ID: 1070779023

View in Genome Browser
Species Human (GRCh38)
Location 10:79126897-79126919
Sequence GACCCAAGGCTTCTCCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070779014_1070779023 18 Left 1070779014 10:79126856-79126878 CCCAGCACCTCGGGGGCAGTTGG No data
Right 1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG No data
1070779013_1070779023 19 Left 1070779013 10:79126855-79126877 CCCCAGCACCTCGGGGGCAGTTG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG No data
1070779021_1070779023 -6 Left 1070779021 10:79126880-79126902 CCAGAAGGCTGCTGCTGGACCCA No data
Right 1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG No data
1070779016_1070779023 17 Left 1070779016 10:79126857-79126879 CCAGCACCTCGGGGGCAGTTGGC 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG No data
1070779017_1070779023 11 Left 1070779017 10:79126863-79126885 CCTCGGGGGCAGTTGGCCCAGAA 0: 1
1: 0
2: 1
3: 4
4: 120
Right 1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG No data
1070779020_1070779023 -5 Left 1070779020 10:79126879-79126901 CCCAGAAGGCTGCTGCTGGACCC No data
Right 1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070779023 Original CRISPR GACCCAAGGCTTCTCCCCAG TGG Intronic
No off target data available for this crispr