ID: 1070784947

View in Genome Browser
Species Human (GRCh38)
Location 10:79157532-79157554
Sequence CTGGACATTGAGCTGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 178}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070784947_1070784961 18 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784961 10:79157573-79157595 CTGGTGGGTGCATGGCTGGAGGG No data
1070784947_1070784951 -1 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784951 10:79157554-79157576 GAGCACCCTGGAGCCTCCTCTGG No data
1070784947_1070784952 2 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784952 10:79157557-79157579 CACCCTGGAGCCTCCTCTGGTGG No data
1070784947_1070784960 17 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784960 10:79157572-79157594 TCTGGTGGGTGCATGGCTGGAGG No data
1070784947_1070784956 10 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784956 10:79157565-79157587 AGCCTCCTCTGGTGGGTGCATGG No data
1070784947_1070784953 3 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784953 10:79157558-79157580 ACCCTGGAGCCTCCTCTGGTGGG No data
1070784947_1070784963 28 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784963 10:79157583-79157605 CATGGCTGGAGGGGTGATTTAGG No data
1070784947_1070784962 19 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784962 10:79157574-79157596 TGGTGGGTGCATGGCTGGAGGGG No data
1070784947_1070784958 14 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784958 10:79157569-79157591 TCCTCTGGTGGGTGCATGGCTGG No data
1070784947_1070784964 29 Left 1070784947 10:79157532-79157554 CCAATGTCCAGCTCAATGTCCAG 0: 1
1: 1
2: 2
3: 18
4: 178
Right 1070784964 10:79157584-79157606 ATGGCTGGAGGGGTGATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070784947 Original CRISPR CTGGACATTGAGCTGGACAT TGG (reversed) Intronic
900276545 1:1833334-1833356 TTGGAGATTGACCTGGACTTGGG - Intronic
901137873 1:7009400-7009422 TTGGCCACTGAGCTGGACCTGGG - Intronic
905410992 1:37767707-37767729 CTGGACATTCAGTTAGACCTCGG + Intergenic
906557003 1:46721887-46721909 CTGGCCAGTGGGCTGGTCATGGG + Intergenic
906610322 1:47197133-47197155 CTGAACCCTGGGCTGGACATAGG - Intergenic
907741215 1:57167880-57167902 CTGGATATTTTGCTGGACACTGG - Intronic
908801165 1:67882113-67882135 CTAGTCAGTGAGCTGGACCTGGG + Intergenic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
912214757 1:107596234-107596256 CAGAACATTCAGCTGGACAGAGG - Exonic
912448925 1:109758015-109758037 AGGGACATTGAGCTGTTCATGGG - Exonic
912664511 1:111567067-111567089 ATGGGCACTGAGCAGGACATAGG + Intronic
912958533 1:114174105-114174127 CTGGACAGTGAGCAGGCCAAGGG + Intergenic
915065101 1:153218381-153218403 CTGCACACTGAGGTGGACACTGG - Exonic
915670077 1:157481505-157481527 CTGCACATTGAACTGGACTTTGG + Intergenic
916658406 1:166898475-166898497 CTGGACCTTTGGCTGGACACAGG - Intergenic
919194077 1:194261084-194261106 CTGCATATTGAATTGGACATAGG + Intergenic
920504368 1:206506342-206506364 CTGTACATTGGGCTGGAGGTGGG - Intergenic
921193696 1:212731946-212731968 CTGAACAGTTAGATGGACATTGG - Intronic
921222101 1:212980575-212980597 CAGGGCCTTGAGCTGGACAATGG + Intronic
923544267 1:234912950-234912972 TTGGGCATTGTGCTGGGCATTGG - Intergenic
1064179517 10:13102113-13102135 CTGGACATTGATCTGTCCAGTGG + Intronic
1065837996 10:29676685-29676707 TGGAACACTGAGCTGGACATTGG + Intronic
1067771557 10:49130321-49130343 CCAGACATTGAAGTGGACATGGG - Intergenic
1067773002 10:49140525-49140547 CTGGACATTGGCTGGGACATTGG + Intergenic
1068798750 10:61115047-61115069 CTGTAGATTGAGGTGGAGATAGG + Intergenic
1070784947 10:79157532-79157554 CTGGACATTGAGCTGGACATTGG - Intronic
1070956110 10:80464684-80464706 CCAGACAATGAGCTGCACATGGG - Intronic
1072067556 10:91885488-91885510 CTGGAGAATGAGCGGGCCATTGG - Intergenic
1076009396 10:126975306-126975328 CTGCAGAGTGAGATGGACATGGG - Intronic
1077634014 11:3829628-3829650 CTGGAGATTCAGTTGGACCTGGG + Intronic
1077915320 11:6608007-6608029 ATGGTCATTGAGCTGGAGGTGGG - Intronic
1079405157 11:20138529-20138551 ATGGACCTTGAGGTGGACTTGGG - Intergenic
1082915624 11:58432936-58432958 CTGGACATTGGGCTAGGCAAAGG + Intergenic
1083732646 11:64661052-64661074 CTGGAGAGTGAGCTGTACCTGGG - Exonic
1084677620 11:70645352-70645374 CTGGGGATAGGGCTGGACATGGG + Intronic
1085230000 11:74958852-74958874 CTGGACATAGAGATGCAGATGGG - Intronic
1086692550 11:89804743-89804765 CTGAACATAGATCTGGAAATTGG + Intronic
1086713250 11:90034916-90034938 CTGAACATAGATCTGGAAATTGG - Intronic
1087196174 11:95306175-95306197 CTGGCCATCGTGCTGGGCATTGG + Intergenic
1087850728 11:103026751-103026773 CTGGCCTTTGAGCTGAACTTTGG + Intergenic
1087865472 11:103221354-103221376 CTGGAGATGGAGGAGGACATAGG + Intronic
1087923036 11:103888860-103888882 AGTGACATTCAGCTGGACATTGG + Intergenic
1091896524 12:4109709-4109731 CTGGCCCTTGGGGTGGACATAGG + Intergenic
1092289533 12:7150917-7150939 CAGGACATTGACCTGGGCAGAGG - Exonic
1092745069 12:11665534-11665556 CCAGACCTTGAGCTGGACACTGG - Intronic
1095496878 12:42794436-42794458 CTGGACATAGAGCAGGAAACAGG - Intergenic
1095663199 12:44762255-44762277 CTGGTAATTGAGCTGGATTTGGG - Intronic
1095701027 12:45191237-45191259 CTGGGCACTGTGCTAGACATTGG - Intergenic
1095997857 12:48104610-48104632 CTGGACAGTGAGCTGCTCAGTGG - Intronic
1101021040 12:100553985-100554007 CTGGACCTTGGGCTGGAGCTGGG + Intronic
1102234691 12:111286956-111286978 CTGGACCCTGAGCTGGACTTTGG + Intronic
1104313586 12:127676547-127676569 ATAGACATAGAGCTAGACATAGG + Intergenic
1104715788 12:131015378-131015400 TTGGAGATTGAGATGGACATGGG + Intronic
1106356006 13:28984016-28984038 CTGAACATAGAGCTGGAAACAGG - Intronic
1109400820 13:61826074-61826096 CTTGACATTGACCTTGGCATTGG - Intergenic
1110411943 13:75214346-75214368 CTGGACATCAAGCTGGAACTTGG + Intergenic
1112785314 13:102944884-102944906 CTGGACATTTATCTGGACCTTGG + Intergenic
1113507453 13:110827016-110827038 CTGGACAATGAGCTGGACACTGG - Intergenic
1115329440 14:32179588-32179610 CAGGACATTGAACTGGACAAAGG - Intergenic
1115888375 14:37999725-37999747 CTGGACACTGAGGTAAACATTGG + Intronic
1116136503 14:40930733-40930755 CTGGACAGAGAGGTGGGCATAGG + Intergenic
1118317859 14:64736747-64736769 GTGGACTTTGAGCTGGTGATGGG + Intronic
1119799147 14:77427217-77427239 CAGGACTTGGCGCTGGACATTGG - Exonic
1119870488 14:78012616-78012638 CTGGCATTTGAGATGGACATTGG + Intergenic
1119971012 14:78970724-78970746 CTGCACATAGAGCTGTAGATAGG - Intronic
1120524248 14:85559342-85559364 ATGAACTTTGAGCTGGTCATTGG + Intronic
1120835571 14:89035873-89035895 CTGGACACTGTGCTAGGCATGGG + Intergenic
1120942804 14:89965202-89965224 CTGGACATTGAGCTAGATGCTGG - Intronic
1121414260 14:93768174-93768196 CTGAACATTGAGGTGGAAAAAGG - Intronic
1121846064 14:97173364-97173386 CAGGACATTGAGTTGGATCTGGG - Intergenic
1122405902 14:101500891-101500913 CTGGACTCGGAGCTGGACACAGG + Intergenic
1126407845 15:48340088-48340110 CTGCCCATTGAGCTGAACACAGG + Intronic
1130867168 15:87942913-87942935 CTGGTGACTGAGCTGGGCATGGG + Intronic
1131682861 15:94742267-94742289 ATGGACAATCAGCAGGACATGGG - Intergenic
1133846092 16:9455066-9455088 CTGGGCATTGAGCTGGAGCCAGG - Intergenic
1134133006 16:11662513-11662535 ATGGACAATGAGCTGGCCCTGGG - Intergenic
1134437934 16:14279014-14279036 CTGGTGAGTGAGCTGGCCATTGG - Intergenic
1136562146 16:31045894-31045916 ATTGACGTTGAGCTGGACAGTGG + Intergenic
1136646899 16:31628381-31628403 CTGCACTTTGGCCTGGACATCGG + Intergenic
1139254280 16:65526497-65526519 GTCGACTTTGAGCTGGATATGGG - Intergenic
1140767092 16:78169966-78169988 CTGGACATTGAGATGGCCACAGG + Intronic
1143270186 17:5669558-5669580 CTGGCCACTGACTTGGACATCGG - Intergenic
1143726352 17:8849556-8849578 CTGGACACTGAGCTTGACAATGG - Intronic
1143960702 17:10716048-10716070 CTGAATATTGATGTGGACATGGG - Intronic
1148156186 17:45426380-45426402 CTGGTCACTGTGCTGGACACTGG - Intronic
1148656617 17:49288670-49288692 CTGGACATTGATCTGGCCACTGG - Intergenic
1149639187 17:58192233-58192255 CTGGGCTTTGAGCTGGGTATGGG + Intergenic
1150387855 17:64774998-64775020 CTGGTCACTGTGCTGGACACTGG - Intergenic
1155339078 18:24795930-24795952 CTAGGCATTCTGCTGGACATTGG - Intergenic
1156364494 18:36413292-36413314 CTGGAGATGGAGCTGAACACAGG - Intronic
1156601424 18:38611650-38611672 CTGTACATTCATCTGGAAATTGG + Intergenic
1156736665 18:40268131-40268153 CTGGACATTGATGTGGAGAGAGG + Intergenic
1160331702 18:77998881-77998903 CTGGGCACTGAGCTGGTCCTGGG + Intergenic
1160680488 19:409799-409821 CTGGACAGTGACCTGGCCACCGG + Intergenic
1161313689 19:3608157-3608179 CTGGAGAATGAACTGGACACAGG + Intergenic
1161488331 19:4547909-4547931 CTGGTCATTGAGCTGGGCAGAGG - Intronic
1163566964 19:18057719-18057741 CGGGAGACTGAGCTGGACAGAGG - Intergenic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1164737841 19:30554891-30554913 CTGGACAGTGAGATGGTGATGGG + Intronic
1166212122 19:41313477-41313499 CTGAAGACTGAGCTGGACAAGGG - Intronic
1166918690 19:46213586-46213608 CTGGAGATTTGGCTGGGCATGGG - Intergenic
1166921127 19:46229897-46229919 CTGGAGATTTGGCTGGGCATGGG - Intronic
1167673742 19:50871717-50871739 CTGGTCATTCAGCTGGAAATGGG + Intronic
1168115264 19:54218677-54218699 CTGGACCTGGAGGAGGACATGGG + Exonic
927402812 2:22733157-22733179 CAGGACATGGAACTGGACAAAGG + Intergenic
934516999 2:94994516-94994538 CAGGAGATGCAGCTGGACATAGG - Intergenic
934690806 2:96357474-96357496 CTGGTGATGGAGCTGGACAGAGG - Intronic
935796618 2:106647905-106647927 CTGCATATGTAGCTGGACATAGG - Intergenic
937258750 2:120572312-120572334 CTGAACATGGAGCTGGAAAGAGG + Intergenic
937378407 2:121353702-121353724 CTGGACATTGTGCCAGTCATGGG - Intronic
938315194 2:130320339-130320361 CTGTACATTGAGCTGGACATGGG - Intergenic
938954224 2:136283279-136283301 CTTGACATTGTGCTAGACACTGG - Intergenic
940576887 2:155519716-155519738 ATGGGCATTGAACTAGACATAGG + Intergenic
943875703 2:193064897-193064919 CTGGACATTGGGCTAGATAAAGG - Intergenic
946895937 2:224323774-224323796 CTGGGAATTGTCCTGGACATAGG - Intergenic
947926552 2:233926827-233926849 CTGGCCATAGAGCTGGAGAAGGG - Intronic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948402396 2:237693073-237693095 CTGCATATTGAGCTGGACAACGG - Intronic
1168868355 20:1108258-1108280 TTGGAGTTGGAGCTGGACATGGG + Intergenic
1169353426 20:4888612-4888634 CTGGGCACCAAGCTGGACATGGG - Intronic
1174882674 20:54297354-54297376 CTGGGCATTGTGCTGGAAACAGG + Intergenic
1175162623 20:57020439-57020461 CTGGACGCTGAGCTGTACGTGGG - Intergenic
1175471190 20:59229876-59229898 CTAGACAATGAGCTGTACAGAGG - Intronic
1178097218 21:29229247-29229269 CAATACATTGAGCTGAACATTGG - Intronic
1178280464 21:31278050-31278072 CTGAAGATTGAGTGGGACATGGG - Intronic
953967688 3:47322612-47322634 CTGGACATTTTGCTGGTCAATGG - Exonic
956639897 3:71405650-71405672 CTGGAGGTTGACCTGGACATTGG - Intronic
960226168 3:115171867-115171889 CTTGACAATGTCCTGGACATGGG + Intergenic
960375752 3:116899550-116899572 CTGGTCTTTGAGCTGGATTTTGG - Intronic
960520337 3:118647306-118647328 CTGGAAATGTAGCTGGACAGGGG - Intergenic
961061814 3:123834955-123834977 CTGGACAGAGAGCTGGGCAATGG + Intronic
961323918 3:126098626-126098648 CTTGACTGTGAGCTTGACATGGG + Intronic
961741866 3:129038267-129038289 GTGGACATTGGGCTGGACCTCGG - Intronic
962353572 3:134673975-134673997 TTAGACATGGACCTGGACATAGG - Intronic
964061058 3:152523199-152523221 ATGGACATTGAGCAAGAAATTGG - Intergenic
965535039 3:169814380-169814402 CTGGACATTGAGAGGAACAGAGG - Intergenic
967875002 3:194262506-194262528 CTGGACATGAAACTGGACATTGG + Intergenic
968755673 4:2414714-2414736 CTGGACACTTACCTGGACCTGGG - Intronic
969451781 4:7277934-7277956 CTGGACATTGCGGTGTACAGGGG + Intronic
969558528 4:7930400-7930422 CTGGAGATTGAGCTAGCCACCGG - Intronic
970212651 4:13726817-13726839 CTGGACCCTGAGATGGGCATTGG + Intergenic
970261494 4:14229687-14229709 CTACACATTGACCTGAACATTGG - Intergenic
973292937 4:48488167-48488189 CTAGCCATTGAGTTGGATATAGG - Intronic
977975396 4:103258757-103258779 GAGGACAATGAGCTGGACACAGG - Intergenic
980668759 4:135974790-135974812 CTGAACACTGAGTTGGCCATGGG + Intergenic
981328102 4:143475704-143475726 ATGGAGATTGAGCTGGACAATGG + Intergenic
985940418 5:3131395-3131417 ATGGACATAGAGCTGGGAATTGG - Intergenic
991230416 5:64326515-64326537 CTGCATATTCAGCTGGAGATTGG + Intronic
994874211 5:105394019-105394041 CTGCACATTGATCTGGAGAAAGG + Intergenic
996221691 5:120940567-120940589 CAGGACATAGAGCTGGAGAGAGG + Intergenic
996572624 5:124948448-124948470 CCTCACATTGAGCTGGACACTGG + Intergenic
996634240 5:125670871-125670893 CCTGACATTGACCTGGAAATTGG + Intergenic
998253948 5:140570891-140570913 CTGGACACTGAGCTTAACAAGGG - Intronic
998856654 5:146400699-146400721 ATGGACAGTGTGCTGGGCATGGG + Intergenic
1001107843 5:168870498-168870520 CTGGACTCAGAGCTGGACTTTGG - Intronic
1002442082 5:179269785-179269807 CTGGACACAGAGCTGGCCTTGGG + Intronic
1002680362 5:180957614-180957636 CAGGACATTGATCTGGGCAATGG - Intergenic
1006451574 6:34108695-34108717 GTGGGCACTGAACTGGACATTGG - Intronic
1007663641 6:43501593-43501615 CTGGAACGTGAGCTGGAAATTGG + Exonic
1009793036 6:68428591-68428613 CTGAAGATGGATCTGGACATTGG - Intergenic
1011980464 6:93369735-93369757 CTGGACATTGTGCTAGGCTTTGG - Intronic
1012961887 6:105630783-105630805 ATGGACATGGAGGTGGACAACGG + Intergenic
1015253014 6:131146859-131146881 CCAGGCATTGTGCTGGACATTGG + Intronic
1015597994 6:134884181-134884203 CAGGACATTGATCTGGGCAAAGG + Intergenic
1016519800 6:144934043-144934065 CTGTTCATTGATCTGTACATGGG - Intergenic
1018633416 6:165840033-165840055 ATGGACATGGAGATGGAGATGGG - Intronic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1020118432 7:5489274-5489296 CTGGAGAATGAACTGGAGATAGG - Intronic
1023268745 7:38436635-38436657 CTGGACTTGGAGCTAGACAAAGG - Intronic
1023696089 7:42848666-42848688 CTTGACATTGACCTGGGCAATGG + Intergenic
1028360311 7:89959770-89959792 CCTGACATTGAGCTGGACATGGG - Intergenic
1028704652 7:93825888-93825910 CAGGACATTGAGCTAGCAATAGG + Intronic
1029255489 7:99266753-99266775 CTGGTCTTTGAGATGGACTTTGG - Intergenic
1034034637 7:147805925-147805947 CAGGACATTGGTCTGGACAAAGG + Intronic
1035626124 8:1071971-1071993 CTCGTCAGTGTGCTGGACATTGG + Intergenic
1036206430 8:6808943-6808965 CTGGACACTCTGCTGGACCTTGG + Exonic
1037220334 8:16511746-16511768 AAGGACATTCAGCTGGTCATAGG - Intronic
1038589495 8:28823466-28823488 TTGGACAAAGAGCAGGACATTGG - Intronic
1039826665 8:41180187-41180209 CTGAACAATGGGTTGGACATGGG + Intergenic
1044346422 8:91109667-91109689 CTTGACATTGAGCTTAACTTTGG + Intronic
1045706586 8:104930469-104930491 CTGGACACTGTGCTGGTCACTGG - Intronic
1049302325 8:141878195-141878217 CTGAAGACTGAGCGGGACATCGG - Intergenic
1052277200 9:26690421-26690443 CTGAACATTGAGCTTGTGATAGG - Intergenic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1056185273 9:84128600-84128622 CTGGACACTGAGCAGGAGAAAGG - Intergenic
1060282867 9:122225904-122225926 CTGGACGCTGAGCTGGGCTTCGG - Intronic
1062493006 9:136817236-136817258 CTGGAACTTGTACTGGACATGGG - Intronic
1187296535 X:18006999-18007021 CAGGCCATTGAGCTGGGCATTGG - Intergenic
1187399444 X:18946758-18946780 GTGGGCATTGAGTTGGACCTTGG - Intronic
1188567342 X:31542070-31542092 CTGGACATTGTGCTGGCATTGGG + Intronic
1194859533 X:98979869-98979891 CTGGACATTGAGAGGAGCATAGG + Intergenic
1195626567 X:107009971-107009993 CTTGGCATTGAGCTGGACAGTGG - Intergenic
1195655386 X:107327278-107327300 CTTGGCATTGAGCTGGACAGTGG - Intergenic
1197355723 X:125435986-125436008 CTGGCTGTTGAGCTGGACCTTGG + Intergenic
1198107850 X:133477918-133477940 CTGGGAATTGAGCTGGGCCTGGG + Intergenic
1199582677 X:149376101-149376123 CTTGACCTTGAGCTGGAAAGAGG + Intergenic
1202027921 Y:20543846-20543868 CTGGCTACTGGGCTGGACATTGG - Intergenic