ID: 1070770042

View in Genome Browser
Species Human (GRCh38)
Location 10:79077016-79077038
Sequence TACACAGAGGAAGTGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070770042_1070770051 -4 Left 1070770042 10:79077016-79077038 CCTGCCTTCACTTCCTCTGTGTA No data
Right 1070770051 10:79077035-79077057 TGTATGGGGAAGCAGGGAGGTGG No data
1070770042_1070770052 16 Left 1070770042 10:79077016-79077038 CCTGCCTTCACTTCCTCTGTGTA No data
Right 1070770052 10:79077055-79077077 TGGCCTTCTCACCCCACCCTAGG No data
1070770042_1070770049 -10 Left 1070770042 10:79077016-79077038 CCTGCCTTCACTTCCTCTGTGTA No data
Right 1070770049 10:79077029-79077051 CCTCTGTGTATGGGGAAGCAGGG No data
1070770042_1070770050 -7 Left 1070770042 10:79077016-79077038 CCTGCCTTCACTTCCTCTGTGTA No data
Right 1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070770042 Original CRISPR TACACAGAGGAAGTGAAGGC AGG (reversed) Intronic
No off target data available for this crispr