ID: 1070771240

View in Genome Browser
Species Human (GRCh38)
Location 10:79083570-79083592
Sequence ATGTGTCCCTCTAAGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070771237_1070771240 15 Left 1070771237 10:79083532-79083554 CCACTGAAGGATTTTAAGTAAAG 0: 1
1: 2
2: 23
3: 149
4: 709
Right 1070771240 10:79083570-79083592 ATGTGTCCCTCTAAGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070771240 Original CRISPR ATGTGTCCCTCTAAGATCTC TGG Intronic
No off target data available for this crispr