ID: 1070771837

View in Genome Browser
Species Human (GRCh38)
Location 10:79087104-79087126
Sequence ACAAGCAATGGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070771837_1070771844 0 Left 1070771837 10:79087104-79087126 CCCTCCACCTTCCCATTGCTTGT 0: 1
1: 1
2: 0
3: 28
4: 384
Right 1070771844 10:79087127-79087149 TCACTGGCATTGTGTCTCCTAGG No data
1070771837_1070771845 14 Left 1070771837 10:79087104-79087126 CCCTCCACCTTCCCATTGCTTGT 0: 1
1: 1
2: 0
3: 28
4: 384
Right 1070771845 10:79087141-79087163 TCTCCTAGGACAGCTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070771837 Original CRISPR ACAAGCAATGGGAAGGTGGA GGG (reversed) Intronic
901938558 1:12644892-12644914 GCAGGCTATGGGAAGGGGGAAGG - Intronic
902234222 1:15047430-15047452 ACGTGCAGTGGGGAGGTGGAGGG + Intronic
902403938 1:16173003-16173025 CCTAGCAATCCGAAGGTGGAGGG - Intergenic
903737046 1:25536474-25536496 ACGAGGGATGGGAAGGTGGGTGG + Intergenic
904133363 1:28291865-28291887 AAAAGAAATGGGAAGGGGCAGGG - Intergenic
904757065 1:32773761-32773783 GCAAGCACTGAGGAGGTGGATGG + Exonic
906723488 1:48026257-48026279 ATAAGCAATGGGATGGTGGTAGG + Intergenic
906745131 1:48216078-48216100 AGGGGCAATGGGAAGCTGGATGG + Intergenic
906836285 1:49086259-49086281 ACTAGCAATGGGAATGGGCAAGG - Intronic
907249727 1:53130167-53130189 CCAACAAATGGGGAGGTGGAAGG + Intronic
909209615 1:72807389-72807411 ACCAGCAATGGGATTGTGGTGGG + Intergenic
909351459 1:74658234-74658256 ACAAGGAATTGGGAAGTGGAGGG - Intronic
909798179 1:79770686-79770708 ACAAGGATTGAGAAGATGGAGGG + Intergenic
911661750 1:100509165-100509187 AGAAGCAAAGGGAGGGAGGAAGG - Intronic
911864855 1:103005491-103005513 AAAAGCAATGAAAAGGTTGAAGG + Intronic
912805760 1:112755914-112755936 ACAACAAATGGGAAGGAAGATGG + Intergenic
913171444 1:116235923-116235945 GCCAGAAGTGGGAAGGTGGAAGG - Intergenic
913674528 1:121128667-121128689 AGAAGCCATGTGAAGATGGAGGG + Intergenic
914026311 1:143915976-143915998 AGAAGCCATGTGAAGATGGAGGG + Intergenic
914664748 1:149823729-149823751 AGAAGCCATGTGAAGATGGAGGG + Intergenic
914671017 1:149870089-149870111 AGAAGCCATGTGAAGATGGAGGG - Intronic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
918053397 1:180995344-180995366 ACAAGGAATGGGGATGGGGAGGG - Intronic
918259482 1:182782593-182782615 ACTAATAATGGGAAGTTGGAAGG + Intergenic
920258384 1:204672299-204672321 TTAAGCAATGGGGAGGGGGAAGG - Intronic
920298685 1:204975431-204975453 ACTAGCACTAGGAAGGGGGAAGG - Intronic
921178561 1:212613964-212613986 CCAAGCAATGGGAATGAGAAAGG + Intronic
921178639 1:212614403-212614425 CCAAGCAATGGGAATGAGAAAGG - Intronic
921216915 1:212945580-212945602 ACAAGCCATGGGTGTGTGGAGGG - Intergenic
922535778 1:226379688-226379710 AAAAGTAAGGGGAAGGTAGAAGG + Intronic
924518492 1:244785856-244785878 ACAAGCACTGAGGAGGGGGATGG - Intergenic
924740976 1:246794085-246794107 ACACGGAAAGGGAAGGGGGAGGG + Intergenic
1063068802 10:2637858-2637880 ATAAGCATGGGCAAGGTGGATGG + Intergenic
1064142114 10:12799218-12799240 ACAAGCCCTTGGAACGTGGACGG - Intronic
1065673398 10:28147060-28147082 ACAGGAAATGGGGAGGTGAAAGG + Intronic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1070538138 10:77394501-77394523 CGAAGCAGTGGGCAGGTGGATGG + Intronic
1070771837 10:79087104-79087126 ACAAGCAATGGGAAGGTGGAGGG - Intronic
1070799927 10:79239357-79239379 ACCAGGGATGTGAAGGTGGATGG + Intronic
1071126505 10:82341748-82341770 ACAAAAGATGGGAAGGTGGGAGG - Intronic
1071137257 10:82466847-82466869 ACAGGCAAGGGGAAGGGGAAGGG + Intronic
1072047879 10:91674851-91674873 CCAGCCAATGGGAAGGAGGAAGG - Intergenic
1072215630 10:93285117-93285139 ACAGGCAATGGGAGGGTGAGGGG + Intergenic
1072323866 10:94277128-94277150 ACAAGCCAGAGGCAGGTGGAGGG - Intronic
1073114051 10:101080982-101081004 ACAAGGAATGAGAAGGAAGAGGG + Intergenic
1073435373 10:103512986-103513008 ACCAGAAATGAGAAGGTAGAGGG - Intronic
1074947273 10:118293421-118293443 AGAAGGAAAGGGAAGGTGCAGGG - Intergenic
1075162241 10:120034425-120034447 ACAAGGTATGGGAAGGTGAGGGG + Intergenic
1075428439 10:122361039-122361061 ACAGGCACTGGGAAGAGGGAGGG + Intergenic
1075559077 10:123455556-123455578 AGAGGAAATGGGAAGGTGCATGG + Intergenic
1076034910 10:127191410-127191432 GCAAGCATAGGGAAGGTAGATGG - Intronic
1076830101 10:132989845-132989867 AGAAGCAACGGGAAGTGGGATGG + Intergenic
1077370937 11:2181279-2181301 GCACACAATGGGGAGGTGGAAGG + Intergenic
1078331878 11:10429090-10429112 CCATGAAATGGGAAGGTGGGAGG - Intronic
1079960175 11:26914109-26914131 AAAAGCCATGTGAAGGTGCAGGG + Intergenic
1081760975 11:45576328-45576350 ACAAGCAAAGAGAAGGAGGCTGG + Intergenic
1082140915 11:48608090-48608112 ACAAGCAATAAGAAGGTTAATGG - Intergenic
1082568082 11:54704909-54704931 ACAAGCAATAAGAAGGTTAATGG - Intergenic
1082874188 11:57971427-57971449 GCAACAAATAGGAAGGTGGAAGG + Intergenic
1082931964 11:58617857-58617879 ACAGGGGATGGGGAGGTGGAGGG - Exonic
1083798872 11:65034972-65034994 CCAAGTTCTGGGAAGGTGGAAGG - Intronic
1084193495 11:67509724-67509746 ACAAGGCATGGGACGGAGGAGGG - Intergenic
1085001491 11:73040469-73040491 ACAAGACTTGGGAAGGAGGATGG - Intronic
1087417666 11:97878518-97878540 ATAATCAATGGTAAGGTGGAAGG + Intergenic
1088711185 11:112510150-112510172 ACAGGGAATGTGAAGGTAGATGG - Intergenic
1089118863 11:116117859-116117881 AGAAGCACAGGGAAGGAGGAGGG + Intergenic
1089834727 11:121359953-121359975 ACCAGAAATTGGAAGGTTGAGGG - Intergenic
1090509044 11:127352535-127352557 ACAAGGAAAGGAAAGATGGAAGG - Intergenic
1090648857 11:128789114-128789136 TGAAGCAAAGGGAAGGAGGAAGG + Intronic
1090964760 11:131588946-131588968 TCATGCAATGTGAAAGTGGAGGG + Intronic
1090998505 11:131888580-131888602 ACAAGGAAGTGGAAGGAGGAGGG - Intronic
1091618969 12:2071209-2071231 GGAAGCAAAGGGAAGGAGGAAGG - Intronic
1092110991 12:5964797-5964819 CCAAGAAAAGGAAAGGTGGAGGG + Intronic
1093100631 12:15024449-15024471 ACAATAAATGGCAGGGTGGAGGG - Intergenic
1093474943 12:19544326-19544348 ACAAACAATGGAAAGGGGAATGG - Intronic
1093990090 12:25580250-25580272 AACATCAATGGAAAGGTGGATGG - Intronic
1094446285 12:30534104-30534126 ACAAGCACTTGGAAGGAGGAGGG - Intergenic
1094690568 12:32764414-32764436 ACATACAATGGGAAGGGGCATGG - Intergenic
1095912410 12:47442053-47442075 AGAAGAAATGAAAAGGTGGAAGG - Intergenic
1096214680 12:49792595-49792617 AGGAACAAAGGGAAGGTGGATGG + Intronic
1096249937 12:50024500-50024522 ACAAAAGATGGGAAGGTGGAGGG + Intronic
1096748420 12:53743582-53743604 AGAAGGAAAGGGAAGGTGCAAGG - Intergenic
1096984776 12:55749058-55749080 ACAAGGAATGTGAAGGAGGTTGG + Intronic
1098169626 12:67733749-67733771 AGAAGAAATGGGAGGGAGGAGGG - Intergenic
1098922810 12:76318352-76318374 ACAGGCAATGTGCTGGTGGATGG - Intergenic
1099801350 12:87460641-87460663 ACAAGCTATGGGAGAGTGAAGGG + Intergenic
1100755831 12:97750076-97750098 AAAGGCAATGTGAAGGTGGAGGG - Intergenic
1100817364 12:98398976-98398998 ACAAGAAATGGGAGGGAGGAAGG + Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101328318 12:103736294-103736316 CCAGGCAGTGGGAAGGAGGAAGG + Intronic
1102215345 12:111157510-111157532 AGAATCAATGGAAAGGAGGAAGG + Intronic
1102906821 12:116682955-116682977 AGAAGCACTGGGAAGATAGAGGG + Intergenic
1103032762 12:117630664-117630686 CCCAGCAGTGGAAAGGTGGATGG + Intronic
1104476459 12:129074467-129074489 AGAAGCAATGGGGAAATGGATGG - Exonic
1104586262 12:130050424-130050446 AAAAGCAAAGCTAAGGTGGAAGG - Intergenic
1104901501 12:132191815-132191837 CGAAGCAAGGGGAAGGTGAAGGG - Intergenic
1104936598 12:132367806-132367828 ACAGGGAGTGGGAAGGTGGGGGG - Intergenic
1106224420 13:27774298-27774320 TCAAGCAATGAGAAGGTGTTTGG - Intergenic
1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG + Intergenic
1106664502 13:31837460-31837482 ACAAGGAAGGAGAAAGTGGAGGG + Intergenic
1107969147 13:45624649-45624671 ACATGGAATTGTAAGGTGGATGG - Intergenic
1111692411 13:91580707-91580729 GCAAGGAATAGGAAGGTGGATGG - Intronic
1112542149 13:100325307-100325329 TAAAGCAAAAGGAAGGTGGAAGG + Intronic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1112753903 13:102609302-102609324 ACAATCATGGGGAAGGTGAAGGG + Intronic
1113145909 13:107207189-107207211 AAAAGAAATGGGAAGGGAGATGG - Intronic
1113524576 13:110964708-110964730 ACTAGGAAAGGGAAGGTGCATGG - Intergenic
1114230566 14:20778031-20778053 ACGAGTTATGGGAAGGTGAAGGG - Intergenic
1114398617 14:22389074-22389096 AGAAGCAATGGGGTGGTGGTTGG + Intergenic
1114708917 14:24757202-24757224 ACTAGCCATGGACAGGTGGAGGG + Intergenic
1116047940 14:39766788-39766810 ACAAGAAAAGGGAAGTGGGAAGG + Intergenic
1116113294 14:40614219-40614241 AAAAGCAAAGGGAAAGTGGCAGG - Intergenic
1116669078 14:47817850-47817872 AGAAGCCATGGCAGGGTGGAAGG - Intergenic
1117079921 14:52141360-52141382 ACCAGCTCTGGGAAGGTGTAAGG - Intergenic
1118257321 14:64216314-64216336 ACAAGCAAATGGAAGGTGACAGG + Exonic
1119078125 14:71664967-71664989 CCTAGAAATGGGAAGGAGGATGG + Intronic
1119753692 14:77098711-77098733 CCAAGCAATGGGCAGGTGAGTGG + Intronic
1119953101 14:78766248-78766270 ACTAGCAGTGGGAAGGGAGAAGG + Intronic
1120627831 14:86851035-86851057 AGAACTAATTGGAAGGTGGAAGG - Intergenic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121111321 14:91315119-91315141 ACAAGCAGGAGAAAGGTGGAGGG - Intronic
1122580897 14:102770990-102771012 ATAAGCACGGGGAAGGTGGGAGG + Intergenic
1122890515 14:104730062-104730084 ACAGGCACTGGGAAGGTGAGGGG - Exonic
1123155271 14:106218706-106218728 ACAAGCAAGAGGAAAGTTGATGG + Intergenic
1123401937 15:19995840-19995862 ACAAGCAAGAGGAAAGTTGATGG + Intergenic
1123511278 15:21002504-21002526 ACAAGCAAGAGGAAAGTTGATGG + Intergenic
1123578108 15:21693275-21693297 ACAAGCAAGAGGAAAGTTGATGG + Intergenic
1123614733 15:22135757-22135779 ACAAGCAAGAGGAAAGTTGATGG + Intergenic
1123965665 15:25454442-25454464 ACATGAGATGGAAAGGTGGACGG - Intergenic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124431815 15:29614728-29614750 GCCAGCACTGGGAAGGTAGAAGG + Intergenic
1125082623 15:35693356-35693378 ACAGGAAATGGGAAGGTGATAGG - Intergenic
1125767855 15:42147058-42147080 AGAAGCAAGGGGCGGGTGGAAGG + Intronic
1127548999 15:60018404-60018426 AGAAGTAATGAGAAGATGGATGG + Intronic
1128885653 15:71284883-71284905 ACTAGCTATGGGGAGGGGGAAGG - Intronic
1130607352 15:85330012-85330034 ACAAGGAAAGGGAAAGTGAAAGG + Intergenic
1130879232 15:88040774-88040796 ACAAGAAAAGGAAAGATGGAGGG + Intronic
1131735520 15:95327177-95327199 ACGCGCTATGGGAAAGTGGAGGG + Intergenic
1202986978 15_KI270727v1_random:427520-427542 ACAAGCAAGAGGAAAGTTGATGG + Intergenic
1135008417 16:18849752-18849774 CCAAGAAATGGGAAGCTGAAAGG - Intronic
1135235702 16:20753733-20753755 ACAAGTAATGAAGAGGTGGAGGG + Intronic
1135284795 16:21184160-21184182 ACAAGTTATGGGAAGGTGAGGGG + Intergenic
1137000422 16:35225107-35225129 ACAAGCAAGGGGATGGCTGATGG - Intergenic
1137387215 16:48052757-48052779 AAAAGCCATGGGAGGGTGAAGGG + Intergenic
1137580127 16:49628470-49628492 ACAGACAATAGGTAGGTGGATGG - Intronic
1138329728 16:56204044-56204066 AAAGGCAATGAGAAGTTGGATGG + Intronic
1138691294 16:58771124-58771146 ACAGGGTATGGGATGGTGGAAGG + Intergenic
1138991923 16:62400740-62400762 ACAAGCAGTGGGATGGTGAGGGG + Intergenic
1139004269 16:62551532-62551554 ACAAGGAAAGGAAAGGGGGAAGG - Intergenic
1139770829 16:69274971-69274993 AAAAGGAAAGGGAAGGAGGAAGG - Intronic
1140346716 16:74220400-74220422 AAAAGTAATGAGCAGGTGGAGGG + Intergenic
1140409490 16:74733438-74733460 ACAAGCTGGGGGAAGGGGGAGGG - Intronic
1140540093 16:75749102-75749124 AAAAGGAAAGGGAAGGAGGAAGG + Intronic
1142550950 17:739108-739130 AAAAGCAATGGGAAAGCTGAGGG + Intronic
1143025232 17:3937677-3937699 AGAAGAGATGGGGAGGTGGAAGG - Intronic
1144382944 17:14720782-14720804 CCTAGTAATGGGATGGTGGAAGG - Intergenic
1145113900 17:20190409-20190431 ACAAGAAATGGGAAGGGGTAGGG - Intronic
1145779129 17:27550454-27550476 ACAAGCAATGTGATGAGGGAAGG - Intronic
1146048723 17:29532487-29532509 ACAAACACTGGGAAGGCCGAAGG - Intronic
1146184862 17:30718154-30718176 AGAAGTGATGGGAAGGTGGCAGG + Intergenic
1147371093 17:39993551-39993573 CCAAGTGATGGGAAGGAGGATGG - Intronic
1148789870 17:50167127-50167149 ACAAGGAATGGAAAGGTTGTGGG + Intronic
1148837070 17:50470917-50470939 AAAAGAAAAGGGAAAGTGGAGGG - Intronic
1149588413 17:57809409-57809431 ACAAGCAATGGGTATATGGATGG - Intergenic
1149755951 17:59185965-59185987 ACAAAGAATGGGAATTTGGAGGG + Intronic
1151236529 17:72724160-72724182 AAAAGCCATGGGAAGGGAGAAGG + Intronic
1151419334 17:73987050-73987072 AGGAGCAATGGAAAGTTGGAAGG + Intergenic
1151904689 17:77039997-77040019 ACAAGAAAGGGGAAGGCAGAAGG - Intergenic
1152082214 17:78195113-78195135 ACAAGAAATGGAATGGTGGTTGG + Intronic
1152350241 17:79780146-79780168 TCAAGCAATGGCAAGATGGGGGG + Intronic
1152811915 17:82386329-82386351 ACAGGCCAGGGGAAGGCGGAGGG - Intergenic
1153493958 18:5678385-5678407 AAAAGCAACCGGAAGGTGCAAGG - Intergenic
1154338257 18:13482743-13482765 ACAAGTTATGGGAAGGTGAGGGG + Intronic
1154957187 18:21270379-21270401 AGAATCATGGGGAAGGTGGATGG + Intronic
1155236519 18:23825239-23825261 AGAAGCCATGGGGAGTTGGAAGG + Intronic
1155503124 18:26506437-26506459 ACAAACACTGGGAGGTTGGAAGG + Intronic
1156538006 18:37882466-37882488 ACAAGGAATGGGAAGGACGTTGG + Intergenic
1156870867 18:41943525-41943547 ACAAATAATGGGAATGTGAAGGG + Intergenic
1157828263 18:50832236-50832258 AACAGCAAAGGGAAGGGGGAAGG - Intergenic
1158253675 18:55519991-55520013 TCAGGGGATGGGAAGGTGGAGGG - Intronic
1159258250 18:65976755-65976777 AAATGGAATGGGAAGGTGGCAGG + Intergenic
1160632311 18:80255106-80255128 ACAGGCAGTGGCAAGGTGGGTGG - Intergenic
1160912509 19:1481504-1481526 AAAAGCCAGGGGAAAGTGGAGGG - Exonic
1161391573 19:4023918-4023940 ACAGGAAATGGGAAGTTGGCTGG - Intronic
1162674525 19:12288927-12288949 ACAAAGAATGGGAATTTGGAGGG - Intronic
1162973919 19:14197541-14197563 AGAAGTGATGGGAAGGTGGCAGG - Intronic
1163554663 19:17985121-17985143 GCAGGCAAAGGGAATGTGGAAGG + Intronic
1163655887 19:18544482-18544504 TCAATAAATGGGTAGGTGGATGG + Intergenic
1163762790 19:19146346-19146368 ACAAGCCAGGGGGCGGTGGAGGG + Exonic
1165726294 19:38115313-38115335 GCAGGGAATGGGAAGGTGGGAGG - Intronic
1166980866 19:46631297-46631319 ACCAGGAATGTGAAGGAGGAAGG + Intergenic
1168121451 19:54254473-54254495 AGAAGCCACGGGCAGGTGGAGGG - Intronic
925563930 2:5229307-5229329 CCAAACAATGGGAAGATGCAAGG - Intergenic
926490878 2:13524888-13524910 AAAAGCAGTGGGAACGCGGAGGG - Intergenic
926530097 2:14033476-14033498 ACCAGGAAAGGGAAGGGGGAGGG + Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
928704005 2:33927867-33927889 CCAAGCAATTTGAAGGAGGATGG - Intergenic
928934900 2:36665635-36665657 CCAGCCAATGGGAAGATGGAGGG - Intergenic
929131243 2:38574958-38574980 ACAAGCAAATGGTAGGTGGCGGG - Intronic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929995150 2:46821406-46821428 ACAGGAGATGGGAAAGTGGAAGG + Intronic
932285180 2:70525606-70525628 AGAAGCAAGGGGCAGGAGGAGGG + Intronic
933150245 2:78905932-78905954 ACAAGCAATCTGAAGTTGGAAGG + Intergenic
933841052 2:86285905-86285927 TCAAGCAGAGGGAAGATGGAAGG + Intronic
935790834 2:106588548-106588570 AGAAGCAATGAGAAGTTGAACGG - Intergenic
936253622 2:110888685-110888707 CCAAGTAATGGGAAAGTAGAAGG - Intronic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
939912513 2:148000852-148000874 ACTATCAATGGGAAGATGGGGGG + Intronic
939958762 2:148547932-148547954 ACAGACAATGCCAAGGTGGATGG + Intergenic
940210236 2:151249314-151249336 ACAAACAAAGAGAAGGTTGAGGG + Exonic
941673632 2:168321300-168321322 GCAAGTTATGGGAAGGTGGGGGG - Intergenic
943093080 2:183396694-183396716 ACAATCAAAGGGAAGGTGAAAGG - Intergenic
944283928 2:197926464-197926486 ACAAAAAATGGGATGGTGAATGG - Intronic
945119230 2:206441812-206441834 ACAAGCAATGAGAAGGGAGAGGG - Intergenic
946736824 2:222762117-222762139 CCAAGCAATGGGAATGGGGAGGG + Intergenic
947063144 2:226189393-226189415 ACAAGTAATGGTAAGGTAGGAGG + Intergenic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
1168811714 20:709115-709137 ACAAAGAATGGGAAGTGGGAGGG - Intergenic
1170963817 20:21049038-21049060 AAAGGCACTGGGAGGGTGGAGGG + Intergenic
1172700204 20:36848611-36848633 AGAAGCACAGGGAAGGTGGGTGG + Intronic
1173054517 20:39597990-39598012 ACAAGGAATGAAAAGGTGAAAGG - Intergenic
1173553670 20:43950479-43950501 GCAAGCAGTGGGGAGGGGGAGGG - Intronic
1174444803 20:50583291-50583313 ACCAGTACTGGGAAGGAGGACGG + Exonic
1175078215 20:56393675-56393697 ACAAGTTATGGGACGGTGAACGG + Intronic
1178150551 21:29789250-29789272 ACAAAGAATGGGAATTTGGAAGG - Intronic
1178157761 21:29874420-29874442 ACAAAGAATGGGAATTTGGAAGG - Intronic
1178277812 21:31254833-31254855 GCAAGAAAGGGGAAGGAGGATGG + Intronic
1178312311 21:31539647-31539669 ACACGAAATGAGAAGGGGGAGGG + Intronic
1178886303 21:36487419-36487441 TCAAGAAATGGGAGGGAGGAGGG - Intronic
1179058747 21:37960003-37960025 GCAAAGAATGGGAAGTTGGAGGG + Intronic
1180085949 21:45507982-45508004 TGAATCAATGGGGAGGTGGATGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1182015335 22:27034392-27034414 GGAAGCAAAGGGAAAGTGGAAGG + Intergenic
1182785317 22:32902662-32902684 ACAAGCAAATGCAAGGAGGATGG + Intronic
1182954398 22:34407762-34407784 ACAAGTAGATGGAAGGTGGATGG + Intergenic
1183118739 22:35713147-35713169 AAAAGCAATGGGAATGAGCAGGG - Intergenic
1183426724 22:37743762-37743784 ACAAGCATTGGGAGGGGGAAGGG + Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1183706716 22:39478877-39478899 ACAAGAAGTGGGAAGAGGGAGGG + Intronic
1184810820 22:46830532-46830554 AGAAGCAAAGGGCTGGTGGAAGG + Intronic
949725647 3:7041294-7041316 CCTGGGAATGGGAAGGTGGAAGG - Intronic
951466299 3:23003892-23003914 CCAATCACTGGCAAGGTGGATGG + Intergenic
952368727 3:32698892-32698914 ACAAGCGAGGCGAAGGTGGGAGG - Intronic
953902009 3:46848859-46848881 ACAGACCAAGGGAAGGTGGAGGG + Intergenic
954460851 3:50626074-50626096 ACAAGCCATGGGGGGGTGGCGGG - Intronic
955015835 3:55067932-55067954 AGAAGCAAGGGGAAAGAGGACGG + Intronic
956242534 3:67146769-67146791 ACAAGCTATGGGAAGATGAGGGG - Intergenic
956562961 3:70602455-70602477 AAAAGCTATGGGAGTGTGGATGG + Intergenic
957322298 3:78647589-78647611 ACTAACAATGGAAAGGAGGAGGG + Intronic
957988930 3:87606885-87606907 ACAAGTTATGGGAAGGTGAGGGG + Intergenic
958734578 3:97993799-97993821 AAAAGGAAAGGGAAGGGGGAAGG - Intronic
961533972 3:127558031-127558053 ACTGGCAAATGGAAGGTGGAGGG + Intergenic
962950407 3:140213425-140213447 CCAAGCAATAGGCAGGTGGAAGG - Intronic
964008188 3:151856543-151856565 AGAAACAATGGTTAGGTGGAGGG - Intergenic
964059852 3:152507999-152508021 TCAGGCAATAGGAAGGAGGAAGG + Intergenic
964219566 3:154327878-154327900 AGAAGAAATGGAAAGGGGGAAGG - Intergenic
964833179 3:160908992-160909014 ACAAGCAATGGCAAGAGTGAAGG + Intronic
966809089 3:183827607-183827629 ACAGGCACTGGGAAGGCTGAGGG + Intergenic
966840789 3:184085545-184085567 ACAAAGAATGGGGAGTTGGAGGG - Intergenic
968923619 4:3535597-3535619 AGAGGCCATGTGAAGGTGGAAGG + Intergenic
969618753 4:8268502-8268524 TCGGGGAATGGGAAGGTGGAGGG - Intergenic
972353595 4:38260055-38260077 GCAGGAAATGGGATGGTGGAGGG - Intergenic
972364677 4:38363317-38363339 ACAAGGAATGGGAAGGTGAGGGG - Intergenic
973013281 4:45104360-45104382 AAAAGCAATGACAAGGAGGATGG + Intergenic
973873049 4:55185960-55185982 ACAAACCATGGACAGGTGGAAGG - Intergenic
974250658 4:59378858-59378880 ACAAGCAATTGGAAGCTGAGAGG - Intergenic
974817997 4:67031037-67031059 CAAAGAAATGGGAATGTGGAGGG + Intergenic
975596587 4:76052441-76052463 ACAAGGAAAGGAAAGGTAGATGG - Intronic
976050045 4:81000941-81000963 CAAAGCAATGGGAAGGTTGGGGG - Intergenic
976801144 4:88993644-88993666 CCAAACAATGGGAAGGGAGACGG + Intronic
978556002 4:109981205-109981227 ACTATAAATGGGGAGGTGGAGGG - Intronic
979109522 4:116734560-116734582 ACATGCAAAGGGAAGAGGGAAGG - Intergenic
979164035 4:117503515-117503537 ACAAGAAATGGGAAACTGCATGG - Intergenic
979469594 4:121078978-121079000 ACAAGAAATGGGATGATGGGTGG - Intergenic
979551035 4:121991309-121991331 AGAAGCCAAGAGAAGGTGGAAGG - Intergenic
980245890 4:130242381-130242403 GCAAGCAATTGGAAGGTGACTGG - Intergenic
980990900 4:139737454-139737476 AAAAGAAATGGGAAGGGGGTGGG + Intronic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
981270028 4:142835095-142835117 ATAAGCTTTGGGAATGTGGAAGG - Intronic
981496220 4:145396789-145396811 ACAAGTTATGGGAAGGTGACGGG - Intergenic
983040511 4:162919784-162919806 ACAAAAGAAGGGAAGGTGGAGGG + Intergenic
984842586 4:184082011-184082033 AACAGCAATGGGAAGCTGGTGGG - Intergenic
986211995 5:5682660-5682682 ACTAGGAAGGGGAAGGTGAAGGG + Intergenic
988060245 5:26158334-26158356 ACAAGTAAATGGATGGTGGATGG - Intergenic
988778637 5:34499445-34499467 ACAGGCATTAGGAAGGTGGGTGG - Intergenic
989375704 5:40757542-40757564 ACAAGGAAAGGGAAAGGGGAAGG + Intergenic
991471130 5:66970180-66970202 ACCAGCAAGGGTAGGGTGGAGGG - Intronic
992202402 5:74397409-74397431 TCAAGCAATGGGGAGTTGGGGGG - Intergenic
992659604 5:78945459-78945481 AAAGGCAGAGGGAAGGTGGATGG - Intronic
993130625 5:83893635-83893657 AGAAGAAATGGGAGGGTGGGAGG + Intergenic
993754724 5:91714328-91714350 AGAAGCAAGAGAAAGGTGGAGGG + Intergenic
994559073 5:101344808-101344830 ACATGCAATTGGAAATTGGAGGG + Intergenic
995475986 5:112548781-112548803 ACAGGCACTTGGAAGGAGGAGGG - Intergenic
996250033 5:121318093-121318115 AAAAGTAAAGGGATGGTGGAAGG + Intergenic
996487079 5:124049122-124049144 ACACTAAATGGAAAGGTGGAAGG - Intergenic
997622753 5:135309496-135309518 GCAAGGAATGGGCAGGAGGAGGG + Intronic
997709500 5:135991630-135991652 GGAAGCTATGGGATGGTGGAAGG + Intergenic
998435024 5:142100854-142100876 ACAAGTTATGGGAAGGTGAGGGG - Intergenic
999079970 5:148834028-148834050 ACTAGCAAGGGGCAGGGGGAGGG - Intergenic
999100702 5:149023517-149023539 TCAAGGAAAGGGAAGTTGGAAGG + Intronic
999147990 5:149408313-149408335 ACAAGAAGCGGGAAGGTGGAGGG - Intergenic
1000101602 5:158022227-158022249 AGAAGGAAGGGGAAGGTGAAGGG - Intergenic
1000282344 5:159793090-159793112 AGAAGGAATGGGAAGTGGGAGGG - Intergenic
1002086737 5:176780594-176780616 ACAGGAAACTGGAAGGTGGAAGG + Intergenic
1002456515 5:179348307-179348329 ACGAGCAATAGGCAGGTGTAGGG - Intergenic
1003215548 6:4106148-4106170 ACAAGTTATGGGAAGGTGAGGGG + Intronic
1003309384 6:4956199-4956221 GCAAGAAGTTGGAAGGTGGAAGG - Intergenic
1003364536 6:5459784-5459806 GGAAGAAATAGGAAGGTGGAGGG - Intronic
1003504144 6:6725796-6725818 AAATGCAATGAGAAGGGGGATGG - Intergenic
1004189334 6:13450494-13450516 ACCAGCAAAGAGAAGGTGCATGG + Intronic
1005206411 6:23410497-23410519 AAACGGAAAGGGAAGGTGGAAGG - Intergenic
1005233226 6:23729020-23729042 CCAAACAATGGGAAGGATGAAGG + Intergenic
1005536225 6:26758479-26758501 ACGAGCAAAGGGGAGGTGAAAGG - Intergenic
1005989892 6:30896233-30896255 ACAAGGGTTTGGAAGGTGGAGGG + Intronic
1006271330 6:32969187-32969209 ACAGCCAATGGGAGCGTGGAGGG + Intronic
1006590132 6:35148866-35148888 GCAAACCATGGGATGGTGGAAGG + Intergenic
1007247224 6:40471289-40471311 CCAAACCATGGGAAGATGGATGG + Intronic
1009007126 6:57800877-57800899 ACAAGCAAAGAGGAGGTGAAAGG - Intergenic
1009995214 6:70889118-70889140 CCAAGGGCTGGGAAGGTGGAGGG - Intronic
1011355378 6:86467827-86467849 ACAAGTAATGGGAGGGTGAGGGG + Intergenic
1011557216 6:88583772-88583794 GCACCCAATGGGGAGGTGGAGGG + Intergenic
1011802990 6:91039233-91039255 CCAAGCAACAGGAAGGAGGAGGG - Intergenic
1012744425 6:103066514-103066536 AGATACAATGTGAAGGTGGATGG - Intergenic
1015324886 6:131913678-131913700 ACTAGCAATGGAAATGTGGAAGG - Intergenic
1016503542 6:144750174-144750196 AGAAGCACAGGGAAGGAGGAGGG - Intronic
1017263817 6:152418893-152418915 ACAAGCTATGGGAGGGTGAGGGG - Intronic
1019313629 7:374752-374774 ACACGGAATGGGAAGGTGAATGG + Intergenic
1019846784 7:3510629-3510651 ACAAGTAATGGGAGGGAAGAAGG + Intronic
1020087159 7:5316708-5316730 ACAAAGAATGGGAAAGGGGAGGG + Intronic
1021266048 7:18523913-18523935 ACAAGCAATGGGAAGCAGGGCGG - Intronic
1021294024 7:18881441-18881463 ACAAGAAATGGAAAAGTGGAGGG - Intronic
1021736665 7:23645971-23645993 ACAGGAATTGGGAAGGAGGAGGG - Intergenic
1021848319 7:24783940-24783962 ACAGGCAGTGGAAATGTGGATGG + Intergenic
1021938799 7:25658523-25658545 ACAAGCACTTGAAAAGTGGAAGG + Intergenic
1022306005 7:29147101-29147123 ACAAGCAATGTGACCCTGGATGG - Intronic
1023373680 7:39535694-39535716 ACAACCAATAGGAGGGTGGGAGG - Intergenic
1023597513 7:41847162-41847184 ACAATAAATAGGAGGGTGGAGGG - Intergenic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024453510 7:49577157-49577179 ACAAGAACTGGGGAGATGGAAGG + Intergenic
1028038470 7:86017189-86017211 AAAAGCAATTGGAAGGGGAATGG + Intergenic
1028161773 7:87493952-87493974 ACAAACACTGGGGAGGTGTATGG + Intergenic
1028234925 7:88348860-88348882 ACTACCTATGAGAAGGTGGATGG - Intergenic
1028550819 7:92062865-92062887 ACTAGTAATGAGCAGGTGGAGGG + Intronic
1028638340 7:93016043-93016065 CCCAGCAAAGGGAAGGGGGAGGG - Intergenic
1029310452 7:99659097-99659119 ACCAGCAACGGAAAGCTGGATGG - Intronic
1029328292 7:99829000-99829022 ACAAGTTATGGGAAGGTGAAGGG - Intronic
1029971612 7:104795306-104795328 TCCGGCAATGGGAAGGAGGATGG - Intronic
1030154758 7:106442867-106442889 TTAAGCAATTGGATGGTGGATGG + Intergenic
1030629055 7:111875073-111875095 TCAAGAGATGGGAAGGAGGAAGG - Intronic
1031995245 7:128226409-128226431 AGAATGAATGGGAGGGTGGATGG - Intergenic
1032191736 7:129769676-129769698 ACAAGCTCTGGGAAGGTGAGTGG + Intergenic
1032427098 7:131830985-131831007 ACATGCACTGTGAAGGTGGGAGG - Intergenic
1032763791 7:134971197-134971219 ACTGGCAATGAGAAGGAGGATGG - Intergenic
1033531927 7:142272781-142272803 ACAAAAAATGGGGAGTTGGATGG - Intergenic
1033896509 7:146077590-146077612 ATAAACATGGGGAAGGTGGAGGG + Intergenic
1034470154 7:151250533-151250555 ACAAGCAGAGGGAAGGCAGAGGG - Intronic
1035948521 8:3992670-3992692 ACAAGGAATGCTAAGGTGGAAGG + Intronic
1036025212 8:4900099-4900121 GCCAGGCATGGGAAGGTGGAAGG - Intronic
1039226081 8:35389778-35389800 ACAAGCAATGGGAAGTTAAAGGG + Intronic
1039376140 8:37036181-37036203 ACAAGTTATGGGAAGGTGAGAGG - Intergenic
1039743062 8:40399727-40399749 ACAAAGCATGGGAAGGAGGATGG - Intergenic
1042869651 8:73386725-73386747 AAAATCAACGGGAAGGAGGAAGG + Intergenic
1043147561 8:76677143-76677165 ACAATGAATGGAAAGGTGCAGGG - Intergenic
1045574792 8:103408791-103408813 AAAAGGGATGGGAAGGAGGAGGG - Intronic
1048422178 8:134288020-134288042 TGAAACAATGGGAAGGTAGATGG + Intergenic
1049325265 8:142018245-142018267 ACAAGCAGCGGGAGGGGGGACGG - Intergenic
1051291501 9:15550269-15550291 ACAAACGATGGGAAGGTTGAGGG + Intergenic
1051378156 9:16426212-16426234 ACAAGGAATGGAAAGCTTGAGGG - Intronic
1051529524 9:18084704-18084726 GAAAGCAATGGGAGGGTGGGAGG - Intergenic
1051962086 9:22778972-22778994 ACCAGCAGTGGGAGGATGGAAGG - Intergenic
1052207661 9:25862877-25862899 ACAATCAATAGGCAGGTAGAAGG + Intergenic
1053145300 9:35707716-35707738 TCAAGCAATGGGAACCTTGATGG + Exonic
1053539776 9:38961673-38961695 ACAAGTTATGGGAAGGTGAGGGG + Intergenic
1053799331 9:41754619-41754641 AGAGGCCATGTGAAGGTGGAAGG + Intergenic
1054145886 9:61560378-61560400 AGAGGCCATGTGAAGGTGGAAGG - Intergenic
1054187740 9:61966680-61966702 AGAGGCCATGTGAAGGTGGAAGG + Intergenic
1054465630 9:65491482-65491504 AGAGGCCATGTGAAGGTGGAAGG - Intergenic
1054626365 9:67402245-67402267 ACAAGTTATGGGAAGGTGAGGGG - Intergenic
1054650776 9:67621901-67621923 AGAGGCCATGTGAAGGTGGAAGG - Intergenic
1054820280 9:69515227-69515249 AGAAAGAATGGGAATGTGGAGGG - Intronic
1054977591 9:71166020-71166042 ACATGCTATGGGAACCTGGAAGG - Intronic
1056103036 9:83318243-83318265 ACAAGATATGGGATGGTGGGAGG - Intronic
1057037501 9:91821951-91821973 ACAAGCAAAGGAAAGATGGAAGG + Intronic
1058426074 9:104876219-104876241 ATAAGCAATGGCAAGGCTGAGGG + Intronic
1058826104 9:108777368-108777390 GCAAGCACTTGGAAGGAGGAAGG - Intergenic
1059540579 9:115126435-115126457 AGAAGGAAAGGGAAGTTGGAGGG + Intergenic
1060769752 9:126323919-126323941 ACAAGAAATGTGAAGGTCCATGG - Intergenic
1061596278 9:131631497-131631519 TCCAGCAACAGGAAGGTGGAGGG - Intronic
1062096483 9:134706478-134706500 ACAGGCAAGGAGAAGGCGGATGG + Intronic
1062548793 9:137076767-137076789 CCAGGCAATGGGAAGCAGGAAGG + Intergenic
1185942721 X:4339276-4339298 ACATGCATTGGGAGAGTGGATGG + Intergenic
1186549331 X:10486340-10486362 ACAAGCAATTGGAAGTGGGCAGG - Intronic
1186791828 X:13007218-13007240 AGAAGAAATGGGAGGGTGGAGGG + Intergenic
1186807190 X:13152174-13152196 AGAAGCAATGAGAAGCTGGGAGG - Intergenic
1187337246 X:18391993-18392015 CCAATCAGTGGTAAGGTGGAGGG + Intergenic
1187475223 X:19604755-19604777 ACAACCAATGTGAAGATGGTTGG + Intronic
1187557918 X:20369671-20369693 ATAAGCACTGGCAAGGAGGATGG + Intergenic
1187799914 X:23050000-23050022 CCAAGCAATGGGAAGTGGGTTGG - Intergenic
1188498149 X:30799845-30799867 GCAAGGAATGGCAAGGTGCAAGG - Intergenic
1188717120 X:33474024-33474046 GCAAGCACTGGGCAGGGGGAGGG + Intergenic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1191601247 X:63011628-63011650 ACAAGCCATGAGAAAGTGGAAGG - Intergenic
1191671127 X:63750040-63750062 CCAAGAAATGGGATGGAGGAGGG - Intronic
1192016713 X:67339176-67339198 ACAAGCAAAGGGCAGGGGAATGG + Intergenic
1193560633 X:83012497-83012519 TCATGCAATGGGAAGAGGGAAGG + Intergenic
1195040223 X:101007348-101007370 AAAAGCAATAGGAAGTTGGCTGG + Intergenic
1197033602 X:121848501-121848523 GAAAGCAATGGGAAGATGGAGGG + Intergenic
1197077558 X:122371409-122371431 TCAGGGACTGGGAAGGTGGAGGG - Intergenic
1197857673 X:130934032-130934054 ACCAGCAATGGTGAGGTGGGAGG - Intergenic
1198309231 X:135413568-135413590 ACAATGGATGGGAAAGTGGAGGG - Intergenic
1198549262 X:137727349-137727371 AAAAGAAATGGGAAGGTGATGGG + Intergenic
1199467780 X:148158883-148158905 AGCAGCAGTGGGAAGGTAGAAGG - Intergenic