ID: 1070776675

View in Genome Browser
Species Human (GRCh38)
Location 10:79113793-79113815
Sequence TAGGAGCCATCAATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070776675_1070776680 3 Left 1070776675 10:79113793-79113815 CCCCTCTCCATTGATGGCTCCTA 0: 1
1: 0
2: 1
3: 8
4: 143
Right 1070776680 10:79113819-79113841 CAGTGTAGTATATTCACGTTTGG No data
1070776675_1070776681 23 Left 1070776675 10:79113793-79113815 CCCCTCTCCATTGATGGCTCCTA 0: 1
1: 0
2: 1
3: 8
4: 143
Right 1070776681 10:79113839-79113861 TGGAGCCCGTTCACCTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070776675 Original CRISPR TAGGAGCCATCAATGGAGAG GGG (reversed) Intronic
900720711 1:4174178-4174200 TAGCACCCATCAAGGGACAGTGG - Intergenic
901641927 1:10696984-10697006 TGGCAGCCAGCAATGGAGGGAGG + Intronic
906308493 1:44736719-44736741 GAGGAGCCAGCAAAGGAGATGGG - Intergenic
910291206 1:85602151-85602173 CAGGAACCCTCAAGGGAGAGAGG - Intergenic
915561341 1:156689986-156690008 TGGGGGCCATCAATGGGGACTGG + Intergenic
915594387 1:156887949-156887971 TAGGGGCTATCAGGGGAGAGAGG - Intergenic
916634279 1:166651579-166651601 AGGGAGCCATGACTGGAGAGTGG - Intergenic
921828679 1:219702617-219702639 GAGGAGCCATCCATGGAGGATGG - Intronic
921876291 1:220200211-220200233 AAGGAGCCAGCTATGGAAAGAGG - Intronic
923892536 1:238232013-238232035 TAGAAGCTGTCAATGGAAAGTGG - Intergenic
924103806 1:240630950-240630972 CAGAAGCAACCAATGGAGAGAGG + Intergenic
1063593437 10:7412293-7412315 TAGGGGCCAGCCATGGAGTGAGG + Intergenic
1065789699 10:29249639-29249661 TGGGACCCATCAATGGAGAGGGG - Intergenic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1074301907 10:112240733-112240755 TGGGAGCCAGGAGTGGAGAGAGG + Intergenic
1074422249 10:113319594-113319616 GAGGAGCCATGAGTGGAGACAGG - Intergenic
1075017933 10:118924614-118924636 AAGGAGCCCTCTAGGGAGAGGGG + Intergenic
1078187504 11:9064983-9065005 TAGAAGAGATGAATGGAGAGGGG - Intronic
1078271400 11:9798361-9798383 AAGGAGCCAGTGATGGAGAGGGG + Intronic
1083222165 11:61259474-61259496 AAGGAGCCATGAACGGAGGGAGG + Intronic
1084667868 11:70586212-70586234 CAGGAGTCAGCAAGGGAGAGAGG + Intronic
1084932391 11:72567453-72567475 TATTAGCGAGCAATGGAGAGAGG + Intergenic
1085042053 11:73332240-73332262 GGGAAGCCATCAGTGGAGAGTGG + Intronic
1086643119 11:89184907-89184929 TAGCAGCCATCTATGGTGGGGGG + Intronic
1088707954 11:112480698-112480720 TAGGAGCCAGCATTGGTGACTGG + Intergenic
1089385160 11:118062516-118062538 TGGGAGTCAACAATGGAGACAGG + Intergenic
1095737797 12:45576652-45576674 TTGGAGGCAACAATGGAGAGGGG + Intergenic
1096084651 12:48857559-48857581 AAGGAGGCAGCAACGGAGAGTGG - Exonic
1098287079 12:68918195-68918217 GAGGAGCCAAGAATGGAGATGGG - Intronic
1098391569 12:69974952-69974974 AAATAGCTATCAATGGAGAGTGG - Intergenic
1100876622 12:98968654-98968676 TAGGAGCCATTAAATGACAGAGG + Intronic
1109348506 13:61145788-61145810 GTGCAGCCATCAGTGGAGAGGGG - Intergenic
1109858338 13:68163184-68163206 TAGGTGCCATCAATTGATGGAGG + Intergenic
1111479595 13:88806902-88806924 TAGGAGCCATCAACTAAGATAGG + Intergenic
1118110359 14:62711628-62711650 CAGGAGCCAGCAATGCACAGCGG + Intronic
1118333033 14:64828464-64828486 TGGGAACCATTAAAGGAGAGGGG + Intronic
1123805885 15:23872741-23872763 TAATAGTCATGAATGGAGAGTGG + Intergenic
1123910221 15:24958452-24958474 TAGCATCCAGAAATGGAGAGAGG - Intronic
1126422876 15:48493431-48493453 TAAGAGAGATCAATGGGGAGAGG + Intronic
1126938596 15:53740171-53740193 AGGGAGACATCAATGCAGAGCGG - Intronic
1128256592 15:66201582-66201604 GAGGTGCCATCATTGCAGAGCGG - Intronic
1129736408 15:77967819-77967841 TAGGAAAAAGCAATGGAGAGTGG - Intergenic
1129955973 15:79637165-79637187 CAGGAGCCATCTCTGGAGCGGGG - Intergenic
1130313912 15:82779054-82779076 TAGGGGTCATCAATGGGGATGGG + Intronic
1130780261 15:87029905-87029927 TAGGAGCCATCAAGGGATGAAGG - Intergenic
1131183617 15:90257138-90257160 TTGAAGCCATCAATGAGGAGGGG - Exonic
1131732098 15:95292946-95292968 GAGGAGGCATCCGTGGAGAGTGG + Intergenic
1132643889 16:990027-990049 CAGGAGCCCTCAGGGGAGAGGGG + Intergenic
1138689527 16:58754274-58754296 TAACAGCTGTCAATGGAGAGGGG + Intergenic
1145912525 17:28550988-28551010 AAGCAGGCATCAATGGAGAGAGG - Intronic
1149591677 17:57834488-57834510 TAGGAGCAAGCAAAGGTGAGTGG - Intergenic
1150158210 17:62871705-62871727 AAGTACCCAGCAATGGAGAGGGG - Intergenic
1151248406 17:72814560-72814582 CAGTAGCCATCAGAGGAGAGGGG + Intronic
1158514304 18:58118780-58118802 CAGGGGCCTTCACTGGAGAGTGG - Intronic
1159368132 18:67496605-67496627 AAGGAGACATGAATGCAGAGAGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163398526 19:17077759-17077781 TCGCAGCCAGGAATGGAGAGTGG - Intronic
1165986033 19:39769748-39769770 TTGTAGCCATCAAGGGCGAGAGG - Intergenic
925312293 2:2893729-2893751 TAGGTGCCAGCACAGGAGAGAGG + Intergenic
925346971 2:3178470-3178492 GAGGACCCAGCAATGGACAGAGG + Intergenic
925476595 2:4223673-4223695 TAGGAGCCAGCAATGGCCTGTGG - Intergenic
927498752 2:23567684-23567706 TGGGGCCCATGAATGGAGAGAGG + Intronic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
931487873 2:62711686-62711708 GAGGAGCCAACAAAGGAGACAGG + Intronic
935127425 2:100236682-100236704 CAAGAACCATCCATGGAGAGTGG + Intergenic
936596639 2:113854532-113854554 AAGGGGCCATCTATGAAGAGTGG - Intergenic
936947703 2:117945449-117945471 GAGAAGCCATCACAGGAGAGTGG + Intronic
937356625 2:121201934-121201956 AAGGTGCCATCTCTGGAGAGGGG + Intergenic
937904381 2:127045822-127045844 TTGGAGCCAGGACTGGAGAGAGG - Intergenic
940359103 2:152778344-152778366 TAGTAGTTATAAATGGAGAGTGG + Intergenic
941878024 2:170454605-170454627 CTGGATCCATCAAAGGAGAGGGG + Intronic
942860840 2:180609950-180609972 TTGGAGCCATAAAGGGAGATGGG - Intergenic
943078706 2:183230522-183230544 TAGGGTCCATCAGTGGAGATTGG + Intergenic
943226544 2:185185618-185185640 GTGGAGCCCTCAGTGGAGAGGGG - Intergenic
943345631 2:186734426-186734448 GTGCAGCCCTCAATGGAGAGAGG + Intronic
1170025138 20:11881047-11881069 TAGGAGAGATTAATGGAGACTGG + Intergenic
1170373419 20:15674293-15674315 TAGAAGGCCTCACTGGAGAGGGG + Intronic
1172099707 20:32477823-32477845 TGGGACCCATCAAGGGAGTGAGG - Intronic
1172129775 20:32647937-32647959 TAGGTGCCATCAATGGATTGGGG - Intergenic
1172756476 20:37288802-37288824 TAGGAGCCTACAATGCAGAGAGG - Intergenic
1173125927 20:40336049-40336071 TAGGAGTCATTAATGGGGACTGG + Intergenic
1173328572 20:42055437-42055459 GAGGAGGCAAGAATGGAGAGAGG + Intergenic
1175679814 20:60977685-60977707 GAGGAGCCAGGAATGGAGGGGGG - Intergenic
1181432312 22:22888844-22888866 TTGGAGCAATAAAGGGAGAGGGG + Intronic
1182424666 22:30265817-30265839 AAGGAGCCACTTATGGAGAGAGG - Intronic
1183612200 22:38916745-38916767 TTGGACCCATCAGTGGAGAAAGG - Intergenic
1184843730 22:47067998-47068020 GAGGAGCCTTCCATTGAGAGGGG + Intronic
953805938 3:46067293-46067315 TAGGAGTTATCCAGGGAGAGGGG + Intergenic
956262494 3:67360202-67360224 CAGGAGTCATGAATGAAGAGAGG + Intergenic
957138482 3:76320851-76320873 TAGGAGCCTCCAATGGAAATAGG - Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
961468949 3:127099456-127099478 TCGGAGCCACCAAAGGACAGGGG + Intergenic
962029486 3:131584254-131584276 TAGGAGCCATCAACTAAGAGAGG - Intronic
962936477 3:140085693-140085715 CTGGGGCCAACAATGGAGAGAGG - Intronic
963027218 3:140931827-140931849 AAAGAGCCATCAATTGAGAATGG + Intergenic
964050985 3:152393255-152393277 TAAAAGCCATCAATGGCCAGGGG - Intronic
964168946 3:153744000-153744022 AAGCAGCTATAAATGGAGAGGGG + Intergenic
964379492 3:156083608-156083630 TAGGAGACATTAATGGAGCAGGG - Intronic
966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG + Intronic
967612724 3:191526885-191526907 TAGCAGGCAAAAATGGAGAGGGG - Intergenic
968959676 4:3736915-3736937 TGGAAGCCATCCATGGAGATTGG + Intergenic
972076643 4:35098457-35098479 TGAGAGACATCAATAGAGAGAGG + Intergenic
972155862 4:36160993-36161015 AAGGAGCCAAAAATGGAGACAGG + Intronic
973590450 4:52435545-52435567 CAGGAGACATGAAGGGAGAGAGG - Intergenic
974388938 4:61239436-61239458 TAATAGCCATCAGTGGAGTGGGG - Intronic
980743893 4:136990216-136990238 TAGCAGCCTTAACTGGAGAGGGG - Intergenic
981508027 4:145524722-145524744 TATGAACCAGCAATGGAGGGTGG - Intronic
986147504 5:5092449-5092471 TAGGAGCCATCTGTGGTCAGAGG - Intergenic
986699914 5:10396412-10396434 TAGGAGCCCTTAAGGCAGAGAGG + Intronic
987027554 5:13942714-13942736 GAGGAGACATCAATGGGGAGGGG - Intronic
998847912 5:146328714-146328736 TAGGAGGTATCAAAGGTGAGTGG - Intronic
1004619878 6:17323032-17323054 GAGGAGCCATCTATGAATAGTGG + Intergenic
1005325061 6:24692138-24692160 TAAGAGCCAGCAAAGGAGACTGG + Intronic
1006946463 6:37787774-37787796 TAAGAGGCAGCAATGGAGTGAGG - Intergenic
1007445499 6:41902403-41902425 CAGGAACCATCAATGGATATAGG + Intergenic
1008021001 6:46577013-46577035 TTAGAGCCAGCAATGGAGAAGGG + Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1012067623 6:94568690-94568712 TAGGAGCCATATGTGGAGAACGG + Intergenic
1012210554 6:96513093-96513115 CAGGAGCCAGTAATGCAGAGTGG - Intergenic
1012505105 6:99936459-99936481 AAGGAGCCAAGAATGGAGACAGG - Intronic
1017768380 6:157625440-157625462 TTGGAGTCATCAGTGTAGAGTGG + Intronic
1021182534 7:17524567-17524589 CAGCAGCCGTCAGTGGAGAGAGG + Intergenic
1022388442 7:29923365-29923387 AAGGAGCCAGGACTGGAGAGGGG + Intronic
1025601463 7:63002603-63002625 TATGAGTCATCAAAGGAGGGAGG - Intergenic
1028128646 7:87144630-87144652 TAGGAGTCATCAGTGTATAGAGG + Intergenic
1032500043 7:132393247-132393269 TAGGAGCCTAGAATGGGGAGTGG - Intronic
1033221886 7:139532408-139532430 GAGGAGCCAACATAGGAGAGAGG + Intronic
1036405972 8:8455631-8455653 TTGGAGCCATGAAGGGAGATGGG + Intergenic
1038954543 8:32452992-32453014 GAGTAGACATCAATGGAGAGTGG - Intronic
1039296401 8:36160363-36160385 GAGGAGCCAGCAAAGGAGACGGG + Intergenic
1039469546 8:37804746-37804768 GAGGAGCCATCCCTGGAGATGGG + Intronic
1039599263 8:38820466-38820488 TAGGAGCCCTCAGAAGAGAGGGG - Exonic
1041925310 8:63230143-63230165 TTGAAGCCAGCAAGGGAGAGAGG + Intergenic
1042677028 8:71332680-71332702 TGGGAGGCATCAAAGGAAAGGGG - Intronic
1042708031 8:71682912-71682934 TAGGAGCCAGAAATAGATAGGGG + Intergenic
1043770470 8:84192858-84192880 TATGAGTCATCAAAGGAGTGAGG + Intronic
1046655377 8:116888238-116888260 AAGGAGCCATCAAATCAGAGTGG + Intergenic
1051441875 9:17093475-17093497 AAGGAGGCATCTGTGGAGAGAGG - Intergenic
1059437448 9:114285229-114285251 AAGGAGCCACCAAGGCAGAGGGG + Intronic
1060435594 9:123590105-123590127 TAGGAACCATCCAAGGAGAGGGG - Intronic
1190789141 X:53683454-53683476 GAGGAGCAACCAATGAAGAGTGG - Intronic
1190936040 X:55000177-55000199 TAGGGGCAATGAATGGCGAGAGG - Intergenic
1192019918 X:67377231-67377253 GAGCAGCTATCAGTGGAGAGGGG + Intergenic
1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG + Exonic
1193282587 X:79671207-79671229 CAGGAGCATTCATTGGAGAGTGG - Intergenic
1196755367 X:119152779-119152801 AAGGAGCCATCAATGCAGTTTGG - Intergenic
1197717068 X:129717257-129717279 TGGGAGCCTTCATTGAAGAGTGG + Intergenic
1197836657 X:130701719-130701741 TAGGAGCCAGTATTGCAGAGTGG - Intronic
1198175242 X:134148384-134148406 TCAGAACCAGCAATGGAGAGTGG - Intergenic
1198210210 X:134509146-134509168 TAGGAAGGATAAATGGAGAGAGG - Intronic
1199302098 X:146224616-146224638 GAGGAGACATCACTGGAGAAAGG - Intergenic
1199504121 X:148542625-148542647 TAGCAGCCATCCATGCAGACAGG + Intronic
1200123588 X:153802743-153802765 TCCCAGCCATCAGTGGAGAGGGG + Exonic