ID: 1070789319

View in Genome Browser
Species Human (GRCh38)
Location 10:79180210-79180232
Sequence GTGCACAGCCTGGCACCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070789319_1070789325 1 Left 1070789319 10:79180210-79180232 CCCCGAGGTGCCAGGCTGTGCAC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1070789325 10:79180234-79180256 CCCAAGCACACCCGTGACCAGGG No data
1070789319_1070789323 0 Left 1070789319 10:79180210-79180232 CCCCGAGGTGCCAGGCTGTGCAC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1070789323 10:79180233-79180255 ACCCAAGCACACCCGTGACCAGG No data
1070789319_1070789329 13 Left 1070789319 10:79180210-79180232 CCCCGAGGTGCCAGGCTGTGCAC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1070789329 10:79180246-79180268 CGTGACCAGGGCCATGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070789319 Original CRISPR GTGCACAGCCTGGCACCTCG GGG (reversed) Intronic
900740260 1:4326838-4326860 GTGCACATCCTGGCATCTGTGGG - Intergenic
900770069 1:4533895-4533917 GTGCAAAGCTTAGCACCTGGAGG - Intergenic
900786045 1:4651231-4651253 GTCCACAGCCTGGAACCCTGGGG - Intergenic
902931534 1:19734925-19734947 GAACACAGCCTGGCACCCGGTGG + Intronic
903274601 1:22212593-22212615 GTGCCCAGCCTGGGAGCTCCAGG - Intergenic
904610411 1:31722947-31722969 ATGCCCACCCTGGCACCTCATGG - Intergenic
905300566 1:36983861-36983883 GAACACTGCCAGGCACCTCGTGG - Intronic
905517187 1:38570340-38570362 CAGCACAGCCCAGCACCTCGAGG + Intergenic
905690103 1:39936686-39936708 GCCCACAGCCTGGCTCCACGAGG - Intergenic
906206211 1:43988062-43988084 GAGCACAGCCTGGCACATGGTGG + Intronic
910759012 1:90717624-90717646 GCCCACAGCCTGGCACCGGGCGG + Intergenic
910881685 1:91927460-91927482 GTGCATATTCTGCCACCTCGTGG + Intergenic
915080408 1:153348192-153348214 GTACACAGCCTTGCACGCCGTGG - Intronic
915357225 1:155262531-155262553 GTGCTCAACCTGGCTCCTAGGGG - Intergenic
916123012 1:161545518-161545540 TTGCTCAGCCTGGCAATTCGTGG + Intronic
916826925 1:168451219-168451241 GTGCCCAGCCTGCCACCACAGGG + Intergenic
919825227 1:201498800-201498822 CTGCAGAGCCTGGCTCCTAGTGG + Intronic
922536779 1:226386756-226386778 GGGCTCAGCCTAGCACCTCCAGG - Intronic
1063348978 10:5337299-5337321 GAGCACAGCCAGGGACCTGGGGG + Intergenic
1064112869 10:12553460-12553482 TTGCACAGCCTGGGTCCTCTGGG - Intronic
1064981778 10:21173459-21173481 GTGCCCAGCCTGGTCCCTCCGGG + Intronic
1065496566 10:26335385-26335407 GTGCACTGCCTGGATCCTTGAGG - Intergenic
1070740988 10:78903149-78903171 GTACAGAGCCTGGCACTTAGTGG - Intergenic
1070789319 10:79180210-79180232 GTGCACAGCCTGGCACCTCGGGG - Intronic
1070824628 10:79384119-79384141 GTGCAGAGCCAGCCACCTTGGGG - Exonic
1075027077 10:118993286-118993308 GTGCAAAGCCAGGCTCCTCCAGG + Intergenic
1075782668 10:125027055-125027077 GTCCACAACCAGGCACGTCGGGG + Exonic
1076381287 10:130026096-130026118 GTGCCCAGGCTGGCACCCCCTGG - Intergenic
1076643141 10:131932285-131932307 CGGTACAGCCTGGCACCTCCTGG - Intronic
1076646113 10:131955879-131955901 GCACACAGCCTGGCACCCCGTGG + Exonic
1077164496 11:1129030-1129052 GTGCAACGCCTGCCACATCGGGG - Intergenic
1077223522 11:1427621-1427643 GTGCACCGCCTGCCCCCTCAGGG + Intronic
1079529050 11:21427030-21427052 GTCCACAGCCAGGCAGCTGGTGG + Intronic
1079818583 11:25094689-25094711 GTGCACAGCCTGGCACAGACTGG + Intergenic
1080304929 11:30825978-30826000 GCCCACTGCCTGGCACCTGGAGG + Intergenic
1083748336 11:64747075-64747097 GTGGACAGCCGGGGACCTAGAGG + Intronic
1083837533 11:65281372-65281394 GTGCACAGTCATGCACCTCATGG - Intronic
1084614325 11:70225806-70225828 GTACACAGCCTGGAACCAGGAGG + Intergenic
1089281819 11:117380056-117380078 GGGCACCACCTGGCACCTGGAGG - Intronic
1090635565 11:128688592-128688614 GAGCCCAGCCTGGCCCCTAGGGG + Intronic
1091407655 12:219348-219370 GAGCACAGCACGGCACCACGCGG + Intergenic
1095521469 12:43071913-43071935 GTTCAATGCCTGGCACATCGTGG + Intergenic
1095789332 12:46147195-46147217 GTTCACAGCCTGGCAACTTAGGG - Intergenic
1096080595 12:48829926-48829948 GTGCACAGCCCCGCACCAAGGGG - Exonic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1104816442 12:131648748-131648770 CTGCACATCCTGGCTCCTTGTGG - Intergenic
1110850666 13:80241279-80241301 GAGCACAGCCAGGCAGCTCCAGG + Intergenic
1113433968 13:110274685-110274707 GTGCACAGCCAGGCCACTCTTGG - Intronic
1113617617 13:111692379-111692401 GTGGGCAGCCTGGCAGCTCAGGG - Intergenic
1113623147 13:111777639-111777661 GTGGGCAGCCTGGCAGCTCAGGG - Intergenic
1113788663 13:113016030-113016052 GGGCACTGCCTGGCAACTGGAGG - Intronic
1114714107 14:24806464-24806486 GTGCCCTACCTGGCACCTCCTGG - Intergenic
1115828992 14:37313400-37313422 GGGCAAGGCCTGGCACCTGGAGG + Intronic
1122075329 14:99231678-99231700 CTGCAGGGCCTGGCACCCCGGGG - Intronic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1122309197 14:100783824-100783846 GTGCACAGCCTCACACGTTGGGG - Intergenic
1122543882 14:102511739-102511761 GTGCACAGCCTGGCATCCACTGG - Intergenic
1122762268 14:104037981-104038003 TAGCAGAGCCTGGCACCTCCAGG + Intronic
1124679281 15:31715882-31715904 GCGCACAGCCTAGCACCTGTAGG - Intronic
1128370081 15:67033934-67033956 GTGCACACCCTGGCTGGTCGTGG + Intergenic
1128923195 15:71630838-71630860 GTGCACAGGATGGCTCCTCACGG + Intronic
1130702705 15:86201648-86201670 GTGCAAAACCTGGCAGCTGGAGG + Intronic
1130734975 15:86538551-86538573 GTGCACAAGCTGGAACCTCCAGG + Intronic
1132418904 15:101647435-101647457 TTGCACAGCCTGGCAACTCAGGG + Intronic
1133495131 16:6310704-6310726 GGGCACAGCCTGGTGCTTCGAGG + Intronic
1134089968 16:11386295-11386317 GTGCACAGCCAGGCACCTGTCGG + Intronic
1134360648 16:13528077-13528099 GTATACTGCCTGGCACTTCGGGG + Intergenic
1137558429 16:49488052-49488074 GTGCAGTGCCTGGCACCTGGGGG + Exonic
1141462128 16:84183821-84183843 GTGCACAGCCTGGCCCAGGGAGG - Intronic
1141597039 16:85103758-85103780 GTCCAGGGCCTGGCACCTAGTGG - Intronic
1141637703 16:85323534-85323556 TGGCACAGCCTGGTAGCTCGCGG + Intergenic
1141976956 16:87523134-87523156 GTTCACAGCCTGGGCCCTAGAGG + Intergenic
1142189230 16:88710043-88710065 CTGAGCAGCCTGGCCCCTCGAGG + Intronic
1142741961 17:1936678-1936700 GGGCATAGTCTGGCAGCTCGGGG + Exonic
1143200335 17:5109037-5109059 GTGCAGGGCCTGGGACCTGGAGG + Exonic
1144731203 17:17527422-17527444 GTGCCCAGCAGGGCAGCTCGTGG + Intronic
1147912484 17:43864352-43864374 GGGCACAGGCTGGCACCTTCTGG - Intergenic
1151537579 17:74747709-74747731 GCGGAGAGCCTGGGACCTCGAGG - Intergenic
1151893383 17:76964217-76964239 GCCCACAGCCTGGACCCTCGGGG - Intergenic
1152015715 17:77749158-77749180 GTGCCCAGCCTCGCAGCTCGGGG - Intergenic
1152197396 17:78925537-78925559 GTGCCCGGCCTGGCACGTCGGGG + Intergenic
1152250049 17:79207768-79207790 GTGCACACCAGGGCACCTCCAGG + Intronic
1152616403 17:81339925-81339947 CTGCACAGCCTGGCAGGTGGGGG + Intergenic
1152718546 17:81911373-81911395 GCGGACAGCCTGGCAGCTCCCGG + Exonic
1158888973 18:61855642-61855664 GTGCACAGCCAGGCACACCAGGG - Intronic
1160727092 19:622133-622155 GGGCACTGCCTGGCACCTGCTGG + Exonic
1161219986 19:3114014-3114036 GTGCACAGCCTGCCACGCGGGGG - Intronic
1162369526 19:10270513-10270535 GAGCAGAGCCAGGCACCTCCCGG - Intergenic
1162799137 19:13101403-13101425 GTGCGCTGCCTAGCACCTGGGGG - Intronic
1164541413 19:29124198-29124220 GGGCACAGCCTCTCACCTGGCGG + Intergenic
1164633039 19:29774112-29774134 GTGCACAGCATGGCACCCATTGG - Intergenic
1165769117 19:38368142-38368164 GTGCGTAGCCTGGCCCCTCTTGG + Intronic
1166792202 19:45405005-45405027 GGGCAGATCCTGGCACCTGGGGG + Intronic
1166988788 19:46678286-46678308 GGAAACAGCCTGGCACCTTGGGG - Intronic
1168245175 19:55109528-55109550 CTGCTCAGCCAGTCACCTCGTGG - Intronic
1168432750 19:56294225-56294247 GTACAGAGCTTGGCACCTGGTGG - Intronic
925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG + Intronic
926320265 2:11744462-11744484 CTGCCCAGCCTACCACCTCGGGG - Intronic
928613999 2:33018316-33018338 GTGCAAAAGCTGGCACCTAGGGG - Intronic
929448824 2:42022797-42022819 CTGAACAGCCTGGCACATAGTGG - Intergenic
929780800 2:44955672-44955694 GTGCTCAGCCTTGGACCCCGCGG + Intergenic
930295066 2:49544390-49544412 GTGCTCAGCCAGGTACCTGGAGG - Intergenic
936548328 2:113412132-113412154 AAGCACAGCCTGGAACCTGGAGG + Intergenic
937740378 2:125345614-125345636 GTGCACAGTCTGGCACATTTGGG - Intergenic
937904327 2:127045532-127045554 GTGCAGAGCCTGAGGCCTCGGGG + Intergenic
940895756 2:159080797-159080819 GTGTACAGCCCGGCTCCTCTTGG + Intronic
941788196 2:169521840-169521862 GAGAACTGCCTGGCACCTCCAGG - Intronic
944202790 2:197125857-197125879 GCGCACAGCCTTGCACCATGCGG - Exonic
946093297 2:217249698-217249720 GTGCAAAGCCCGGCACTTCCTGG + Intergenic
947186784 2:227462795-227462817 GTGCACATCCTGGAGCCCCGGGG + Intergenic
948858246 2:240740608-240740630 TGGCACAGCCTGGCCCCTCTGGG + Intronic
1172107331 20:32524655-32524677 GGGCACAGCCTGGCATCACGGGG - Intronic
1172330840 20:34075110-34075132 GTGCACAGCCTGGGAGCCCTGGG + Intronic
1174412517 20:50345211-50345233 GAACACAGCCTGGCACGTAGTGG + Intergenic
1176072941 20:63236228-63236250 CTGCAGAGCCTGGGACCACGTGG + Exonic
1176269122 20:64226316-64226338 GGGCACAGCCTGGCACCCAAAGG - Intronic
1181765470 22:25088444-25088466 CTGCAGAGCCTGGCACCTGGTGG - Intronic
1184019194 22:41809225-41809247 GTGCATGGCCTGGCACCTTGTGG + Intronic
952167689 3:30768905-30768927 GTGCCCAGCCTGCCCCCTGGTGG - Intronic
952339311 3:32432233-32432255 TTGCACTGCCTGGTACCTAGCGG + Intronic
952958545 3:38575692-38575714 GTGAACAGCCTGGCAGGTCTGGG + Intronic
953607444 3:44420917-44420939 GGGCACAGCCTGGGGCCTCCTGG - Intergenic
955290856 3:57691362-57691384 ATGCAGTGCCTGGCACCTAGTGG - Intronic
958170457 3:89933275-89933297 GTCCACAGCCTGACACATGGGGG + Intergenic
961017161 3:123477160-123477182 CTGCAAAGCCTGGCACATCGGGG - Intergenic
963068392 3:141281792-141281814 GTGGACAGCTTGGCACATTGGGG + Intronic
968470177 4:777188-777210 GTCCACACCCTGGCAGCTTGGGG + Intergenic
969872175 4:10111444-10111466 GTGCAGAGCCAGGAACCTCTAGG - Intronic
976392749 4:84522830-84522852 GTTCACAGCCTGACACTTAGTGG - Intergenic
977920153 4:102634468-102634490 GAACACAGCCTGGAACCTAGTGG + Intronic
978620763 4:110632825-110632847 CTGCCCAGGCTGGCCCCTCGGGG + Intronic
984158156 4:176217701-176217723 GTGCAAAGCCTGGCACATGCTGG + Intronic
986670518 5:10139322-10139344 GGGCACAGCCTAGGACCTGGGGG - Intergenic
990943467 5:61227080-61227102 CTGCACAGGCTGGCTCCTCTTGG + Intergenic
994986590 5:106941309-106941331 CAACACAGCCTGGCACCTCAAGG - Intergenic
996919396 5:128750001-128750023 GTACAAGGCCTGGCACCTAGAGG - Intronic
999306059 5:150520468-150520490 TTGCACAGCCTGGGAACTAGAGG - Intronic
1001289873 5:170449433-170449455 GGGCAGAGCCTGGCACTTCCAGG + Intronic
1001406164 5:171479301-171479323 GGGTACAGCCTGGCTCCTCCAGG - Intergenic
1002582028 5:180214887-180214909 GTGCCCAGCCTGCCTCCTCCTGG - Intergenic
1003136465 6:3438354-3438376 GTGCCAAGGCAGGCACCTCGTGG - Intronic
1003245447 6:4378531-4378553 GTCCACTGCCTGCCACCCCGAGG + Intergenic
1004856054 6:19751430-19751452 GTCCACTGCCTGGCACCCTGAGG - Intergenic
1006924939 6:37648923-37648945 GGGCAGAGCCTGGCCCCTGGTGG + Intronic
1007116675 6:39348012-39348034 GTGCAGAGCCTGCCACCTGGTGG - Intronic
1012916816 6:105179763-105179785 GTCCGCACCCTCGCACCTCGCGG - Intronic
1016258123 6:142133915-142133937 CTGCAAAGCCTAGCACCCCGAGG - Exonic
1018944935 6:168341110-168341132 GTGCATGTCCTGGCACCTCAGGG - Intergenic
1018955936 6:168410705-168410727 GTGCACAGCCTGCCAGGGCGGGG + Intergenic
1019146687 6:169980039-169980061 CTGCAGAGCCTGCCACCTCCGGG - Intergenic
1019760795 7:2811143-2811165 GTGCACAGCCTGGGGGCTCTGGG - Intronic
1020055895 7:5117401-5117423 GTCCACAGCCTGGCCCCTGGAGG - Intergenic
1021057501 7:16067953-16067975 CTCCACAGAGTGGCACCTCGAGG + Intergenic
1031709598 7:125028999-125029021 GTGAAAGGCCTGGCACCTAGTGG + Intergenic
1045564305 8:103298602-103298624 GGGCTCAGCCTTGCGCCTCGGGG + Intronic
1046766505 8:118075207-118075229 GTGCACAGCCTGGTCTCTCTGGG - Intronic
1047507077 8:125488425-125488447 CTGCACAGCCTGGCCTCTGGAGG + Intergenic
1047601028 8:126426033-126426055 AAGCAGAGCCTGGCACCTTGAGG - Intergenic
1047764770 8:127981412-127981434 CTGCACAGCCTGGCATGTGGTGG + Intergenic
1048269910 8:133020326-133020348 GTGCAGGGCCTGTCACCTGGAGG - Intronic
1048955497 8:139532820-139532842 GTTCACTGCTTGACACCTCGTGG + Intergenic
1049234957 8:141507844-141507866 GTGCACAGCGAGGCACGGCGAGG - Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1051075318 9:13226495-13226517 GTGAACAGCTTGGCACTTTGAGG - Intronic
1051721501 9:20041940-20041962 GTGCAGAGTCTGGCACCTGAGGG - Intergenic
1053727235 9:41016655-41016677 AAGCACAGCCTGGAACCTGGAGG - Intergenic
1054701281 9:68415457-68415479 AAGCACAGCCTGGAACCTGGAGG + Intronic
1056235891 9:84593962-84593984 GCACACAGCCTGGCACATCATGG - Intergenic
1056645454 9:88408057-88408079 GTGCCCAGCCTGGAATCTCTTGG + Intronic
1057298237 9:93861567-93861589 GTGCACAGCCGGGCAGGTCCTGG - Intergenic
1057604934 9:96492379-96492401 GCGCACAGCCTGTCACCAGGTGG + Intronic
1059669698 9:116480307-116480329 GACCACAGCCTGGCACATAGTGG + Intronic
1061135400 9:128730600-128730622 TTCCACAGCCTGGGACCTGGTGG + Exonic
1061178068 9:129009224-129009246 GTGGCCAGCCTGGCCCCTCCGGG - Exonic
1061520815 9:131116891-131116913 GTGGACATCCTGGCACCTTTGGG + Intronic
1062028078 9:134349717-134349739 GTGCACAGCCCTGCGCCTCCAGG - Intronic
1062030983 9:134361915-134361937 GTGCACACCCTGGCCCCCCAGGG - Intronic
1062430142 9:136523264-136523286 GAGCCCAGGCTGGCACCTCCAGG - Intronic
1062560829 9:137141174-137141196 GTGCACTGCATGGCCCCACGTGG - Intronic
1062561085 9:137142191-137142213 GGGCACAGCCTGGCCACTCCAGG + Intronic
1062618964 9:137411067-137411089 GGGCATAGGCTGGCACCTCTAGG + Intronic
1062626948 9:137447712-137447734 GTGCGCAGCCTGGCACAGCCTGG - Exonic
1062687915 9:137825477-137825499 GTGCCCAGGGTGGCACCTCTGGG - Intronic
1190338790 X:49280049-49280071 GTGCACATCCTGACTCCCCGGGG + Intronic
1190826656 X:54024130-54024152 GTGCACAGCATGGCCAGTCGCGG + Intronic
1195310726 X:103629501-103629523 GGTCACAGCGGGGCACCTCGAGG + Exonic
1195621172 X:106956464-106956486 GTGCACTGCCTCTCACCTGGTGG + Exonic
1202347973 Y:23954988-23955010 GTGCTCTGACTGGCACCTGGAGG + Intergenic
1202522801 Y:25715116-25715138 GTGCTCTGACTGGCACCTGGAGG - Intergenic