ID: 1070789411

View in Genome Browser
Species Human (GRCh38)
Location 10:79180554-79180576
Sequence CAGTCTGGCCCAAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070789401_1070789411 3 Left 1070789401 10:79180528-79180550 CCAGTAGGCCCTGCCGCCCCTTT 0: 1
1: 0
2: 1
3: 6
4: 141
Right 1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG No data
1070789403_1070789411 -6 Left 1070789403 10:79180537-79180559 CCTGCCGCCCCTTTGCACAGTCT 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG No data
1070789400_1070789411 4 Left 1070789400 10:79180527-79180549 CCCAGTAGGCCCTGCCGCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG No data
1070789398_1070789411 6 Left 1070789398 10:79180525-79180547 CCCCCAGTAGGCCCTGCCGCCCC 0: 1
1: 0
2: 0
3: 33
4: 305
Right 1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG No data
1070789405_1070789411 -10 Left 1070789405 10:79180541-79180563 CCGCCCCTTTGCACAGTCTGGCC 0: 1
1: 0
2: 2
3: 13
4: 232
Right 1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG No data
1070789402_1070789411 -5 Left 1070789402 10:79180536-79180558 CCCTGCCGCCCCTTTGCACAGTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG No data
1070789399_1070789411 5 Left 1070789399 10:79180526-79180548 CCCCAGTAGGCCCTGCCGCCCCT 0: 1
1: 0
2: 2
3: 24
4: 254
Right 1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070789411 Original CRISPR CAGTCTGGCCCAAAGGAAGT GGG Intronic
No off target data available for this crispr