ID: 1070770050

View in Genome Browser
Species Human (GRCh38)
Location 10:79077032-79077054
Sequence CTGTGTATGGGGAAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070770041_1070770050 6 Left 1070770041 10:79077003-79077025 CCACTGACTTGGTCCTGCCTTCA 0: 1
1: 0
2: 4
3: 28
4: 296
Right 1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG No data
1070770038_1070770050 25 Left 1070770038 10:79076984-79077006 CCTTTGCAGAGCAAATGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG No data
1070770042_1070770050 -7 Left 1070770042 10:79077016-79077038 CCTGCCTTCACTTCCTCTGTGTA No data
Right 1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG No data
1070770040_1070770050 7 Left 1070770040 10:79077002-79077024 CCCACTGACTTGGTCCTGCCTTC 0: 1
1: 0
2: 2
3: 15
4: 212
Right 1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070770050 Original CRISPR CTGTGTATGGGGAAGCAGGG AGG Intronic
No off target data available for this crispr