ID: 1070779720

View in Genome Browser
Species Human (GRCh38)
Location 10:79130433-79130455
Sequence CCTGGCTGCAGCTCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 1, 2: 8, 3: 56, 4: 467}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070779720 Original CRISPR CCTGGCTGCAGCTCTGCTGC AGG (reversed) Intronic
900288128 1:1911534-1911556 CCTGGTTGCAGCTTGGCAGCGGG + Intergenic
900367474 1:2317098-2317120 CCTGGCTGAGGCCCTGCTGAAGG + Intergenic
900436971 1:2635418-2635440 CCTGGCCCCAGGGCTGCTGCAGG - Intergenic
900479144 1:2889842-2889864 CCTGCCTGGAACTGTGCTGCAGG - Intergenic
900774508 1:4572105-4572127 TCTTGCTGCAGCTCATCTGCAGG - Intergenic
901000671 1:6147367-6147389 CCTGGGTGCAGCCCTGCCCCGGG - Intronic
901055360 1:6446601-6446623 CCTGGCTGAGGCTCTGGAGCAGG + Intronic
901056296 1:6450067-6450089 CTTAGCTTCAGCCCTGCTGCAGG - Intronic
901235106 1:7663552-7663574 CCTCGGTGCTGCTCTGGTGCAGG - Exonic
901801060 1:11708206-11708228 CCTGGCTGCAGCCCTGGAGCTGG - Intronic
902048969 1:13546914-13546936 CCTGGCTGCTGTGCTCCTGCAGG - Intergenic
902152250 1:14452820-14452842 CCTTTCTTGAGCTCTGCTGCTGG + Intergenic
902173025 1:14628304-14628326 CCTGGCTGCTTATATGCTGCGGG - Intronic
902383162 1:16062070-16062092 TCTGGCCGCAACTCTCCTGCCGG - Intronic
902479006 1:16701988-16702010 CCTGGCTGAGGCTCTGGAGCAGG - Intergenic
903030632 1:20461821-20461843 CCTGGCCCCAGCTCTGCCACTGG + Intergenic
903168441 1:21537507-21537529 CCTGGCTGCTGCCCTGTGGCTGG - Intronic
903750030 1:25616216-25616238 CCGGGCTGCAGGGGTGCTGCTGG - Intergenic
904441740 1:30536201-30536223 CATGGCAGGAGGTCTGCTGCAGG - Intergenic
905287667 1:36893532-36893554 CATGGCTCCAGCTTTGGTGCGGG + Intronic
906695864 1:47823152-47823174 CTTGCCTGGAGATCTGCTGCAGG + Intronic
907409162 1:54272706-54272728 CCTGGAAGCTGCTCTGCCGCAGG - Intronic
908028998 1:59980244-59980266 CCTTGCAGGAGCTCTTCTGCAGG - Intergenic
908030854 1:59997788-59997810 TCTGGCTGCAGCTCCTCTTCTGG + Exonic
912557869 1:110529283-110529305 CCTGGCTAAAGTTCTGCTGTTGG + Intergenic
913002317 1:114593182-114593204 ACTGGCTGCTCCTCTGTTGCTGG + Intronic
913069272 1:115284764-115284786 GCTGGGTGGAGCCCTGCTGCAGG + Intergenic
913344585 1:117795534-117795556 CATGGTTACGGCTCTGCTGCTGG + Intergenic
913544412 1:119853308-119853330 CCTGGCCGTCGCGCTGCTGCAGG - Intergenic
915118468 1:153614429-153614451 CCTGCCTCCAGCTCTGCCCCAGG - Exonic
915236424 1:154486603-154486625 TCTGGGTCCAGCTCTTCTGCCGG + Exonic
915812613 1:158930706-158930728 CCTGCTTGCAGATCTGCTGCTGG + Intergenic
915819689 1:159008940-159008962 CCTGCTTGCAGATCTGCTGCTGG + Intronic
916053339 1:161051245-161051267 CTAGGCTGAAGCTCTGATGCTGG - Intronic
918404602 1:184199377-184199399 TCTGGCTCCAGCTCTGCTGATGG - Intergenic
920516487 1:206588167-206588189 TTTGCCTGAAGCTCTGCTGCTGG + Intronic
922792476 1:228317835-228317857 CCTGGGTGCATCTTTGCTGATGG + Intronic
922895212 1:229094665-229094687 CCTTGCTGCAGCTCTTCCCCAGG + Intergenic
922961264 1:229647578-229647600 CCTGGCTGCACTGCTGCGGCAGG + Exonic
923048922 1:230376574-230376596 CCTGGGGGCAGCTCTGCAGAGGG - Intronic
923971117 1:239204369-239204391 ACTGGCTGCAGAGATGCTGCAGG + Intergenic
1063091034 10:2866404-2866426 CGTGGCTGCTGCTTTTCTGCCGG - Intergenic
1063604132 10:7508110-7508132 CCTGGCTGGAGCCCTGTGGCGGG + Intergenic
1064289415 10:14020223-14020245 TCTGGCTGCTGCTATGCTGCTGG - Intronic
1066435763 10:35395825-35395847 CCTGGGTGCATCTCTGAGGCTGG + Intronic
1067170151 10:43899319-43899341 CCATGCTGCAGCTCTGCTACTGG + Intergenic
1067453163 10:46394846-46394868 CTTGGCTGCAGCTCTTCTCAAGG - Intergenic
1067582236 10:47452973-47452995 CCTGGCTGCACTGCTACTGCAGG - Intergenic
1067584072 10:47464920-47464942 CTTGGCTGCAGCTCTTCTCAAGG + Intronic
1067800579 10:49355810-49355832 TCTGGCTGCTGCTCTTCTCCTGG - Intergenic
1067938261 10:50629888-50629910 CTTTGCTGCAGCTCTGAGGCAGG - Intergenic
1068544082 10:58327071-58327093 GGTTGCTGCAGCCCTGCTGCGGG + Intergenic
1069191418 10:65495544-65495566 CCATGCTGCTGCTCTGCTTCTGG + Intergenic
1070060710 10:72980787-72980809 CCTGGGTGCAGGTCTGCTGGTGG + Intergenic
1070771060 10:79082592-79082614 CCTGCCTGCAGCTCTGCAGCTGG - Intronic
1070779720 10:79130433-79130455 CCTGGCTGCAGCTCTGCTGCAGG - Intronic
1070792073 10:79195498-79195520 CGTGGCTGCAGCTCTATAGCCGG - Intronic
1071509878 10:86254839-86254861 CCTGGCTGGGGCTGTGCAGCCGG - Intronic
1071526242 10:86361186-86361208 CTTGCCTGGGGCTCTGCTGCAGG - Intronic
1071826506 10:89331042-89331064 CTTGGGTGCAGCTCTACTCCTGG - Intronic
1071842901 10:89491277-89491299 CCTGGTTGCAACTCAGCTCCTGG - Intronic
1072050477 10:91698805-91698827 CATGGCTGTGGCTATGCTGCTGG + Intergenic
1072336587 10:94403204-94403226 CCAGGCAGCAGCTCCGCAGCGGG - Exonic
1072539943 10:96390611-96390633 GCTTGCTCCAGCTCTTCTGCTGG + Intronic
1072633230 10:97161218-97161240 CCTGGCTCCACCTCTTGTGCTGG - Intronic
1072792218 10:98326662-98326684 TCTAGCAACAGCTCTGCTGCAGG - Intergenic
1073185663 10:101613795-101613817 CCTGGCAGCAGCAGTGCTCCTGG - Intronic
1073398250 10:103236162-103236184 CTTCCCTGCAGCTCTCCTGCCGG - Intergenic
1073931774 10:108584835-108584857 CTTGGCCCCAGCTTTGCTGCAGG - Intergenic
1074203660 10:111261418-111261440 GCAGGTTGCAGCTCTGCTACAGG + Intergenic
1074698730 10:116074610-116074632 CCTGCCTGCCCCTTTGCTGCAGG - Intronic
1074732786 10:116395514-116395536 CCTGGCTACGGCTCTACTTCTGG - Intergenic
1075682415 10:124342243-124342265 CCCACCTGAAGCTCTGCTGCCGG + Intergenic
1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG + Intronic
1076735178 10:132455784-132455806 CCTGGCTTTCCCTCTGCTGCTGG - Intergenic
1076862414 10:133144983-133145005 CCTGGCTGCTGCTGGCCTGCAGG - Intergenic
1076898176 10:133324574-133324596 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1076898185 10:133324607-133324629 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1076898194 10:133324640-133324662 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1077365795 11:2161089-2161111 CCAGGCCCCAGCTCTGCAGCAGG - Exonic
1077407753 11:2390275-2390297 CCAGGTGTCAGCTCTGCTGCTGG - Intronic
1077610124 11:3638907-3638929 CCTAGCTGCACCCCTGCTGAAGG + Intronic
1077792888 11:5461004-5461026 CCTGGCCACAGCTCTTTTGCTGG - Intronic
1077902529 11:6500933-6500955 CCTGGCTGCTTCTCTGCAGGTGG + Intronic
1078106303 11:8360106-8360128 CCTGGCTGCTGCTAAGATGCAGG + Intergenic
1078377006 11:10804303-10804325 CCTGGTTGACCCTCTGCTGCTGG + Exonic
1078416718 11:11172146-11172168 CCTGGCTGCACCTCACTTGCTGG - Intergenic
1078449881 11:11432860-11432882 CCTGGCTCCAGCTTTGCTGGAGG + Intronic
1078508154 11:11967087-11967109 CCTGTCTGCAGCTCTGCACCCGG - Exonic
1078643149 11:13114504-13114526 CCTGGCCCCAGCTCTGTTTCAGG + Intergenic
1080859718 11:36142721-36142743 CCTGGCTGCAGCTGGGTTGGGGG - Intronic
1080875059 11:36267298-36267320 CCTGGAAGCAGCTTTTCTGCAGG - Intergenic
1081541471 11:44037599-44037621 CCTGGGAGCCTCTCTGCTGCGGG - Intergenic
1081915333 11:46726870-46726892 CCTGGGGGCAGGTGTGCTGCTGG + Intronic
1083627402 11:64078691-64078713 CCTGGCTCCCCCTTTGCTGCTGG - Intronic
1083638589 11:64133389-64133411 CCAGGCTGGAGCTCTCCTGCTGG + Intronic
1083877694 11:65532937-65532959 CGTGGGTGCAGCTCGGCAGCTGG + Intronic
1084278136 11:68066914-68066936 GCTGGCTGCAGCACTCCAGCTGG + Intronic
1084365364 11:68694038-68694060 CCTGGCGTCTGCTCTGCTCCTGG - Intergenic
1084947848 11:72648456-72648478 CCTGGCAGCAGCTCTGGGTCAGG + Intronic
1089094976 11:115912478-115912500 CCCGGCTGCCGCTCTGGTGGGGG + Intergenic
1089685937 11:120146968-120146990 TATGGCTGCAGCTCTGGTTCGGG - Intronic
1090441003 11:126725693-126725715 CCTCGCTGCAAGGCTGCTGCTGG + Intronic
1090611459 11:128474713-128474735 CCTGCCAGCATCTCAGCTGCTGG + Intronic
1090662322 11:128891123-128891145 CCCGGCTGCACCCCTGCTGCGGG - Intergenic
1091409342 12:228932-228954 CCTGGGTGCACCCCTGATGCAGG - Intronic
1091786142 12:3244438-3244460 CCTGGCTCCAGGGCTGCGGCTGG - Intronic
1092149974 12:6241189-6241211 CCATGCTGCAGCTTTGCTGAAGG + Intergenic
1093110218 12:15143065-15143087 GCTGTCTGAAGCTCTGCTGGAGG + Intronic
1094042414 12:26132005-26132027 CCTTGGTGAAGCTCTGCTTCAGG + Intronic
1094225684 12:28042673-28042695 CCAGGCTGAAGCTCTGGTGGAGG + Intergenic
1094502010 12:31030096-31030118 CGTGGCTGGAGCGCTTCTGCAGG + Intergenic
1094582055 12:31742590-31742612 CCTGGCTGCAGGTCTATTGAAGG - Intergenic
1095946678 12:47757877-47757899 CCTGGATGCAGCTCGGACGCTGG + Exonic
1096534622 12:52263418-52263440 CCTGGTTGCAGCTCATCTGATGG + Intronic
1096801789 12:54115327-54115349 CCTGCCTGAAGCTCTGGTGGTGG - Intergenic
1097076232 12:56397003-56397025 CCTCTCTGCATCTCTGCAGCTGG + Intergenic
1097367581 12:58734883-58734905 CCTGGCTGCATCTCTGACTCTGG - Intronic
1098812240 12:75109481-75109503 CCCAGCTGCAGCTCTCCTACAGG - Intronic
1098886822 12:75968965-75968987 CCGTGCTGCTTCTCTGCTGCTGG - Intergenic
1100852914 12:98732146-98732168 CCTGTCTGCAGCTCTCAAGCAGG + Intronic
1102152655 12:110699391-110699413 CCTGGGAGCTTCTCTGCTGCAGG - Intronic
1102428074 12:112860200-112860222 CCTGCCTGCAGCTCAAATGCTGG - Intronic
1103222297 12:119255851-119255873 ACTGAATGCTGCTCTGCTGCAGG - Intergenic
1103470037 12:121173053-121173075 CCTGACTGCAGCACTGGTGAGGG + Intronic
1104150577 12:126078592-126078614 CCTGGCATCAGATCTGCTGCGGG - Intergenic
1104690981 12:130826267-130826289 CCAGGCGCCACCTCTGCTGCCGG + Intronic
1104744923 12:131204545-131204567 CCTGGCTGCTGATCTCCTGCTGG - Intergenic
1104758377 12:131282787-131282809 CCAGGCCCCAGCTCTGCTGAGGG - Intergenic
1104789482 12:131472855-131472877 CCTGGCTGCTGATCTCCTGATGG + Intergenic
1104902572 12:132197379-132197401 CCTGGGTGCTGCTGTGATGCTGG - Intronic
1104988511 12:132611154-132611176 CCTGGCAGCAGGTGTCCTGCAGG - Intergenic
1106083824 13:26522783-26522805 CCTGAATGCAGCTCTGCTCAGGG + Intergenic
1106836650 13:33642400-33642422 CCTGGCTGGAGCTTTGCTCCAGG - Intergenic
1111192603 13:84830351-84830373 CCAGGCTGGAGGTCTGCTGATGG + Intergenic
1111213282 13:85108754-85108776 CCAGCCTGCAGCTCTGGGGCTGG + Intergenic
1112562270 13:100525498-100525520 CCTGGCTACAGCTCTACTCTGGG - Intronic
1113235654 13:108270036-108270058 GCTGGCTGCAACCTTGCTGCTGG + Exonic
1113463333 13:110496785-110496807 CCTGGCTGAGGCTGTGCTGATGG - Intronic
1113463508 13:110497765-110497787 CCTGACTGAGGCTGTGCTGCTGG - Intronic
1113463517 13:110497808-110497830 CCTGACTGAGGCTGTGCTGCTGG - Intronic
1113553721 13:111214295-111214317 CCTGGCCTCAGCCCTGGTGCTGG + Intronic
1113633168 13:111901742-111901764 CCTGGATGCGTCTCCGCTGCTGG - Intergenic
1113643601 13:111976266-111976288 CGCGGCTTCAGCTCTGCAGCCGG + Intergenic
1113861927 13:113491737-113491759 CAGGGCTGCATCTCTGCGGCCGG - Intronic
1117003929 14:51399124-51399146 CCTGGCCCCAGCTCTGCTCTTGG + Intergenic
1118774423 14:68964819-68964841 CCAGGCTGCCTCTCTCCTGCAGG + Intronic
1119130966 14:72172997-72173019 CCTGGCAGCAGCCCTGCCCCAGG - Intronic
1119323817 14:73746791-73746813 CCCTGCTGCAGCTCTGCAGGTGG + Intronic
1119389096 14:74278218-74278240 GCTGGCTCTAGCTGTGCTGCTGG - Intergenic
1121397956 14:93643653-93643675 CCTGGCAGCCCCGCTGCTGCTGG + Exonic
1122433758 14:101677651-101677673 CCTGGCTGCTACTCGGCTGACGG - Intergenic
1122765242 14:104064620-104064642 CTTGTCTTCAGCTCTGCTGAAGG + Intergenic
1122789105 14:104176898-104176920 CCGGGCTGCTCCTCTGCTCCAGG - Exonic
1122961451 14:105095626-105095648 ACTGGAGGCAGCTCTGCAGCAGG - Intergenic
1124250043 15:28101125-28101147 CTTGGCCGCAGCTGTCCTGCTGG - Intergenic
1124374473 15:29121529-29121551 CGTGGCTGAAGCTCGGCTCCAGG + Exonic
1124801804 15:32840057-32840079 CAGGGCTGCAGCTCTCCTCCCGG - Intronic
1124971647 15:34495184-34495206 CCTGGGCGCAGCTCTGCTCCAGG - Intergenic
1125318231 15:38454857-38454879 GCAGGCTGCAAGTCTGCTGCCGG + Intronic
1125363419 15:38888636-38888658 CCTGGCTAAAGCTCTGTTGTTGG + Intergenic
1125477361 15:40056054-40056076 CCTGGCTGCCACCCTGCAGCTGG - Intergenic
1125523594 15:40361781-40361803 CCTGGCTGCTGCACTGCTGAAGG - Intronic
1125724131 15:41859632-41859654 CCTGGCTTCTGCCCTCCTGCAGG - Intronic
1125932916 15:43612860-43612882 CCTGGCCCCAGACCTGCTGCTGG + Exonic
1125946015 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG + Intergenic
1126107615 15:45157007-45157029 CCTGTATGCAGTTCTGCTGCAGG - Intronic
1127870852 15:63072472-63072494 ACTGGCTTCAGCTGTGCTGCAGG + Intergenic
1127933098 15:63610662-63610684 GCAGGCTGCTGCTCTGCTCCTGG - Intronic
1128226689 15:66006608-66006630 CCTGGCTCTCTCTCTGCTGCTGG + Intronic
1128508995 15:68302159-68302181 CCTGGCTGCAGCTGGGCAGCAGG - Exonic
1129448351 15:75634563-75634585 CCTCTCTGCCCCTCTGCTGCTGG + Intergenic
1129764071 15:78149810-78149832 CCCGGCTGCGGCCCTGCTGCGGG + Intronic
1130512536 15:84601215-84601237 GCTGCCGGCAGCTCTGCTGGGGG + Intronic
1130725312 15:86432946-86432968 CCTGGCTGCAGGGCTGCTAGGGG + Intronic
1130909115 15:88258734-88258756 CCAGGCTGGAGCACTGATGCTGG - Intergenic
1131382529 15:91975630-91975652 CCTGGATGCAGCTTGTCTGCTGG - Intronic
1132301799 15:100780633-100780655 CCTGAGGGCAGGTCTGCTGCCGG - Intergenic
1132577162 16:669418-669440 CATGGGTGCAGCTCTGAGGCCGG - Intronic
1132615754 16:840462-840484 CCTTGCTGCAGCTCTGCTTCTGG + Intergenic
1132652177 16:1026496-1026518 CGTGGCTGGAGTTCTGTTGCTGG + Intergenic
1132668568 16:1093496-1093518 CCCGGCTACAGCTCGGCGGCCGG + Exonic
1132712173 16:1273850-1273872 CCTGTCTGCGGCTCCGATGCTGG - Intergenic
1132930736 16:2457995-2458017 CCCAACTGCAGCTCTGCTGTGGG + Exonic
1133283904 16:4681770-4681792 CCTGGCTGCTGCTCACCTGTCGG - Exonic
1133285439 16:4688540-4688562 CGGGGCTGCAGATCTGCTGTGGG + Intronic
1134029879 16:10983432-10983454 CCAGGCTGCTGCTGTTCTGCAGG + Intronic
1135004708 16:18809389-18809411 CCTGAGTGCAGCTGTCCTGCGGG + Exonic
1135532244 16:23264789-23264811 CCAGGCTGCATCTCTTCTGGAGG + Intergenic
1136239055 16:28933092-28933114 CCTGGCTGAGGCTCTGGTTCAGG - Exonic
1137056859 16:35750117-35750139 CCTGGCTGCAGCTTGGATGAGGG + Intergenic
1137239337 16:46641387-46641409 CTCTGCTGCAGGTCTGCTGCAGG - Intergenic
1137696073 16:50463011-50463033 CCAGGCTGCAGGTCTGCTGCAGG - Intergenic
1139505591 16:67396644-67396666 CCTGGCTGCTGCTCTGGAGAGGG + Intronic
1139957668 16:70700857-70700879 CCTGGCAGCGGCTCAGCTGTTGG - Intronic
1141541479 16:84726281-84726303 GCTGGCTACAGCTCTCCCGCCGG - Intronic
1141643891 16:85357222-85357244 CCAGGCTGGACCCCTGCTGCTGG - Intergenic
1142119624 16:88379544-88379566 CCTGGGGGCAGCTTTGCTCCAGG - Intergenic
1142196925 16:88743232-88743254 CCTGGCTTCACCTCTGCTCTCGG + Intronic
1142281540 16:89150737-89150759 CCTGGCTCCAGGGCTCCTGCAGG - Intronic
1142421397 16:89972656-89972678 CCTGGCCACCGCTCTACTGCCGG - Intergenic
1142960804 17:3551399-3551421 CCTGGCTCCAGGCCTGCTGTAGG + Intronic
1143389150 17:6549849-6549871 CCTGGCTGCAGACCTGGTGATGG + Intronic
1143836948 17:9700326-9700348 CCTGCCTGCAGCCGTGCTGGGGG - Intronic
1144584454 17:16479680-16479702 TTTCGCTACAGCTCTGCTGCTGG - Intronic
1144654166 17:17024947-17024969 CCTGGCTGGAGCCCTGCTCGAGG - Intergenic
1145943847 17:28758821-28758843 CCTCGCTGCACATCTGCTGTAGG + Exonic
1146008289 17:29176224-29176246 CCTGTTTGCAGCTTTACTGCTGG - Intronic
1146291152 17:31608243-31608265 CCATGCTGCTGCTCTGCTGATGG - Intergenic
1147258294 17:39195034-39195056 CTTGGCTGTAGCTCTGGGGCTGG - Intronic
1147310881 17:39595643-39595665 CCTGGCCTCTGCTCTTCTGCTGG - Intergenic
1147376170 17:40023557-40023579 CCTGGCCCCTGCTCTGCTCCTGG + Intronic
1147446368 17:40477605-40477627 CCTGGTGACTGCTCTGCTGCAGG - Exonic
1147526652 17:41231173-41231195 TCTGTCTGCTGCTCTGCTGACGG + Intronic
1148217901 17:45843776-45843798 CCTGGCTGCAACTCTGAGGCCGG - Intergenic
1148664000 17:49361631-49361653 CTTGGCTGCAGTTTTGCAGCGGG - Intronic
1149326327 17:55534041-55534063 CACGGCTCCATCTCTGCTGCTGG - Intergenic
1152675927 17:81641237-81641259 CCTGGCTGTGGAGCTGCTGCAGG + Intronic
1155052405 18:22160088-22160110 GCTGGCTGCACCTCTGCACCTGG - Intergenic
1157243592 18:46034114-46034136 CCTGGCTACAGCTCTGTTTCCGG - Intronic
1157669439 18:49515885-49515907 CCTGGCTCCAGCCCTGATTCTGG + Intergenic
1157721164 18:49925670-49925692 CCTGGCTGCACTCCTGCTTCTGG - Intronic
1157724953 18:49957311-49957333 CCTGTCAGCAGCTTTGCTGGGGG - Intronic
1157738648 18:50072941-50072963 CCTGGCTTCAACTCAGCTGATGG - Intronic
1157867453 18:51198140-51198162 TATGCCTGCAGCTCTGCTCCAGG - Intronic
1158260764 18:55603670-55603692 ACAGGCTGCATCTCTGCTGCTGG + Intronic
1158302607 18:56068355-56068377 CCTGGCTAGAACTCTGCTTCTGG + Intergenic
1159289944 18:66404207-66404229 CCTGTCTGGAGCTCTGCAGAGGG + Intergenic
1160011903 18:75112517-75112539 CCGGCCTGCAGCTCTGCTCCTGG + Intergenic
1160534830 18:79586205-79586227 CCTGGCTCCAGCACTCCTCCAGG + Intergenic
1160715828 19:576138-576160 GCTGGGGGCAGCTCGGCTGCGGG + Intronic
1160810447 19:1010829-1010851 CCTGGATGCGGACCTGCTGCAGG + Exonic
1161595570 19:5149525-5149547 CCTGACTGCCGTTCTGCTCCAGG - Intronic
1162124017 19:8489788-8489810 CCTGGCTGCTGCTGTTCTGTTGG + Intergenic
1163302584 19:16457360-16457382 CCTGGGTGTATGTCTGCTGCTGG - Intronic
1163433973 19:17284117-17284139 ACTGGCTGCAGCCCTGCGGACGG + Exonic
1163931297 19:20395203-20395225 CCAGGCTGGAGCACAGCTGCAGG + Intergenic
1164092153 19:21966395-21966417 CATGAATGCAGCTCTGCTTCAGG - Intronic
1164504098 19:28843905-28843927 AATGCCTCCAGCTCTGCTGCTGG + Intergenic
1164618814 19:29681807-29681829 GCTGGCCGCAGCTCTGCTCCTGG - Intergenic
1164853150 19:31501070-31501092 CCTGGCCGCAGCACTCCTGGCGG + Intergenic
1164888680 19:31804717-31804739 CCTGGCTGCAGCCCAGGTGTGGG + Intergenic
1165473424 19:36016194-36016216 CCAGGTTGCTGTTCTGCTGCTGG - Exonic
1166866173 19:45838745-45838767 CCAGGCTGCAGCTCTGCCTCTGG + Intronic
1167485120 19:49758257-49758279 TCTGGATGCAGCTCAGGTGCTGG + Intronic
1168130152 19:54312584-54312606 ACTGGCTGCAGCTGTGCAGATGG + Exonic
1168244764 19:55106683-55106705 CCAAGCAGCAGCTGTGCTGCAGG - Intronic
1168536570 19:57175253-57175275 GCTGGCTGGGGCTCTGCAGCAGG + Intergenic
1202713047 1_KI270714v1_random:27895-27917 CCTGGCTGAGGCTCTGGAGCAGG - Intergenic
925071995 2:976939-976961 CCAGGCTGCTGGTCTGCTGGTGG + Intronic
925220311 2:2134160-2134182 CATGGCTTCAGCTCTCATGCTGG + Intronic
925611045 2:5703429-5703451 CCTGGCCACAGATCTGCTGCAGG - Intergenic
925741895 2:7012658-7012680 CCAGGCTGCAGCCCTGCTGGAGG + Intronic
926284909 2:11481549-11481571 CCTGACTCCAGTTCTGCTTCTGG + Intergenic
927027943 2:19089654-19089676 CCAGGCTGCAGCCTTGCTGGTGG - Intergenic
927146203 2:20168197-20168219 TCAGCCTGCACCTCTGCTGCAGG + Intergenic
927240430 2:20915838-20915860 TCAGGCTGCAGCACTGTTGCAGG - Intergenic
927482724 2:23467170-23467192 GCTGACTGCTGCTCAGCTGCTGG + Intronic
927504871 2:23606322-23606344 CCTCCCAGCCGCTCTGCTGCTGG + Intronic
928374790 2:30765461-30765483 CCTGGCTGCAGCTTTTGTTCTGG + Intronic
928419639 2:31128333-31128355 CCTGCCTGCATCTCTAATGCCGG - Intronic
929266056 2:39920317-39920339 AGTGGCTGCAGCCCTGCTGATGG + Intergenic
929484691 2:42342903-42342925 CCCGGGTGCGGCACTGCTGCAGG - Intronic
929869830 2:45749437-45749459 CATGGGTGCAGTTCTGCTACAGG + Intronic
930153455 2:48081051-48081073 CCAGAATGCAGCTCTGCTCCTGG - Intergenic
931817013 2:65914388-65914410 CCAGGCTGCAGCCCTGCTCCTGG - Intergenic
932501709 2:72188034-72188056 GGTGGCTGCAGCTGTGCTGGGGG + Intronic
932685094 2:73862193-73862215 CGTGGCTGCAGCTCTGCAATAGG - Exonic
932716895 2:74107224-74107246 CTTGCCTGCAGCTCTGCAGGAGG - Exonic
933353457 2:81185352-81185374 TCTGACAGCATCTCTGCTGCAGG + Intergenic
934529615 2:95076830-95076852 CCTGGGTGCAGCTCACCTGGCGG + Intergenic
935396001 2:102609801-102609823 CCTGCCTGCATCTATGCTACAGG + Intergenic
935542796 2:104369407-104369429 CCTCTCTCCAGCTCTGCTGCTGG - Intergenic
935653135 2:105399023-105399045 GGTGGCTGCGGCTCCGCTGCCGG + Intronic
937224923 2:120363247-120363269 CCTGCCTCCAGCTCTGCCTCAGG - Intergenic
937239738 2:120452341-120452363 GCGTGCTGCAGCTCAGCTGCTGG - Intergenic
937981183 2:127616739-127616761 CCAGGCCACAGCTCTGCTTCAGG - Intronic
937993891 2:127679170-127679192 CCTGCCTGCCCCTCTGCAGCTGG - Intronic
938120774 2:128631710-128631732 CCTGGCTGTGGCTCTGGAGCTGG - Intergenic
939276711 2:140007612-140007634 CCTGGCTTCAGCTGGGCTGTGGG + Intergenic
939445760 2:142308450-142308472 CCTGAGTGTAGCTCTGCTGCTGG - Intergenic
939748515 2:146009617-146009639 CCTGACTGCAGCCCAGCAGCTGG - Intergenic
940606499 2:155930359-155930381 CCTGTCTCCAGCTCTGCTAATGG - Intergenic
941366888 2:164621118-164621140 CCTGTCTGCAGCACAGCCGCGGG + Exonic
942487638 2:176456088-176456110 TCCAGCTGCAGCTCTGCTCCAGG + Intergenic
942763469 2:179427444-179427466 CCTGGATGCAGGTCTGGTCCTGG - Intergenic
943758543 2:191584448-191584470 TCTGTCTGTAGCCCTGCTGCAGG + Intergenic
944303097 2:198146877-198146899 CTTGGCCTCAGCACTGCTGCTGG - Exonic
944801146 2:203239000-203239022 CCAGGCTGAGGCGCTGCTGCTGG + Exonic
945169405 2:206980151-206980173 CCTTGCTTCAGCTCAGCTCCGGG - Intergenic
947178084 2:227387700-227387722 TCTGGCAGCAGCACTTCTGCTGG + Intergenic
947200320 2:227609062-227609084 TCTGGCAGCAGCACTTCTGCTGG - Intergenic
947200980 2:227614555-227614577 TCTGGCAGCAGCACTTCTGCTGG + Intronic
948135641 2:235634022-235634044 CCAGGCTGCAACTCTGCGGCGGG - Intronic
948334143 2:237194403-237194425 CCTGCCCGTAGCTCTGCAGCTGG - Intergenic
948574576 2:238941424-238941446 CATGGCTGCAGCATTGCTCCTGG - Intergenic
948593230 2:239064321-239064343 CATGGCAGCAGCCCTGCTGGGGG + Intronic
948602305 2:239114304-239114326 CGAGGCAGCAGCTCTGCTGCTGG + Intronic
948660404 2:239503198-239503220 CACGGCGGCAGCTCTGATGCTGG + Intergenic
948761797 2:240196969-240196991 GCTGGCTGTGGCTCTGCTCCAGG + Intergenic
948964711 2:241369055-241369077 CATGGCTGCAGCTGAGATGCAGG - Intronic
1169632343 20:7647559-7647581 TCAGGCTGCAGTTCTGCTGATGG - Intergenic
1170578228 20:17680749-17680771 CCTGGCTCCGGCACTGCGGCGGG - Intronic
1170893501 20:20395194-20395216 ACTGGCTGCAGCCCAGCTGCAGG - Intronic
1171201255 20:23244262-23244284 CCCGCCTGCAGCTCTGCTGTGGG - Intergenic
1171368632 20:24645663-24645685 CCTGGGTGCAGACCTGCAGCTGG - Intronic
1171794920 20:29559139-29559161 CCTGCCTGAAGCTCTGGTGGTGG + Intergenic
1171853534 20:30325126-30325148 CCTGCCTGAAGCTCTGGTGGTGG - Intergenic
1174402990 20:50285852-50285874 CCGGGCTGCAGCTCTGTTGCTGG + Intergenic
1174565481 20:51461600-51461622 GGTGGCTGCTGCTGTGCTGCAGG - Intronic
1175264438 20:57694025-57694047 CCAGGCTGTGGCCCTGCTGCAGG - Intronic
1175317335 20:58058172-58058194 CCTAGCTGCTGCTCTGCTTCTGG + Intergenic
1175889467 20:62309924-62309946 CCTGGCTCCCGCTCTGCAGAAGG + Intronic
1175916668 20:62429146-62429168 TGAGGCTGCAGCTCTGCTGGGGG + Intergenic
1175982543 20:62746333-62746355 CCTGGCTGCAGTAGTGCTGGGGG - Intronic
1176194171 20:63829814-63829836 ACTGGATACATCTCTGCTGCTGG - Intronic
1178523201 21:33303266-33303288 CTTGACTGGAGCTCTGTTGCGGG + Intergenic
1179211363 21:39327211-39327233 TCTGGCTGGAGCTCAGCTGCAGG + Intergenic
1179534026 21:42039835-42039857 GCTGGCTGCAGGGCGGCTGCTGG + Intergenic
1179591277 21:42410335-42410357 CCTGGCCCCAACTCTGCTGTTGG + Intronic
1179709575 21:43205531-43205553 CCAGGCTCCAGCTGGGCTGCTGG + Intergenic
1179904177 21:44413664-44413686 CCTGGGTGCAGCTCTGCCCCCGG + Intronic
1180057926 21:45368619-45368641 CCACCCTGCAGCTCTCCTGCTGG + Intergenic
1180127468 21:45802180-45802202 CCTGGTAGCGGCTCTGCAGCTGG + Intronic
1180226673 21:46397613-46397635 CCTGGGTGCACCTGTGCAGCAGG - Intronic
1181142065 22:20813055-20813077 ACTGGATGCAGCCCAGCTGCTGG + Intronic
1181283347 22:21735577-21735599 CCTGGCTGCAGCTGCGCGGGCGG - Intronic
1181318962 22:21990195-21990217 CCTTGCTGAAGCTCTGTTGTAGG - Intergenic
1181902804 22:26169742-26169764 CCTCGCTCCAGCGCTGCCGCCGG - Exonic
1182444573 22:30382642-30382664 CCGGCCTGAAGCTCCGCTGCAGG + Intronic
1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG + Intronic
1182567563 22:31211687-31211709 CCTGGCTGAGGATCTGCTCCTGG + Intergenic
1182658234 22:31906500-31906522 CCAGGCTGCACCTGTGCTGGGGG + Exonic
1183092556 22:35532775-35532797 TCTGGCAGCAGCTGAGCTGCTGG - Intergenic
1183427729 22:37748415-37748437 CCTGGGTGCAGCTTTGCTCCCGG + Intronic
1183541241 22:38430634-38430656 CCTGGCTGCTGGGATGCTGCGGG - Intronic
1183714939 22:39528112-39528134 CCTGACTCCAGCTCTGCCCCCGG + Intergenic
1183937557 22:41272073-41272095 CCTGCGTGCAGCTCTGAGGCTGG - Intronic
1183983805 22:41558142-41558164 CATGGCTCCAGCGCTTCTGCTGG + Intergenic
1184114271 22:42413116-42413138 ACTGTCTGCTGCTCAGCTGCTGG - Intronic
1184331794 22:43832402-43832424 CCCGTCTGCAGGTCTGCTGCCGG - Intronic
1184492870 22:44820340-44820362 CCTCCCTGCAGCTCTGAAGCGGG + Intronic
1184514530 22:44953923-44953945 CCTGGCTTCACCTCTCCTGGCGG - Intronic
1184648395 22:45908338-45908360 CCTGGCTGCTGCTCTGCCTGTGG - Intergenic
1184726997 22:46352993-46353015 CCAGGCTGCAGCTCAGGTGTAGG + Intronic
1184825144 22:46945535-46945557 CCAGGCTGCAGCTGTGCTGACGG + Intronic
1185119767 22:48959452-48959474 CCTGCCTTCTGCTCTCCTGCAGG - Intergenic
1185331505 22:50254091-50254113 CCTGGCTTCATTTCTGCTCCAGG - Intronic
950020202 3:9781750-9781772 CCTTGCAGCTGCTCTGCAGCAGG + Intronic
950164002 3:10780028-10780050 CCTGACTGCCGCTCTGTGGCTGG + Intergenic
950432355 3:12958178-12958200 CCTGGCAGCTGCCGTGCTGCAGG - Intronic
950436495 3:12983492-12983514 CCAGGCTGCAGTTCTCCAGCAGG - Intronic
950638641 3:14333621-14333643 CCTGGAGGCAGCTCGGCTGGTGG + Intergenic
950655272 3:14432574-14432596 ACTGCCTGCAGCTCTGCTCCAGG - Intronic
952844473 3:37675456-37675478 CCTGTCTCCAGCTCTGCATCTGG + Intronic
954481658 3:50805784-50805806 CCTGGGTGCATGTCTGCTGGAGG + Intronic
954487044 3:50862647-50862669 CCTGGCTGCAGTGTGGCTGCAGG + Intronic
954612962 3:51955931-51955953 CCTCTCCGCCGCTCTGCTGCCGG + Exonic
954632747 3:52056133-52056155 CCTTGCTGCTGCTCGACTGCCGG - Exonic
954775267 3:53011521-53011543 CCTTCCTGCTGGTCTGCTGCTGG - Intronic
955656871 3:61253507-61253529 CCTGTCTCCAGATCTGCTTCTGG - Intergenic
956162540 3:66370529-66370551 GCTGGCTCCAGCACTGCTGATGG + Exonic
956848026 3:73201917-73201939 CCTGGCTGCCATTCTGCAGCTGG - Intergenic
960847933 3:122022030-122022052 CTTGGCTGCTGCTCTGCACCTGG - Exonic
961414692 3:126748799-126748821 CCGGGCTGCAGCCCTGCTCAGGG - Intronic
961438064 3:126932884-126932906 CCTGGCTGCCGCTGGGCTGAGGG + Intronic
961645135 3:128388863-128388885 CCAAGCTGCAGGTCTGCTGTTGG + Intronic
962334130 3:134510781-134510803 CCTGGCTGCAGTTCTGGCCCTGG + Intronic
963366569 3:144343139-144343161 CTTGGCTGGATTTCTGCTGCAGG + Intergenic
964873630 3:161340899-161340921 CCTGGCTCCAGCACTGGTGTGGG - Intergenic
967504938 3:190243496-190243518 CCTGGCATCTGCTCTGCTTCTGG + Intergenic
967695287 3:192524109-192524131 CTTAGTTGCAGCCCTGCTGCTGG - Intronic
968010609 3:195271545-195271567 CCTAGCTGCAGCTCGTGTGCAGG - Intergenic
968502489 4:957402-957424 CCTGGCTGAAGATCTGCAGAGGG - Intronic
968511178 4:996599-996621 CCTGGCCTCAGGTCTTCTGCAGG + Intronic
968565032 4:1307627-1307649 CTGGGGTGCAGGTCTGCTGCGGG - Intronic
968938972 4:3628181-3628203 CCTGGCTGCAGCTCAGATGCCGG - Intergenic
969031791 4:4221527-4221549 CCTGGTTGCAGCCCTGCTCAAGG + Intronic
969254985 4:5995391-5995413 CCCAGCTGCCGCCCTGCTGCAGG + Intergenic
969619608 4:8272523-8272545 TCTGGCAGCAGCTCTCCTGCAGG - Intronic
970269480 4:14329123-14329145 ACGTGCTGCAGCTCTGCTTCAGG - Intergenic
970508956 4:16761422-16761444 CCTGGCTGCAGGTCTGCACAAGG - Intronic
971296748 4:25400605-25400627 CATGGCTGCAGGTCTGCTGCAGG + Intronic
971869272 4:32215412-32215434 CCTGGTTGCCGCTCCGCTCCTGG - Intergenic
973271811 4:48269751-48269773 CCTGGCTGAAGCGCGGCTGCTGG + Exonic
973335206 4:48948924-48948946 GCTAGCAGCAGCTCTGCTGTAGG + Intergenic
974753654 4:66174572-66174594 CCAGGCTGGAGTTCTGCAGCAGG - Intergenic
975713640 4:77185105-77185127 CCTCTCTGCAGGTCTGCTTCAGG - Intronic
975769365 4:77704820-77704842 CCTGGCTGCTTCTCTTCTCCAGG - Intergenic
976392694 4:84522094-84522116 CATGGCTGGAGCTCTGCTAAGGG + Intergenic
978619350 4:110623020-110623042 CCTTGCCGCAGCTCAGCTCCAGG + Exonic
978822413 4:112980453-112980475 GCTGGCTGCAGCGGTGCGGCCGG - Intronic
979218430 4:118193572-118193594 GCTGCCTGCAGATCTGCTGCTGG + Intronic
981042663 4:140237762-140237784 CCTGGCTGCACATTGGCTGCTGG - Intergenic
982806158 4:159766442-159766464 ATTGGCTGCAGCTTGGCTGCTGG + Intergenic
982828413 4:160028320-160028342 CCTGGCAGCAGCCATGCTGTTGG - Intergenic
984583308 4:181534909-181534931 CCAGGCTCCAGCTCTTCTGGAGG + Intergenic
984598074 4:181694249-181694271 TTTGGCTCCAGGTCTGCTGCTGG + Intergenic
985629435 5:1007039-1007061 CCTGGGTGAAGATCTGCTGGTGG - Intergenic
985719312 5:1481072-1481094 CCTGGCTGCAGCGCCTCTGTGGG - Intronic
986210305 5:5665388-5665410 CCTTGCTGAAGCTCTGAAGCTGG - Intergenic
988455543 5:31384122-31384144 CCTGGATGCAACCCTCCTGCAGG - Intergenic
991917191 5:71616769-71616791 CCTGGCAGTTGCTCTGATGCCGG + Intronic
993810000 5:92464238-92464260 TTTGGCTGCATCTCTGCTGAAGG + Intergenic
994881369 5:105501485-105501507 CCTAGCAGCAGCTGTGCAGCTGG + Intergenic
995182356 5:109240684-109240706 CCTGTTTCCAGCTCTGCTGCAGG - Intergenic
995476585 5:112554307-112554329 CCTGGCAGCAGCTCTCATGTTGG + Intergenic
997304990 5:132830367-132830389 CCGCCCTGCAGCTCTGCAGCTGG + Intronic
997658534 5:135573088-135573110 CCAGGCTGCAGCTCAGGTGGAGG + Intronic
997710685 5:136001522-136001544 CCTGGCTGCAGGCATCCTGCCGG + Intergenic
997965391 5:138352603-138352625 CCAGGCTGCGGCTCCGCTCCCGG + Exonic
998004524 5:138648267-138648289 CGTGGCTGCCTCTCTGCAGCAGG + Intronic
998109263 5:139488470-139488492 ACTGGCTGCAGCTCTCAGGCTGG + Intergenic
998447762 5:142211625-142211647 CCTGGCGGGGTCTCTGCTGCTGG + Intergenic
999098734 5:149004845-149004867 CCTGGCAGCAGCGGTCCTGCTGG - Exonic
999694787 5:154179318-154179340 CCTTGCTGCAACTTTGCCGCAGG - Intronic
999734962 5:154506193-154506215 CCTGCCTGCAACCCTGCTTCTGG + Intergenic
999739415 5:154538702-154538724 GGTGGCTGTAGATCTGCTGCAGG + Intergenic
999921559 5:156327066-156327088 CTTGGCTGCAGTTCTGCAGTTGG + Exonic
1001014172 5:168125814-168125836 TCTGGCTTCAACTCTGTTGCTGG + Intronic
1001122413 5:168991556-168991578 CCTGCCTACAGGTTTGCTGCTGG - Intronic
1001496187 5:172188797-172188819 GCTGGCTGCCCGTCTGCTGCGGG + Intergenic
1002512729 5:179733286-179733308 CCTGGATGCAGCGCTGGTGCAGG - Exonic
1002878253 6:1229985-1230007 CCTGGCTGCCGCTCCCCTCCTGG - Intergenic
1002929831 6:1625389-1625411 GCTGGCTGCAGCTCCGCTCGTGG - Intronic
1003156749 6:3603394-3603416 CCACACTGCAGCTCTGCTGCTGG + Intergenic
1004374466 6:15079633-15079655 CCTGGCTGCTTCTCTGCTCAAGG - Intergenic
1006078569 6:31550584-31550606 TCTGGATGCAGGTCTGCTTCGGG - Intronic
1006169142 6:32083065-32083087 CCAGGCAGCAGCTCTCATGCAGG + Intronic
1006183482 6:32167548-32167570 TCTGGCTGCAGCTCTTCAGGCGG - Exonic
1006311432 6:33263960-33263982 ACTGGAAGCAGCCCTGCTGCTGG + Intronic
1006843545 6:37047513-37047535 CCAGGCTGCAGCTCTGCACGGGG - Intergenic
1007219303 6:40265817-40265839 TCTGGCTGCAGATCTGGTGGGGG + Intergenic
1007247207 6:40471208-40471230 CCTGGCTTCAGTTCTGGAGCCGG - Intronic
1007264794 6:40587963-40587985 CAGGGCTGCACCTCTGCAGCTGG + Intergenic
1007350944 6:41273024-41273046 CGTGCCTGCAGCACAGCTGCCGG - Intronic
1007521609 6:42454470-42454492 CCTGGCAGCAGCGCTGTGGCCGG + Intergenic
1007620844 6:43213583-43213605 CCGGGCTGAGCCTCTGCTGCTGG + Intronic
1007842929 6:44731396-44731418 CCCTGCTGCTGCCCTGCTGCTGG - Intergenic
1008597607 6:53058986-53059008 CCTGGCTGCAGCTCTGCTTCTGG - Intronic
1010303571 6:74289516-74289538 CCTGGCTGCACCTCTGCTGGGGG + Intergenic
1011696508 6:89918041-89918063 CCTGGCTGCCTCTGTGCTGGGGG + Intergenic
1011999622 6:93637181-93637203 CCTCGCTGCCGCCCTGCAGCTGG + Intergenic
1013117416 6:107114275-107114297 CCAGGCTTCAGCTTTGCGGCCGG + Exonic
1015503107 6:133953375-133953397 CGCGGCGGCAGCGCTGCTGCCGG - Exonic
1016561225 6:145397061-145397083 CCTGCCTAAAGCTCTTCTGCTGG + Intergenic
1017083941 6:150696265-150696287 CCTGGCTGCAGCTCTACCCTGGG - Intronic
1017564150 6:155666293-155666315 TCTCCCTGCAGCTCTGCCGCAGG - Intergenic
1017950248 6:159130107-159130129 CCTGGTGGAAGCTCTGCTCCAGG + Intergenic
1019093865 6:169563246-169563268 CCTGGCTGCAGCGGAGTTGCAGG - Intronic
1019287182 7:229470-229492 CCTGCCTGCAGCCCTGTGGCTGG + Exonic
1019832436 7:3346253-3346275 CTTGTCTGCAGCTCTGGGGCTGG + Intronic
1020009898 7:4802068-4802090 CCTGGCGGCCCTTCTGCTGCAGG - Intronic
1020130922 7:5558162-5558184 CCTGGCCGGAGCACTGTTGCGGG + Intronic
1021920850 7:25483504-25483526 CCTGGCTTGAGCTGTGCTTCAGG + Intergenic
1022256660 7:28665151-28665173 CCTAGCTTGACCTCTGCTGCTGG + Intronic
1023395105 7:39745110-39745132 CCTGCCTGGGTCTCTGCTGCTGG - Intergenic
1023885128 7:44348902-44348924 ACTGGCTGCAGACCTGCTTCGGG + Intergenic
1024476106 7:49813218-49813240 CCTGCCTCCTGCTCTCCTGCAGG + Intronic
1026211179 7:68306833-68306855 CATGCTTGCAGCTCTGCTGCAGG + Intergenic
1028096376 7:86765932-86765954 ACTGGGGGCAGCTCTGCTCCAGG + Intronic
1029047806 7:97649383-97649405 TCAGGCTGCACCTGTGCTGCAGG - Intergenic
1029194206 7:98793267-98793289 CCTGGTGGCATTTCTGCTGCAGG - Intergenic
1029482579 7:100822306-100822328 ACGGGCTGCAGCTGTGCTCCGGG - Exonic
1029528223 7:101108515-101108537 CCGGTCAGCAGCTCTGCAGCAGG - Intergenic
1032066262 7:128773870-128773892 CCAGGTTGCAGCTCAGCAGCAGG - Exonic
1032711462 7:134463835-134463857 CCTGGGTGCATGTCTGCTGGGGG - Intergenic
1033879997 7:145869242-145869264 CCTGAGAGCAGCTCTGCTACTGG + Intergenic
1034295848 7:149971862-149971884 CCTGACTGCATCTCAGCTGTTGG + Intergenic
1034392010 7:150794190-150794212 CCTCTCTGCAGCTCTGATTCTGG + Intronic
1034435418 7:151060733-151060755 CCTGGCTGAAGGCCTGCTGAGGG + Intronic
1034488002 7:151378214-151378236 CCTGGCTGCTGCTGTGGTCCTGG - Exonic
1034810205 7:154125042-154125064 CCTGACTGCATCTCAGCTGTTGG - Intronic
1034883009 7:154776595-154776617 CCTGGCTCCAGTTCTGCAGCAGG + Intronic
1034940264 7:155226233-155226255 CCTGGCTGCAGTCCTGCCCCCGG + Intergenic
1035108425 7:156460933-156460955 TCTGGGTGCAGCTCAGCTGTGGG + Intergenic
1035704848 8:1667848-1667870 CCTAGCTGTGTCTCTGCTGCTGG + Intronic
1035704870 8:1668014-1668036 CCTAGCTGTGTCTCTGCTGCTGG + Intronic
1036569018 8:9963431-9963453 CCTGTCTCCATCACTGCTGCCGG - Intergenic
1036578849 8:10054452-10054474 TCCGGCTGCGGCTCCGCTGCCGG + Exonic
1038425793 8:27463074-27463096 CAAGGCTGAGGCTCTGCTGCAGG - Exonic
1038443032 8:27584835-27584857 CTTGGCTGCAGATCTGAGGCTGG + Intergenic
1038583957 8:28772944-28772966 GCTGTCTCCAGCTCTGCTGTGGG + Intronic
1039803711 8:40981438-40981460 CCAGCTTTCAGCTCTGCTGCAGG + Intergenic
1039826329 8:41176959-41176981 ACTGGCTGTAGCTCTACTTCTGG - Intergenic
1040616594 8:49043719-49043741 CCTGGCTCCAGAGCAGCTGCTGG + Intergenic
1041381759 8:57259553-57259575 CCCTGCTGCAGCTGTGCTGCGGG - Intergenic
1044706195 8:95011021-95011043 CCTGCCTCCATCACTGCTGCGGG + Intronic
1044725496 8:95191257-95191279 CCTGGATCCAGCTCCGGTGCAGG + Intergenic
1045051673 8:98332877-98332899 TCTGACAGCAGCTCTGCAGCTGG - Intergenic
1049190167 8:141282970-141282992 CCGGTCTGCAGCTTTGCCGCAGG - Intronic
1049258741 8:141627616-141627638 CCTGTCTGCATAGCTGCTGCTGG + Intergenic
1049265912 8:141667810-141667832 CCTGGGTGGAGCTCAGCTGGGGG + Intergenic
1049389858 8:142362087-142362109 CCACGCTGCAGCTCCTCTGCCGG + Intronic
1049801645 8:144520480-144520502 GCCCGCTGCGGCTCTGCTGCCGG + Exonic
1054451773 9:65407139-65407161 CCTGGCTGCAGCTCAGATGCTGG + Intergenic
1054473601 9:65557466-65557488 CCTGCTTGCAGCTCTGATGGTGG + Intergenic
1056763477 9:89430452-89430474 CCTGGCTGCTGCCCCTCTGCAGG - Intronic
1057624267 9:96663694-96663716 CCTGGCTGCATCTCTGCCTCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058237805 9:102514735-102514757 CTTGGCTGCAGCCCAGCTGCAGG - Intergenic
1058428980 9:104901288-104901310 TCTGGTTGCAGCTCAGTTGCTGG + Intronic
1059896144 9:118868221-118868243 CCTGTCTGGAGGTTTGCTGCTGG - Intergenic
1060416935 9:123437371-123437393 TCTGACGGCAGCTCTGCAGCGGG - Intronic
1060449699 9:123725579-123725601 CCTGCCTGCAGTTCTGCTCGTGG - Intronic
1060643866 9:125261801-125261823 CGTGGCGGCAGCGCCGCTGCAGG + Intronic
1060929398 9:127479454-127479476 TCTGGCTGCTGCTCTGCTGAAGG - Exonic
1060991908 9:127854313-127854335 TCTGGCTGTTGCCCTGCTGCTGG - Exonic
1061227424 9:129288795-129288817 CCAGGCTGCAGGCCTGCTGTCGG + Intergenic
1061605247 9:131705228-131705250 CCTGGCTGCAGTTTCCCTGCTGG - Intronic
1062004807 9:134233822-134233844 CCTGGCTGCAGCTGGGGAGCTGG - Intergenic
1062346689 9:136118385-136118407 CCTGGCTGCAGAGCCCCTGCCGG + Intronic
1062569166 9:137176761-137176783 GCTGGCTGCTGCTCTGCTGTTGG + Intronic
1062637842 9:137500830-137500852 CCTGGCTGCCGATCTTCCGCTGG + Exonic
1185803351 X:3033306-3033328 CATGGCTGCAGCCTTGCTGTGGG + Exonic
1187311626 X:18149613-18149635 CCTATCTCCAGCTCTGCTTCTGG + Intergenic
1187525534 X:20050849-20050871 CATGACTGAAGCTCTGCTTCTGG + Exonic
1188105131 X:26139926-26139948 CCTGGCTGCAGCTCTGGCTTGGG - Exonic
1188111620 X:26200658-26200680 CCTGGCTGCAGCTATACCTCAGG - Intergenic
1188442369 X:30224904-30224926 CCTGGCTGCAGCTCTGGCTCAGG - Intergenic
1188444608 X:30243085-30243107 CCTGGCTGCAACTCTGGGCCGGG - Exonic
1189561281 X:42193829-42193851 CCTGGCTGCAAATATGCAGCTGG - Intergenic
1190065959 X:47241955-47241977 CCTAGCTGGAGCTCTGCCTCTGG + Intronic
1193675560 X:84447936-84447958 CTGTGCTGCAGCTCTGCTACTGG - Intronic
1194021356 X:88695410-88695432 CTCTGCTGCAGGTCTGCTGCAGG - Intergenic
1194798672 X:98243308-98243330 CCTGACTACAGCTGTGCTCCTGG + Intergenic
1195093814 X:101487609-101487631 TCTGCCTGCATGTCTGCTGCAGG + Intronic
1196042255 X:111217548-111217570 CCTGGGTGCAGCTCTGTCTCTGG - Intronic
1198743710 X:139867898-139867920 CATGGCTGCAGCTTTGGTCCAGG - Intronic
1199872218 X:151909686-151909708 CCTACCTGCATCTCAGCTGCTGG - Intergenic
1200067768 X:153512377-153512399 CCTGGCTGCCCCTGTGCAGCAGG - Intergenic
1201273554 Y:12278514-12278536 TCTGGCTGCAACTCTGATCCTGG + Intergenic
1202026422 Y:20528607-20528629 CCTTGCTGCAGCCTTGCAGCTGG - Intergenic