAGGAGCAAGACAGAGGG + Intergenic
939195670 2:138967803-138967825 AAAGGTAGGACCAAGACATTAGG + Intergenic
945522359 2:210844425-210844447 TAAGGCAGGACCAAGAATGTTGG + Intergenic
945560662 2:211336013-211336035 GAAAGCAGGAACACCTCAGTTGG + Intergenic
945676951 2:212866644-212866666 GAAGCTAGGACCAAGTCGGGGGG + Intergenic
946321163 2:218955344-218955366 GAAGGCAGGAGCCAGGGAGTTGG + Intergenic
947387277 2:229604067-229604089 GAAGGAAGGTCAAAGTCATTAGG - Intronic
947768223 2:232651094-232651116 GAAAGCAGGCCCCGGTCAGTTGG + Intronic
948422958 2:237871652-237871674 GGGGGCAGGACCAAGAGAGTTGG - Intronic
1170707094 20:18754161-18754183 GAAGCCAGAAGCAGGTCAGTTGG + Intronic
1172992644 20:39047780-39047802 GAGGGGAGGACCATGTCAGGGGG + Intergenic
1174750897 20:53110598-53110620 GAAGGCAGGCCAACGTCTGTTGG + Intronic
1175074203 20:56359484-56359506 GAAGTTCAGACCAAGTCAGTCGG - Intronic
1176128186 20:63485265-63485287 GAAGGCAGGCCCAAGTCCTTGGG - Intergenic
1179432394 21:41332070-41332092 GAAGGCAGCACCAAGCCATGAGG - Intronic
1179517327 21:41917714-41917736 GCAGGCAGGACCAGGGCAGCAGG + Intronic
1180478183 22:15730515-15730537 CAAGGCAGGACAAACTCACTTGG + Intergenic
1180479001 22:15735429-15735451 CAAGGCAGGACAAACTCACTGGG + Intergenic
1181688104 22:24543112-24543134 GAAGGCAGAACGGGGTCAGTGGG + Intronic
1182025192 22:27112500-27112522 GAAGACAGGACTCAGTCACTAGG + Intergenic
1182332263 22:29559589-29559611 TAGGGAAGGAGCAAGTCAGTGGG - Intronic
1183581292 22:38728126-38728148 GAAGGCCGCACCAAGGCTGTCGG + Exonic
1184887548 22:47355565-47355587 GATGGCAGGAGCATGTCACTGGG + Intergenic
949682194 3:6526993-6527015 GAAGACAGGACTAAGTCAGAGGG + Intergenic
951702650 3:25511735-25511757 TAAGGCAGGGGCATGTCAGTGGG - Intronic
953775831 3:45816370-45816392 AAAGGCAAGGCCAAGTCAGATGG + Intergenic
955029187 3:55199989-55200011 GAAGGCAGGATCCAGGCTGTGGG - Intergenic
955426925 3:58800938-58800960 GAGGGCATGAGCAAGTGAGTAGG - Intronic
956039765 3:65133533-65133555 GAAGGCATGACCATGTGACTAGG - Intergenic
957772728 3:84715310-84715332 GAAGACAGCACCAAGTCATGAGG - Intergenic
961401796 3:126652214-126652236 CAGGGCAGGAGCAAGACAGTGGG + Intronic
961418947 3:126784464-126784486 GAAAGCAGCAGCAAGGCAGTGGG - Intronic
961756167 3:129128446-129128468 CCAGGCAGGACCAGGTCAGGAGG - Intronic
961894868 3:130158690-130158712 GAAGCCAGGGCCAAGGCAGCAGG - Intergenic
963372152 3:144414114-144414136 GAAGGCAGGACCAAATTTCTGGG - Intergenic
964284301 3:155101005-155101027 AAAGACAGGGCCAAGTCATTAGG - Intronic
964857685 3:161164770-161164792 GAAGACGGGACCAAGAAAGTGGG - Intronic
965857365 3:173104549-173104571 GAGTGCAGGAGCAAGTCAGGGGG + Intronic
966953984 3:184854202-184854224 AAAGGAAGGACCATGTCAGGAGG + Intronic
967632049 3:191755824-191755846 GAAGACAGCACCAAGTCATTAGG + Intergenic
968236709 3:197035815-197035837 GATGGCAGGTCCAACTCAGTTGG - Intergenic
968520283 4:1031983-1032005 GAAGGCAGGGCCAAGAGAGTGGG + Intergenic
969203636 4:5625176-5625198 GAATGCAGCAGCAAGTCAATGGG - Intronic
970383514 4:15532355-15532377 GAAGGCAGGCCTAAGTCTGGAGG - Intronic
970914912 4:21321714-21321736 GAAGGCAGGAGGGAGGCAGTGGG + Intronic
971310888 4:25524921-25524943 GCAGGCAGGCCTGAGTCAGTAGG + Intergenic
971997489 4:33984275-33984297 GAAGGCAGGAGCGCATCAGTGGG - Intergenic
972386422 4:38570751-38570773 GAAGTCAGTACCAAGTCAGATGG + Intergenic
975143965 4:70947232-70947254 AAAGGCAGGATCAAGACACTGGG + Intronic
977665646 4:99644487-99644509 GAAGTCACTACCAAGTTAGTGGG + Intronic
978114519 4:105003366-105003388 GAAGGTAGGACCAAGCAAGCAGG + Intergenic
978731986 4:112038753-112038775 GAACTCAGGACCAAGTCCCTGGG - Intergenic
983881993 4:172943181-172943203 GAAGCCAGCACCAAGTCATGAGG + Intronic
985720318 5:1485439-1485461 GAATGCAGGAACAAGGCAGAGGG + Intronic
996964851 5:129295629-129295651 GAGGGCAGGCCCCAGTCAGGTGG + Intergenic
997860745 5:137413514-137413536 GAAGGCAGGACAAGATCAGGGGG - Intronic
997892160 5:137686723-137686745 AAAAGCAGGCCCACGTCAGTGGG + Intronic
998977077 5:147660264-147660286 GAAGGAAAGACCAACTCTGTAGG + Intronic
1001260930 5:170227766-170227788 CAGGGCAGGACCAGGGCAGTGGG + Intergenic
1001379832 5:171297518-171297540 TAATACATGACCAAGTCAGTTGG + Intronic
1001616806 5:173049331-173049353 GAAGGGAGGACCCAGTACGTGGG - Intergenic
1002712642 5:181204528-181204550 GAGCGCGGGACCAAGTCAGGGGG + Intronic
1005977870 6:30813992-30814014 GAGGGCAGGAGCAGGTCAGAGGG + Intergenic
1008783036 6:55130244-55130266 AAAGGCAGCACAAATTCAGTGGG + Intronic
1009988740 6:70814616-70814638 GTAGGCAGGACGAAATCAGATGG - Intronic
1011710232 6:90045622-90045644 AAAGTCAAAACCAAGTCAGTGGG + Intronic
1011841698 6:91508812-91508834 GAAAGCAGGGACAAGACAGTGGG - Intergenic
1012945375 6:105460487-105460509 GGGGACAGGAACAAGTCAGTAGG - Intergenic
1014064706 6:117111093-117111115 GGAGGAAAGACCAAGTCTGTTGG - Intergenic
1014397585 6:120945131-120945153 GAAAGCAGGAACAAGACAGAAGG + Intergenic
1014893672 6:126873143-126873165 GAAAGCAAGAGCAAGTGAGTCGG - Intergenic
1018313650 6:162535276-162535298 CAAGGCAGGACCAGGGCAGATGG - Intronic
1018874757 6:167812026-167812048 GAAGGCAGCACCATGGCACTGGG - Intergenic
1023391202 7:39713386-39713408 GAAAGCAGGAGCAAGTGAGATGG - Intergenic
1023698176 7:42868466-42868488 GAAAGCAGGAGCAAGACAGAGGG - Intergenic
1028971295 7:96861292-96861314 GGAGGCAGGACCAAGTCACTTGG + Intergenic
1030125943 7:106152543-106152565 GCAGGCAGGCCCAACTGAGTGGG - Intergenic
1030156938 7:106465084-106465106 GGAGGCAGGACCAGCACAGTTGG - Intergenic
1030306000 7:108019331-108019353 GAAGGCAGGAGAGAGTCAGAGGG - Intergenic
1032328120 7:130951211-130951233 GCTCGCAGGACAAAGTCAGTGGG + Intergenic
1032518096 7:132521872-132521894 GAGGGCATGACCAAGTCATAGGG - Intronic
1032744551 7:134772534-134772556 GCAGGCAAGACCATGTTAGTAGG - Intronic
1034757030 7:153632089-153632111 GAAGGCAGCATCATATCAGTGGG + Intergenic
1036583419 8:10099970-10099992 GAGGGCAGGACAAAGGCAGAGGG + Intronic
1036857258 8:12307175-12307197 GAAGGCAGGCCCATGTCCCTGGG - Intergenic
1037434148 8:18845369-18845391 GCAGACAGGACCATGTGAGTGGG - Intronic
1037584509 8:20267415-20267437 GTAGGCAGGGCCCAGTAAGTGGG - Intronic
1042225836 8:66513675-66513697 GAAGGAAGGATCAGGACAGTGGG - Intronic
1042530526 8:69810283-69810305 GAAGCCAGGTCCCAGGCAGTGGG + Intronic
1043078467 8:75733322-75733344 GGAGATTGGACCAAGTCAGTGGG + Intergenic
1045650528 8:104338102-104338124 GAAGGGAAGACCATTTCAGTTGG + Intronic
1046054326 8:109061106-109061128 GAAGACAGCACCAAGCCAGAAGG + Intergenic
1048086363 8:131185168-131185190 GAAGACAGAACCAAGTCATGAGG - Intergenic
1048885338 8:138904910-138904932 GAAGCCAGGCTCAAGTCTGTGGG - Intronic
1053187082 9:36025361-36025383 CAAAGCAGGCCCAAGCCAGTTGG + Intergenic
1053543412 9:38998084-38998106 GAAGGCAGGAGAAGGTCAGAGGG - Intergenic
1056513869 9:87331945-87331967 TAAGGCTGGACCAATTCTGTTGG - Intergenic
1058147804 9:101430948-101430970 GGATGCATGACCAAGACAGTTGG + Intronic
1059885378 9:118739701-118739723 GAATGCAGGAGCAAGTGAGAAGG + Intergenic
1061024609 9:128040253-128040275 GAAGGCAGGAAAAGGTCAGAGGG - Intergenic
1203424452 Un_GL000195v1:24629-24651 TAAGGCAGGGCCCAGGCAGTTGG + Intergenic
1189110865 X:38287065-38287087 GAAGGCAAGGCAAAATCAGTGGG - Exonic
1191775381 X:64807918-64807940 GAAGGAAAGACCAAGTCTGCTGG - Intergenic
1191957915 X:66666255-66666277 AAAGGTGGGAACAAGTCAGTTGG + Intergenic
1196061821 X:111416453-111416475 GAAGACAGCACCAAGTCATGGGG - Intergenic
1199995587 X:153023457-153023479 GAACACAGGCCCAAGTCACTAGG - Intergenic
1200863717 Y:8020234-8020256 GTAGGCAGAACCCAGTCAGAAGG + Intergenic
1200903636 Y:8459007-8459029 GTAGGCAGAACCCAGTCAGAAGG - Intergenic
1201314947 Y:12634968-12634990 AAAAGCAGGAGCAAGACAGTGGG + Intergenic