ID: 1070782672

View in Genome Browser
Species Human (GRCh38)
Location 10:79146669-79146691
Sequence CTCTGGGTGGGGAGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070782659_1070782672 3 Left 1070782659 10:79146643-79146665 CCACAGTTTCCCAGCAGACATCT 0: 1
1: 0
2: 0
3: 23
4: 264
Right 1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG No data
1070782654_1070782672 30 Left 1070782654 10:79146616-79146638 CCCTGTAGTCAGGGAACGGCTGG No data
Right 1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG No data
1070782660_1070782672 -6 Left 1070782660 10:79146652-79146674 CCCAGCAGACATCTGCCCTCTGG 0: 1
1: 0
2: 2
3: 20
4: 244
Right 1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG No data
1070782656_1070782672 29 Left 1070782656 10:79146617-79146639 CCTGTAGTCAGGGAACGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG No data
1070782662_1070782672 -7 Left 1070782662 10:79146653-79146675 CCAGCAGACATCTGCCCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070782672 Original CRISPR CTCTGGGTGGGGAGGGCGGA AGG Intronic
No off target data available for this crispr