ID: 1070780592

View in Genome Browser
Species Human (GRCh38)
Location 10:79135458-79135480
Sequence CTGGTGGCTTGGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070780592_1070780599 1 Left 1070780592 10:79135458-79135480 CCCATTTCCCACCAAGCCACCAG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1070780599 10:79135482-79135504 TGCGAGTGTGTCACTTCACATGG No data
1070780592_1070780601 27 Left 1070780592 10:79135458-79135480 CCCATTTCCCACCAAGCCACCAG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1070780601 10:79135508-79135530 TGCGGTGCACCTGTTTCCCCTGG No data
1070780592_1070780600 9 Left 1070780592 10:79135458-79135480 CCCATTTCCCACCAAGCCACCAG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1070780600 10:79135490-79135512 TGTCACTTCACATGGACATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070780592 Original CRISPR CTGGTGGCTTGGTGGGAAAT GGG (reversed) Intronic
900896778 1:5488184-5488206 ATGGTGACTAGGTGGTAAATGGG - Intergenic
902918236 1:19651516-19651538 ATGGAGGCTTACTGGGAAATGGG - Intronic
905021350 1:34815666-34815688 CTGGGAGCTTGGGGGGCAATGGG + Intronic
905605193 1:39291852-39291874 CTGCTGGCTTGGTAGGAAAATGG - Intronic
908069870 1:60448335-60448357 CTGGTTGTTTGGTGGTAACTGGG + Intergenic
908992964 1:70115978-70116000 AATGTGGCTTGTTGGGAAATTGG + Intronic
910980689 1:92957890-92957912 GTGGTTGCCTGGGGGGAAATGGG - Intronic
911236280 1:95415731-95415753 CTGATGGCTGGGTGGAAAATGGG + Intergenic
911295406 1:96108585-96108607 CTGGAGGCTTGTGGGGCAATGGG - Intergenic
912457867 1:109810604-109810626 TTGGTGGGTTGATGGGAAACTGG - Intergenic
912518031 1:110228022-110228044 CAGGTGGGTTGCTGGGAAACAGG + Intronic
916061613 1:161102636-161102658 CTCATAGTTTGGTGGGAAATAGG + Intronic
916837358 1:168560868-168560890 CTGGAGGCTTGGTGGGAGAGAGG + Intergenic
917932689 1:179834401-179834423 CTAGTGATCTGGTGGGAAATTGG - Intergenic
918105079 1:181409979-181410001 CTGGTGGCCTGGTGAGAGCTGGG + Intergenic
918811704 1:189130529-189130551 CTGATGGTTTGGTGAGAAATGGG + Intergenic
919927852 1:202201740-202201762 CTGGTGGATGGGAGGGAAATGGG - Intronic
921127767 1:212193202-212193224 CTGGGGGGTTGGGGGAAAATGGG - Intergenic
921621750 1:217333123-217333145 CTGGTGTCTTTGTGGAAACTGGG + Intergenic
922178064 1:223212531-223212553 CTGATGGCTTGGTGGGAGGTGGG + Intergenic
922980102 1:229818510-229818532 CTGGTGGTAGAGTGGGAAATTGG - Intergenic
1063102327 10:2961562-2961584 CTGGTTGATTGGTGGGCACTTGG + Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1068322652 10:55439718-55439740 CTGATTGCTTGGTAGGTAATAGG + Intronic
1069737805 10:70669030-70669052 CTGGTGGCCTGCTGGGAGATGGG + Intergenic
1069945613 10:71983371-71983393 CTGCTGGCTTCCTGGGAAACAGG - Intronic
1070663033 10:78321321-78321343 ATGGTGGCTGGGTGGGGAGTGGG + Intergenic
1070780592 10:79135458-79135480 CTGGTGGCTTGGTGGGAAATGGG - Intronic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1076608761 10:131707203-131707225 CTGGTGGCTTGACGGGCAGTTGG - Intergenic
1077143736 11:1035850-1035872 CTGGTGCCTTGGTCGGCAAGAGG + Intronic
1077274152 11:1695657-1695679 CTGCTGTCTTGGTTGGAAAGAGG - Intergenic
1078556318 11:12329467-12329489 GAGGTGGCATGGTGGGAAGTGGG + Intronic
1078565235 11:12408799-12408821 ATAGTGGCTTGGTGGGAAGCGGG + Intronic
1079026845 11:16955739-16955761 ATGGGGGCTTGGGGGAAAATGGG + Intronic
1080646978 11:34194549-34194571 CTGGGGCCTTGATGGGACATTGG + Intronic
1082163539 11:48912613-48912635 CTGGTGCCTTCTTTGGAAATCGG - Intergenic
1083083764 11:60121323-60121345 CTGGTGGCCTGCTAGGAACTGGG + Intergenic
1083625217 11:64068886-64068908 GTGGGGACTTGGCGGGAAATGGG + Intronic
1086250361 11:84805165-84805187 ATGGAGGCTTAGTGGGAAACGGG + Intronic
1087832786 11:102837819-102837841 CTGGTGGCCTCCTGGGAAAAGGG + Intronic
1090450928 11:126805829-126805851 CTGGGGGCTGAGTGGGAACTTGG - Intronic
1090743736 11:129690870-129690892 CAGGGGGCCGGGTGGGAAATGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091610590 12:2004393-2004415 CAGGCGGCCTGGTGGGAAAGGGG - Exonic
1091907648 12:4201736-4201758 CTGGTGGCTTGGGGAGTAAGCGG + Intergenic
1094032364 12:26027180-26027202 CTGGGGATTTGATGGGAAATGGG + Intronic
1095747375 12:45674894-45674916 CTGGTGGCTATATGGAAAATAGG + Intergenic
1095808709 12:46349174-46349196 CTGAAGGCTTGGTCTGAAATGGG + Intergenic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097703166 12:62840854-62840876 CTTGTGGCTTAGTAGAAAATGGG + Intronic
1099270066 12:80497487-80497509 CTGGTGGCCTGTTAGGAACTGGG - Intronic
1099659699 12:85541165-85541187 CTGAGGGCTTAGTGAGAAATAGG - Intergenic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1103023216 12:117553459-117553481 CTGGCTGCTGTGTGGGAAATGGG + Intronic
1103407878 12:120688130-120688152 CTGGTGGCTGTGTGTGAACTGGG + Intronic
1103889919 12:124230919-124230941 CTGGTTGCTTGGTTGGAGAATGG + Intronic
1104094985 12:125548779-125548801 CTGGCTGCTGTGTGGGAAATGGG + Intronic
1104139210 12:125971581-125971603 CCAGTGGCTTGGTGGGAAGCAGG - Intergenic
1104252242 12:127106252-127106274 TTGGTGGCTGGCTGGCAAATTGG - Intergenic
1104744888 12:131204431-131204453 CCAGTGGGATGGTGGGAAATGGG - Intergenic
1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG + Intergenic
1106314373 13:28580110-28580132 CTGGGGACTTGGTAGGATATAGG + Intergenic
1106349065 13:28910158-28910180 CGGGTGGGATGGAGGGAAATGGG - Intronic
1108563175 13:51666963-51666985 CTTGTGCCTGGGTGGGAAACTGG + Intronic
1111723772 13:91978773-91978795 CTGATGGCTTTGTGGAAAATGGG + Intronic
1115746556 14:36443809-36443831 CTGCTTGCTGGGTGGGAAGTGGG - Intergenic
1115935331 14:38545857-38545879 CTGGTGGCTGGGCTGGAAATGGG + Intergenic
1118734473 14:68691639-68691661 CTGGCGGGTAGGTGGGAAACAGG + Intronic
1119582712 14:75801332-75801354 TTGTTGGCTGCGTGGGAAATGGG - Intronic
1120415426 14:84213389-84213411 CTGATGTCTTGGTGAGACATTGG + Intergenic
1122416215 14:101550753-101550775 CTGGTGGGTGGGTGGGTAAGTGG + Intergenic
1124023097 15:25941724-25941746 CTGGTGACTGGGAAGGAAATGGG - Intergenic
1128667068 15:69546333-69546355 CTGGTGGGTTGGGAGGGAATGGG + Intergenic
1129515313 15:76153660-76153682 CTGGAGGCTGGGTGTGAACTTGG + Intronic
1131028503 15:89166243-89166265 TTGGTGTTTTGGTGGGAGATGGG - Intronic
1132243918 15:100280118-100280140 CAGATGTCTTGGTGGGAAAGAGG - Intronic
1132624139 16:882134-882156 CAGTTGCCTTGGTGGGAAGTGGG - Intronic
1133072554 16:3256248-3256270 CTGGCTGCTTTGTGGGAAAGGGG - Intronic
1133775878 16:8894743-8894765 CTGGGGGCTTGGCGGGCCATAGG - Intronic
1134044130 16:11088989-11089011 CAGGTGGCCTGGGGGGAAAGGGG - Intronic
1134979287 16:18594171-18594193 CTGGCGGGTGGGTGGGGAATAGG - Intergenic
1136356062 16:29745479-29745501 CTGGGGTCTGGGAGGGAAATGGG - Intronic
1136523345 16:30811908-30811930 GTGGTGGCTGAGTGGGAGATGGG + Intergenic
1136569730 16:31089377-31089399 CTGCTGGCTTCCTGGGAAACAGG + Intronic
1138088103 16:54152425-54152447 CAGGTGGCTTGGAGGAAAGTGGG - Intergenic
1139381394 16:66534105-66534127 CTGGTGGCTTTATGAGAAAAGGG + Intronic
1140247285 16:73262955-73262977 CTGGTGGCTTGGTTGGGGCTGGG - Intergenic
1143917208 17:10302789-10302811 GTGGTGGGATGGTGGGAATTAGG + Intronic
1144299708 17:13911958-13911980 CTGGGAGGTTTGTGGGAAATGGG + Intergenic
1146103522 17:30009386-30009408 CTGGAGGTTTGGAAGGAAATGGG - Intronic
1146917986 17:36690339-36690361 CTGGTGGCTTGGTCAGCAGTGGG + Intergenic
1147162568 17:38576705-38576727 TTGGTGCCTTGGAGAGAAATAGG - Intronic
1148833991 17:50455742-50455764 CTGCTGGCTGGGTGGGTGATGGG - Intronic
1149575236 17:57707270-57707292 CTGGAGGCTGGGAGGGAGATGGG - Intergenic
1150021647 17:61621203-61621225 ATGGTGGCAGGGAGGGAAATGGG - Intergenic
1150432738 17:65131539-65131561 CTGGTGGCTGGGAGGGACACAGG - Intergenic
1151323896 17:73367360-73367382 CAGGTGGCTTGCAGGAAAATGGG - Intronic
1152399324 17:80055756-80055778 CTGGTGGCTGGGTGGGGGAAGGG - Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1156293192 18:35767315-35767337 CTGGAGGGTTGGGGGAAAATAGG - Intergenic
1160944446 19:1634672-1634694 CTGGTGGCTCGTTGGCAAATGGG + Intronic
1161026354 19:2039085-2039107 CTGGTGGCTTGGTTGGGGAAGGG - Exonic
1162136349 19:8557742-8557764 CGGGTGACTTGGTGGGAAGTGGG + Intronic
1162523807 19:11196529-11196551 GTGGTGGCTTGGTGGGCAGTGGG - Intronic
1163395461 19:17057859-17057881 CTGGTGTCTTGTGGGGAAAGGGG + Intronic
1164521032 19:28980036-28980058 CTGGTGGGTTGGAGGTAAAGTGG - Intergenic
1165221404 19:34319639-34319661 GGGGTTACTTGGTGGGAAATGGG + Intronic
1165965314 19:39572953-39572975 CTGGGGACTTGGGGGGAAAAGGG - Intergenic
1166635451 19:44447641-44447663 CCTGTGGCGTGGTGGGAATTGGG - Intronic
1168494691 19:56839205-56839227 CTGGTTGGTTGGTGGCAGATGGG - Intronic
1168494746 19:56839481-56839503 CTGGTTGGTTGGTGGCATATGGG - Intronic
1168494801 19:56839745-56839767 CTGGTTGATTGGTGGCAGATGGG - Intronic
925060359 2:885758-885780 CTGGGGGCTTGGAGGGGAACTGG + Intergenic
926162967 2:10501324-10501346 CTGGAGTCTGGGTGGGGAATTGG + Intergenic
926774913 2:16412521-16412543 GTGGGGGCTTGGTGGGGAGTTGG - Intergenic
927865522 2:26585083-26585105 AAGGTGGCTCTGTGGGAAATAGG - Intronic
930202624 2:48559719-48559741 CTGGTGGTATGGTAGGAAAAGGG - Intronic
933596368 2:84287525-84287547 CTGGTAGCTGGGTGGGAATGGGG - Intergenic
934884764 2:98014618-98014640 CTGGTGGGTTGGTGGGATGGTGG - Intergenic
934884775 2:98014649-98014671 CTGGTGGGTTGGTGGGATGGTGG - Intergenic
935201895 2:100864088-100864110 CTAGATGCTTGGTGGGAATTTGG + Intronic
936141421 2:109945333-109945355 CTTGTGGCCTGGTGGGAAGCAGG + Intergenic
936178110 2:110243281-110243303 CTTGTGGCCTGGTGGGAAGCAGG + Intergenic
936203272 2:110426150-110426172 CTTGTGGCCTGGTGGGAAGCAGG - Intronic
937310419 2:120899238-120899260 CAGGCGTCTTGGTGGGAGATGGG + Intronic
939176898 2:138759494-138759516 CAGGTGGGAAGGTGGGAAATGGG + Intronic
940161560 2:150719493-150719515 ATGGTGGCATGGTGGGTGATGGG - Intergenic
940238768 2:151540493-151540515 TAGGTGGCTTGGTTGGAAATTGG - Intronic
946193909 2:218022105-218022127 CAGGTGGCCTGGTGAGAAAGAGG + Intergenic
947572237 2:231245210-231245232 CCTGTGGCTTGCTGGGATATGGG + Intronic
947766728 2:232642583-232642605 CTACTGGTTTGGAGGGAAATGGG + Intronic
948417580 2:237824747-237824769 CTGGTTGCCTGGTGGTAACTGGG - Intronic
1170329510 20:15193006-15193028 CTGGTGGCCTGGTTGAAAGTTGG + Intronic
1174060927 20:47832646-47832668 CTGGAGGCTTGGTGGGGAGCCGG - Intergenic
1174070970 20:47898724-47898746 CTGGAGGCTTGGTGGGGAGCCGG + Intergenic
1174153088 20:48499934-48499956 CTGGAGGCTTGGTGGGGAGCCGG - Intergenic
1174482011 20:50837946-50837968 GAGGTGGGTGGGTGGGAAATGGG - Intronic
1175471001 20:59228326-59228348 CTGGCAGGTTGATGGGAAATTGG + Intronic
1175581330 20:60102116-60102138 CTGGTGGCCTGGTGAGCAAGTGG + Intergenic
1175706360 20:61180665-61180687 CTGGTGTCTGGGTGAGAGATAGG - Intergenic
1178713047 21:34936891-34936913 ATGGTGGTTTAGTGGGAAAAGGG + Intronic
1178976021 21:37221570-37221592 CTGGAGTCTTGGTGGGCAAGGGG - Intergenic
1183240278 22:36652714-36652736 GTGGTGGCTTGCTGGGAAATGGG - Intronic
1183978561 22:41526899-41526921 CTGGTGGCTGGGTGGGGCAGAGG + Exonic
1184096162 22:42317641-42317663 CTGGGGGCTGGGGGGGAAAGGGG + Intronic
1184257823 22:43297072-43297094 CTGGTGGCTGGGTGGGACGAGGG - Intronic
1184390040 22:44198489-44198511 CTGGTGCCTTGATGAGAAGTGGG - Intronic
950193746 3:10994693-10994715 CTGGAGGCTTGATGAGAAGTGGG + Intronic
950775705 3:15348289-15348311 CTAATGGCTTATTGGGAAATTGG + Intergenic
951805934 3:26643494-26643516 CTGGTGGGTGGGTGGAAAACTGG - Intronic
952902487 3:38119410-38119432 TTGGTGGCTTGGTCAGAGATGGG - Intronic
955476388 3:59340539-59340561 CAGGTGTCTTGGTGAGAAAGTGG - Intergenic
955951961 3:64251455-64251477 ATGATTGCTTGGTGGGAACTTGG - Intronic
956554121 3:70498827-70498849 CATCTGGCTTGGTGGAAAATTGG - Intergenic
958944702 3:100350190-100350212 CTGGTTGCATGGTGGAAGATGGG + Intronic
959760072 3:109951484-109951506 CTAGAGGTTTGGAGGGAAATAGG + Intergenic
960729177 3:120705999-120706021 CTGGAGTCTTGGTGACAAATGGG - Exonic
964034561 3:152180231-152180253 TTGGTGTGTTTGTGGGAAATGGG - Intergenic
965074649 3:163960355-163960377 GTGATGTCTTGCTGGGAAATGGG - Intergenic
966288505 3:178326370-178326392 CTGGTGGCTTTCTAGGAAAGGGG - Intergenic
966684332 3:182677433-182677455 CTGGTGGCTAGTTGGGTAATAGG + Intergenic
967878649 3:194283497-194283519 CTGGTTTATTTGTGGGAAATGGG + Intergenic
968185378 3:196630108-196630130 CTGGGGGTTTGGGGGAAAATGGG - Intergenic
968517673 4:1021693-1021715 CTGATGGTTGGGTGGGAATTAGG + Intronic
969059367 4:4422996-4423018 ATGGTGTCTGCGTGGGAAATAGG - Intronic
971506582 4:27372977-27372999 CAGGTGTCTAGGTGGGAAGTGGG - Intergenic
980120065 4:128718423-128718445 CTGGTGGCTTCTTGGGGAGTTGG + Intergenic
981515495 4:145604753-145604775 CAGGTGCCTTGGTAGAAAATAGG - Intergenic
986728442 5:10617602-10617624 CTGGCTGCTGGGTGGGAAACAGG - Intronic
988891573 5:35623170-35623192 GTGGTGCCTTGCTGTGAAATTGG + Intronic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
1001630069 5:173168365-173168387 CTCCTGGTTTGGTGGGAAAGAGG - Intergenic
1002070214 5:176674442-176674464 CGGGTGGCCTGGTGGGAACTGGG + Intergenic
1002670409 5:180861596-180861618 GTGGGGGCCTGGCGGGAAATGGG + Intergenic
1013940858 6:115660111-115660133 GTGGTGGCTTGGTAGGAAAAAGG - Intergenic
1016935260 6:149445140-149445162 CTGGTGGCTGGGCTGAAAATGGG - Intergenic
1018032725 6:159855310-159855332 ATGGTGGCTGGGTGGGACAGTGG - Intergenic
1019920476 7:4160116-4160138 CTTGTGGTTTAGTGTGAAATTGG - Intronic
1020267617 7:6571863-6571885 CTGGTGGCTTGCTGGGCCAGAGG + Intergenic
1020442721 7:8235267-8235289 CTGCTTGCTTGGTGGGTCATGGG + Intronic
1020938532 7:14500685-14500707 CTGGTAGTTGGGTGTGAAATTGG + Intronic
1021752876 7:23821932-23821954 TTGGTGCCTTTGTGGGAAATTGG + Intronic
1021886842 7:25147509-25147531 CTGGGGTCTGGGTGGGAAAGGGG + Intronic
1024963776 7:55004494-55004516 CTGGTGGCTTGGAGGGACGTTGG + Intergenic
1027725896 7:81805820-81805842 CGGGAGGCTTGGTGGGTACTTGG - Intergenic
1027870649 7:83702583-83702605 CTGGTAGACTGGAGGGAAATGGG - Intergenic
1028057332 7:86262538-86262560 CTGGGGGCTAGGTGGGCAGTGGG - Intergenic
1028165886 7:87538199-87538221 CTGGAGGCTGGTTGGGTAATGGG + Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1031481720 7:122285519-122285541 CAGGTGGTTTGGTATGAAATTGG + Intergenic
1033573727 7:142659252-142659274 CTGGTGGCAATGTGAGAAATAGG - Intergenic
1034847086 7:154456504-154456526 GTGGTGGGTTGGTTGGAAATGGG + Intronic
1035138327 7:156730224-156730246 CTGGTGTCTTGAAGGGAAAGTGG - Intronic
1035176376 7:157054959-157054981 CTGTTGTGTAGGTGGGAAATAGG + Intergenic
1040810569 8:51448235-51448257 CTGGCGCCTTGGTGGGGCATAGG + Intronic
1041388560 8:57329543-57329565 GTGGGGGGTGGGTGGGAAATGGG - Intergenic
1041710603 8:60890888-60890910 CTTATGGCTTGGTGGCAAAACGG - Intergenic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1047746174 8:127846619-127846641 CTGATAGCTGTGTGGGAAATGGG + Intergenic
1047894756 8:129354207-129354229 GTGGTGGCATGGGGGGTAATTGG - Intergenic
1048864661 8:138750800-138750822 CAGGTACCTTGGTGGGAACTGGG + Intronic
1048878914 8:138857476-138857498 CAGGTGCCTTGCTGTGAAATAGG - Intronic
1049336512 8:142089534-142089556 CTGACCGCTTGGTGGCAAATAGG + Intergenic
1050171046 9:2816995-2817017 GTAGTGGCTGAGTGGGAAATAGG + Intronic
1050851595 9:10294104-10294126 TTGGTGTCTTGATTGGAAATTGG + Intronic
1052120221 9:24705612-24705634 CTGGAGAATTGGGGGGAAATGGG + Intergenic
1052886329 9:33651629-33651651 CTGGTGGCAATGTGAGAAATAGG - Intergenic
1054746593 9:68860179-68860201 CTGGGGGCTTGGGGAGATATTGG - Intronic
1054764909 9:69035488-69035510 CTGCTGTCTTGCTGGGAAGTGGG - Exonic
1055632019 9:78234413-78234435 CAGGTGGCTTCATGGGAAACAGG + Intergenic
1056044321 9:82701409-82701431 CTGATGCCTTGGTCTGAAATGGG + Intergenic
1056815645 9:89798974-89798996 CTGGGGGCTTGGCTGGAAAGTGG + Intergenic
1058764207 9:108165504-108165526 CTGGGGGCTTGATGTGGAATTGG + Intergenic
1058765743 9:108181208-108181230 CTTAGGGCTTGGTGGGAGATAGG + Intergenic
1059659626 9:116388190-116388212 CAGGTGTCTGGGTGGGAAATTGG - Intronic
1060027403 9:120184813-120184835 GTGGTGGCTTGGCGGGAACCTGG - Intergenic
1060775000 9:126366736-126366758 CAGGAGGCTGGGTGGGAACTGGG - Intronic
1061464318 9:130765888-130765910 GTGGTGGCTTGGTGGAAAAACGG + Intronic
1061911116 9:133725200-133725222 CTGGGGACAGGGTGGGAAATGGG + Intronic
1061954939 9:133956387-133956409 CTGGGGGCCTGGTGGGGAAAGGG + Intronic
1062167895 9:135117465-135117487 GTGGTGTCTTGTTGGGATATGGG + Intronic
1062729688 9:138102034-138102056 CTCAGGGCTGGGTGGGAAATGGG - Intronic
1188745190 X:33832739-33832761 GTGGAGGCTGGGTGGGAGATGGG - Intergenic
1189245166 X:39557705-39557727 CTGGTGGCCTAGAGGGAAACAGG + Intergenic
1190744272 X:53312177-53312199 CATGTGGGTTGGTGGGAATTGGG - Intronic
1190745419 X:53319633-53319655 CTCTTGGGTTGGTGGGACATGGG - Intronic
1192574595 X:72232985-72233007 CTGATGGGTTGGTGGGGAACTGG + Intronic
1196725361 X:118890375-118890397 CTGGTGGTATTGTGGGAAAGGGG + Intergenic
1197791888 X:130263545-130263567 TGGGAGGGTTGGTGGGAAATGGG + Intronic
1198100698 X:133419314-133419336 CTGATGGCTGTGTGGGGAATGGG - Intergenic
1198787449 X:140304225-140304247 CTGGTGGGTGGGTGGGTTATTGG - Intergenic
1201495151 Y:14584691-14584713 CTGGCAGTTTGGTGGAAAATTGG + Intronic