ID: 1070770699

View in Genome Browser
Species Human (GRCh38)
Location 10:79080766-79080788
Sequence GACCCACTCCTTCTGCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070770699_1070770708 19 Left 1070770699 10:79080766-79080788 CCTTTAGGCAGAAGGAGTGGGTC No data
Right 1070770708 10:79080808-79080830 CTCATGGGCCTCAGAAGTCTTGG No data
1070770699_1070770705 3 Left 1070770699 10:79080766-79080788 CCTTTAGGCAGAAGGAGTGGGTC No data
Right 1070770705 10:79080792-79080814 ATTGGGGGTTGGAATCCTCATGG No data
1070770699_1070770706 4 Left 1070770699 10:79080766-79080788 CCTTTAGGCAGAAGGAGTGGGTC No data
Right 1070770706 10:79080793-79080815 TTGGGGGTTGGAATCCTCATGGG No data
1070770699_1070770704 -8 Left 1070770699 10:79080766-79080788 CCTTTAGGCAGAAGGAGTGGGTC No data
Right 1070770704 10:79080781-79080803 AGTGGGTCTGCATTGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070770699 Original CRISPR GACCCACTCCTTCTGCCTAA AGG (reversed) Intronic
No off target data available for this crispr