ID: 1070789924

View in Genome Browser
Species Human (GRCh38)
Location 10:79182920-79182942
Sequence CTCACTGCTCAGATGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070789924_1070789934 18 Left 1070789924 10:79182920-79182942 CCCTTCACCATCTGAGCAGTGAG 0: 1
1: 1
2: 1
3: 35
4: 217
Right 1070789934 10:79182961-79182983 AGTATGGTGAGTCAGCCAGGAGG No data
1070789924_1070789932 2 Left 1070789924 10:79182920-79182942 CCCTTCACCATCTGAGCAGTGAG 0: 1
1: 1
2: 1
3: 35
4: 217
Right 1070789932 10:79182945-79182967 CTGGAGTAGGGCAGTTAGTATGG No data
1070789924_1070789933 15 Left 1070789924 10:79182920-79182942 CCCTTCACCATCTGAGCAGTGAG 0: 1
1: 1
2: 1
3: 35
4: 217
Right 1070789933 10:79182958-79182980 GTTAGTATGGTGAGTCAGCCAGG No data
1070789924_1070789935 19 Left 1070789924 10:79182920-79182942 CCCTTCACCATCTGAGCAGTGAG 0: 1
1: 1
2: 1
3: 35
4: 217
Right 1070789935 10:79182962-79182984 GTATGGTGAGTCAGCCAGGAGGG No data
1070789924_1070789936 25 Left 1070789924 10:79182920-79182942 CCCTTCACCATCTGAGCAGTGAG 0: 1
1: 1
2: 1
3: 35
4: 217
Right 1070789936 10:79182968-79182990 TGAGTCAGCCAGGAGGGTCCTGG No data
1070789924_1070789931 -10 Left 1070789924 10:79182920-79182942 CCCTTCACCATCTGAGCAGTGAG 0: 1
1: 1
2: 1
3: 35
4: 217
Right 1070789931 10:79182933-79182955 GAGCAGTGAGGGCTGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070789924 Original CRISPR CTCACTGCTCAGATGGTGAA GGG (reversed) Intronic
900823343 1:4907201-4907223 CTCTGTGCTCACATGGTGGAAGG + Intergenic
903733140 1:25512771-25512793 CTCACTGTTCACATGGTGGAAGG - Intergenic
904381956 1:30117477-30117499 CTCACCCCTCAGATGGAGACCGG + Intergenic
904454348 1:30638401-30638423 CTCACTGCTCAAATGGTGAGCGG + Intergenic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
908203937 1:61825667-61825689 CTCACTGCTCTGTTGCTAAAGGG - Intronic
909029094 1:70517656-70517678 CTTACTGCTGACATGGAGAAAGG + Intergenic
910404667 1:86874492-86874514 CACACTGCTCAGAATGTCAAGGG + Intronic
911283921 1:95966345-95966367 CTCACTTCCCAGATGGTGCGGGG + Intergenic
911443277 1:97957182-97957204 CTCACTGCCCAGACGATGTAAGG - Intergenic
914262911 1:146014338-146014360 CTCAATGTTGAAATGGTGAATGG - Intergenic
914947211 1:152078541-152078563 CTCACTTCCCAGATGGTGAGGGG + Intergenic
914947222 1:152078581-152078603 CTCACTTCCCAGACGGTGCAGGG + Intergenic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
915613710 1:157017235-157017257 CTCACTGCCCAGATTCTGAATGG + Intronic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
916927865 1:169541928-169541950 TTCACTTCTTAGAGGGTGAAAGG + Exonic
917108961 1:171525436-171525458 CCCACTTCTGAGATGGTAAATGG + Intronic
917454508 1:175174477-175174499 CTCATTTCTCAGATGAGGAAAGG - Intronic
923891898 1:238225068-238225090 GTCAGAGCTCAGGTGGTGAAGGG + Intergenic
1062925072 10:1310125-1310147 GTCACTCATCAGATGTTGAATGG + Intronic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1065737979 10:28771623-28771645 CTCACATCTCAGATGATGGACGG - Intergenic
1066025978 10:31361543-31361565 CTCACTTCCCAGATGGTGAGGGG + Intronic
1066025992 10:31361583-31361605 CTCACTTCCCAGACGGTGCAGGG + Intronic
1066026221 10:31362507-31362529 CTCACTGCCCAGACGGGGCAGGG + Intronic
1066263393 10:33751154-33751176 AACACTGATCAGATGGTGTAAGG + Intergenic
1068174955 10:53446425-53446447 CTGAGTGCTCACATGGTGGAAGG + Intergenic
1068660968 10:59622958-59622980 CTCACTTGTCAGATGAGGAACGG + Intergenic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071071149 10:81696025-81696047 CTGATTTCTCACATGGTGAAAGG + Intergenic
1071162036 10:82758636-82758658 TTCACTGGTGAGATGGTGAGGGG - Intronic
1072751569 10:97984315-97984337 ATGACTGCTCAGATGGGGGAGGG - Intronic
1074072288 10:110084614-110084636 CTCATTTCTCATATGGAGAAAGG - Intronic
1076223491 10:128754416-128754438 CTCTCTCCTCAGTTGGTGGATGG - Intergenic
1076357047 10:129860861-129860883 CTCAATTTTCAGATGATGAATGG + Intronic
1077296410 11:1828334-1828356 CTCACTACTCAGATGGTCGGAGG + Intronic
1082781387 11:57290225-57290247 GTGAGTGCACAGATGGTGAATGG + Intergenic
1083182497 11:60996271-60996293 CCCACTGCTCTGATAGGGAAAGG - Intronic
1083308163 11:61771555-61771577 CTCAATGCCCAGATGCTGAATGG + Exonic
1085885727 11:80519590-80519612 CTCACGGCTTGGATGGAGAAAGG - Intergenic
1085906626 11:80772184-80772206 CTCATTGCTGAGATGAGGAAAGG - Intergenic
1086076967 11:82865053-82865075 GTAACTGCCGAGATGGTGAAGGG - Intronic
1086640766 11:89152826-89152848 CTGAGTCCTCACATGGTGAAGGG + Intergenic
1087650371 11:100860272-100860294 AGCACTGCTCAAATGGGGAAGGG - Intronic
1088046386 11:105457429-105457451 CTCACAGCTCAGAAGGAGAAGGG + Intergenic
1088694052 11:112351047-112351069 CTCTCTCCTCAGCTTGTGAATGG - Intergenic
1089788918 11:120928442-120928464 GTAATTGCTCAGCTGGTGAATGG + Intronic
1089969168 11:122678608-122678630 CCCACTGCCCAGAGGCTGAAAGG + Intronic
1090550435 11:127813780-127813802 CTCACTGCTCCCATGGGGCAGGG - Intergenic
1097675187 12:62593460-62593482 CTTACTGGTCAGATGTTTAATGG - Exonic
1097788541 12:63788719-63788741 CTTATTGCTCATATGGAGAAAGG - Intronic
1098387333 12:69933383-69933405 CTGACTATTCATATGGTGAAAGG + Intronic
1101993574 12:109507872-109507894 CACACTGCTCACTTGGTAAATGG - Intronic
1102583950 12:113910235-113910257 CTCCCTGCCCAGGCGGTGAAAGG - Intronic
1103086411 12:118064260-118064282 GTCACAGCTCAGCTGGTCAAAGG + Exonic
1105371148 13:19803304-19803326 GTCACTTATCAGATGGTCAAAGG - Intergenic
1106752752 13:32791841-32791863 CACAGTGCTCAGAAGGTGCAGGG - Intergenic
1109074918 13:57822484-57822506 TTCATTGGTCAAATGGTGAATGG + Intergenic
1110280642 13:73689603-73689625 CTAACTGCAAAGATGGTTAAAGG + Exonic
1110626322 13:77660001-77660023 CTCACTTCCCAGATGGTGAGGGG + Intergenic
1110626571 13:77661084-77661106 CTCACTGCCCAGACGGGGCAGGG + Intergenic
1111777101 13:92678208-92678230 CTAAATGCTTAGATGATGAAAGG + Intronic
1113400243 13:109985824-109985846 CTCACAGCTCAGAACTTGAAAGG + Intergenic
1114570047 14:23660579-23660601 CTCACTGCTCAGACAGAGGAAGG - Intergenic
1118355327 14:65008922-65008944 CTCACTGTGCAGAGGGTGACAGG - Intronic
1120825987 14:88955888-88955910 GTCAAGGCTCAAATGGTGAATGG + Intergenic
1121881440 14:97503871-97503893 CTCTGTCCTCACATGGTGAAAGG - Intergenic
1121948200 14:98143736-98143758 CCCTCTGCTCTGATGGTGTAGGG + Intergenic
1122751598 14:103937977-103937999 CTCAGAGCTCAGTTGGGGAAGGG + Intronic
1123024597 14:105418851-105418873 CTGCCTGCTCAGATGCTGGAGGG - Intronic
1123791703 15:23727635-23727657 CTCCCTCCTCACATGGTGGAAGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124222939 15:27865575-27865597 CTCAGTGTTCAGGTGGGGAATGG - Intronic
1124956396 15:34363307-34363329 CTCAGTCCTCAGATGAAGAAGGG + Intronic
1125328176 15:38558155-38558177 CTGACTGCTGAAATGGTGTAAGG + Intronic
1126112589 15:45184599-45184621 CACACTGCACAGATGGTCACAGG + Intronic
1127858934 15:62976915-62976937 CTCTCTGCTCAGATGCTGAGAGG + Intergenic
1128728080 15:70002510-70002532 GTCACTCCTCTGATGGTGAGAGG + Intergenic
1130865558 15:87930487-87930509 CTCACTCCTCAGAAGGAGGAAGG + Intronic
1131887189 15:96928794-96928816 ATCACTGATAAGATGCTGAAGGG + Intergenic
1133019211 16:2959478-2959500 CCCTCCGCTCAGTTGGTGAATGG + Intergenic
1133849457 16:9488417-9488439 ATGATTGCTCAGATGCTGAAAGG - Intergenic
1136567162 16:31077360-31077382 CCCAGTGCACAGATGCTGAATGG + Exonic
1138829136 16:60357802-60357824 CTCACTTCCCAGATGGTGAGGGG + Intergenic
1138829147 16:60357842-60357864 CTCACTTCCCAGACGGTGCAGGG + Intergenic
1140625173 16:76784868-76784890 CTAACTGCTCAATTGCTGAAGGG - Intergenic
1141263044 16:82471188-82471210 CTCACTGCTCAGAGGTTAAGAGG - Intergenic
1141836847 16:86546295-86546317 CTCTCTGTTCAGGTGGTGAAAGG - Intronic
1141856992 16:86689701-86689723 CTTACTGCTGATATGGTGAAAGG - Intergenic
1144581256 17:16460780-16460802 CTCACAGATGAGAGGGTGAAAGG - Intronic
1147241131 17:39091201-39091223 GGCAGTGCTCAGGTGGTGAATGG + Intronic
1149654387 17:58302604-58302626 CACACAGCACAGGTGGTGAATGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151712100 17:75812848-75812870 CTCACAGCTCACAGGGTGAAAGG - Intronic
1152700068 17:81814263-81814285 CTCACGTCTCTGCTGGTGAATGG - Intergenic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1161003444 19:1922779-1922801 CCCACTGCTGCGATGGTGAAGGG + Intronic
1161003452 19:1922849-1922871 CTCACTGCTGCGATGGTGGAGGG + Intronic
1162475313 19:10896160-10896182 CTCACTGAGCAGATGGTGCCGGG - Intronic
1164016796 19:21261048-21261070 CTCACTTCCCAGATGATGGACGG + Intronic
1164117731 19:22238337-22238359 CACCATGCTCAGCTGGTGAAAGG + Intergenic
1165970621 19:39625958-39625980 CTCTCTGCCCAGAAGATGAAAGG + Intergenic
1165975841 19:39675929-39675951 CTCTCTGCCCAGAAGATGAAAGG - Intergenic
1167830949 19:52022337-52022359 CTCACTTCCCAGATGGTGGGCGG - Intronic
926506966 2:13728696-13728718 GTCACTGCTCAGATGTTATATGG + Intergenic
926942363 2:18151899-18151921 CTCACTCCTAATGTGGTGAATGG + Intronic
929891052 2:45918899-45918921 AACACAGCTTAGATGGTGAAAGG - Intronic
932062923 2:68527038-68527060 CTCACTTCCCAGATGGTGAGGGG + Intronic
932062934 2:68527078-68527100 CTCACTTCCCAGACGGTGCAGGG + Intronic
932063133 2:68527922-68527944 CTCACTGCCCAGACGGGGCAGGG + Intronic
932606046 2:73166363-73166385 CCCACTCCTCAGCTGGGGAAAGG + Intergenic
932837679 2:75052257-75052279 CTAAGTCCTCAGATGGTGGAAGG - Intronic
933654837 2:84879085-84879107 GTCACTGCTCTGATGGCTAATGG + Intronic
933926381 2:87094088-87094110 CCCACTCCTCAGCTGGGGAAAGG - Intergenic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
936993062 2:118386405-118386427 CCCACTGCCCAAATGGTGCAGGG - Intergenic
938794571 2:134706872-134706894 CTCACAGCACAGAGGGTGACAGG + Intronic
940382207 2:153028255-153028277 CTCACTGGTCAGATGCTGTAAGG + Intergenic
942061015 2:172228767-172228789 CACACTTCTCAGATGGAGACAGG - Intergenic
944960588 2:204868094-204868116 CTCACTTCTGGGGTGGTGAAGGG + Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948326240 2:237123983-237124005 CTCACTTGGCAGATGGTGGAAGG - Intergenic
948731501 2:239966674-239966696 CTCACAGTTAAGAGGGTGAATGG + Intronic
948870498 2:240795564-240795586 AGCACTGCCCAGCTGGTGAAAGG - Intronic
1169125727 20:3125488-3125510 CTCACTTCTCAGATGATGGGCGG - Intronic
1170132223 20:13032817-13032839 CTGACTTCTCAGGTGGTGAATGG + Intronic
1172176314 20:32974232-32974254 CCCACGGCTCAGCAGGTGAAGGG + Intergenic
1173510345 20:43623159-43623181 GTCATTGCTAAAATGGTGAAAGG + Intronic
1173984682 20:47251833-47251855 CTCACTTCCCAGATGGTGCGGGG - Intronic
1174739850 20:53001895-53001917 TTCACTGCTTTGATGGAGAACGG + Intronic
1175538917 20:59736140-59736162 CTCAGTCCTCAGATGATGGATGG - Intronic
1176033586 20:63025584-63025606 CCCAGTGCTCAGATGGTCACGGG + Intergenic
1177349778 21:19922340-19922362 CTGTCTCCTCACATGGTGAAAGG + Intergenic
1177606534 21:23385941-23385963 CTCAATGATCAGATGGTAAAAGG + Intergenic
1177800357 21:25822808-25822830 TTCACTGCTTAGACGGTGAACGG + Intergenic
1179113707 21:38470079-38470101 CCCACTGCACAGCTGCTGAATGG + Intronic
1182250682 22:28997554-28997576 CACACTCCTCAGATGGAGAGAGG - Intronic
1182679039 22:32063949-32063971 CTCTCTTCTCAGATAGTGAGTGG + Intronic
1183105393 22:35611665-35611687 CTCACTGTGCAGATGACGAAGGG + Intronic
1184636255 22:45834401-45834423 TTCACTGCCCAGATGGTGGCAGG - Intronic
1185187918 22:49413939-49413961 CTCTCTCCTCAGCTGGTGGACGG + Intergenic
1185349336 22:50326505-50326527 GTCACTGCTCCGGTGGGGAATGG + Intronic
950110680 3:10416932-10416954 CTCACTTCCCAGATGGTGGGTGG + Intronic
950110689 3:10416971-10416993 CTCACTTCCCAGATGGTGAGTGG + Intronic
950147943 3:10665077-10665099 CTCAAAGATCAGATGGTAAAGGG - Intronic
950271578 3:11620307-11620329 TTCACAGAGCAGATGGTGAAGGG + Intronic
950361285 3:12451110-12451132 GCCACAGCTGAGATGGTGAATGG - Intergenic
953226421 3:41025729-41025751 ATCACTGCTCAGATCAAGAAGGG + Intergenic
953918679 3:46937121-46937143 GTCACTCCTGAGATGGTGAGGGG + Intronic
955879311 3:63526881-63526903 CTCAGAGCTCAGATGGTGAGTGG + Intronic
956887951 3:73579185-73579207 CTTTCTCCTCACATGGTGAAAGG - Intronic
958104965 3:89059804-89059826 CTCACTGTACAGATAATGAAAGG + Intergenic
958787788 3:98617078-98617100 CTCACTGTGAAGATGGAGAAAGG - Intergenic
959657728 3:108829000-108829022 TTCACTCATCAGATGCTGAAGGG - Intronic
961605072 3:128087586-128087608 CTAAGTGGTGAGATGGTGAATGG + Intronic
962449151 3:135497463-135497485 TTCACTGACCAGATGGAGAAAGG + Intergenic
966116323 3:176467654-176467676 CTCACTGCTGAGATAGAGAAAGG + Intergenic
966285408 3:178289304-178289326 CAAACTGCTCTGGTGGTGAAGGG - Intergenic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
967155556 3:186688570-186688592 CTCACTCTTCAGATGGTAGAAGG + Intergenic
967511823 3:190321979-190322001 CTCACTGCTCAGATTCAGCAAGG + Exonic
967927376 3:194662158-194662180 CTCACTGTTCAGATGGATTACGG - Intronic
969060254 4:4428354-4428376 CTTACTGCTTAGAAGGTGAGGGG - Intronic
970316693 4:14834764-14834786 CTCACTGCACTAATAGTGAAGGG + Intergenic
970988590 4:22187293-22187315 ATCACGGCTCAGATGCAGAATGG - Intergenic
972624029 4:40778527-40778549 CTGTATCCTCAGATGGTGAAAGG - Intronic
973553748 4:52060918-52060940 CTCACTGTTCAGAAAGTCAAGGG - Intronic
974922327 4:68257199-68257221 GTCACTGCTCATATGATGATTGG + Intergenic
975599231 4:76082083-76082105 TTCACTGAACAGATGGTAAAAGG - Exonic
976117162 4:81740151-81740173 TTTCCTGCTCACATGGTGAATGG - Intronic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
982713606 4:158783639-158783661 TTCACTAATCTGATGGTGAACGG - Intronic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986245473 5:6002948-6002970 CTCAGTTCTCAAATGGTGAACGG - Intergenic
988186072 5:27863802-27863824 CTCGCTAATCAGGTGGTGAATGG + Intergenic
990133448 5:52616394-52616416 AACACTGCTCAGATGGGGAGAGG + Intergenic
991246494 5:64513809-64513831 CTCACTGGTCAAATAGTGAAAGG + Intronic
991695895 5:69271199-69271221 TTCACTGCTCTAATGGTTAATGG + Intronic
993738878 5:91511612-91511634 CTCACTGTTCAGTGGATGAATGG + Intergenic
994476439 5:100276899-100276921 CTCTCTGCTTATATGGAGAATGG - Intergenic
995012807 5:107276704-107276726 CTCACTTCTGAGATGATGATTGG - Intergenic
995966550 5:117914517-117914539 CTCACTTCACCGAAGGTGAAGGG - Intergenic
996035330 5:118752248-118752270 CTAATTGCTCAGATTGTTAAAGG - Intergenic
997741765 5:136261086-136261108 CTCTCTGCTCAGATGTTGAGAGG - Intronic
997823356 5:137085420-137085442 CTCTCTGTGCAGATGGTGAGTGG - Intronic
999063302 5:148658273-148658295 ATCACTCCTGACATGGTGAATGG + Intronic
1000452879 5:161412216-161412238 CTCACTCCTCAGGTGCAGAATGG + Intronic
1004312204 6:14555452-14555474 CGCACTGCTCTGATGGTTACAGG - Intergenic
1004410898 6:15380575-15380597 CTCACTGGACGGATGGTGCATGG + Intronic
1005243407 6:23855730-23855752 CTCACTGCCCAGACGGGGCAGGG - Intergenic
1005243518 6:23856214-23856236 CTCACTTCCCAGATGGTGCAGGG - Intergenic
1006207199 6:32357896-32357918 CTCACTGCACAAAGGGTTAAGGG + Intronic
1007282219 6:40721014-40721036 GCCACTGCTCAGATGGGAAAAGG + Intergenic
1007401615 6:41605750-41605772 CTGACTACTCAGAAGGTTAAGGG + Intergenic
1007691124 6:43702277-43702299 CTCACTGGGCAGATGGTCAGGGG - Intergenic
1009398278 6:63228071-63228093 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1011224067 6:85087551-85087573 CTGGCTCCTTAGATGGTGAAAGG - Intergenic
1013180990 6:107716922-107716944 CTCACTGCTGAGAATGTGCATGG + Intronic
1013540711 6:111105625-111105647 CTCACTGCTCAGTGTGTGACAGG - Intronic
1015181135 6:130364409-130364431 CTCACTCCTTAGATAGTGAGGGG + Intronic
1016034499 6:139373026-139373048 CTCACTTTTCAGATCTTGAAAGG - Exonic
1017120788 6:151022133-151022155 CTCACTGCCCAGATGGCCAGGGG + Intronic
1019868626 7:3737254-3737276 CTCTCTGGTCAGGTGGTCAATGG + Intronic
1020158928 7:5752921-5752943 CTGACTCCTCAGATGAGGAAAGG - Exonic
1021463752 7:20918235-20918257 ATCTCTTGTCAGATGGTGAAAGG - Intergenic
1023978395 7:45051033-45051055 CCCACTGCTCTGAGGGTGGATGG - Intronic
1026163558 7:67890469-67890491 CTCACTTCCCAGATGGTGGGTGG - Intergenic
1028334826 7:89638997-89639019 CTCAGTGCTTACATGCTGAATGG - Intergenic
1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG + Exonic
1030099883 7:105936430-105936452 CTCTGTGCTCACATGGTGGAAGG - Intronic
1031242111 7:119259054-119259076 CTCACTGGTCATATTGTGAAAGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032892483 7:136213235-136213257 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1034949532 7:155287695-155287717 CTCACTTCTGAGGAGGTGAATGG + Intergenic
1035144430 7:156799856-156799878 CTTACTGCTGATATGGAGAAAGG + Intronic
1036625365 8:10466913-10466935 CTCACAGCTCAGGTAGTCAAGGG + Intergenic
1038944110 8:32337841-32337863 CTCATTTCTGAGATGATGAATGG - Intronic
1039311249 8:36320836-36320858 CTCACTTCCCAGATGGTGCTGGG + Intergenic
1045742311 8:105375603-105375625 TTCACTACTCAACTGGTGAAGGG - Intronic
1046132542 8:109984971-109984993 CTCACTGCCCATTTGGAGAAGGG - Intergenic
1046685800 8:117225534-117225556 ACCACTGCTCAGATAGGGAAGGG + Intergenic
1047846851 8:128815477-128815499 CACACTGCTCAGTGGGTGAACGG + Intergenic
1048604516 8:135953904-135953926 ATCACTGCTCAGACAGTGACAGG + Intergenic
1049659102 8:143811763-143811785 CTCACTGGGGAGATGGAGAAAGG - Intronic
1052413542 9:28149546-28149568 CTCACTGCCCAGACGGGGCAGGG - Intronic
1052413697 9:28150229-28150251 CTCACTTCCCAGATGGTGAGGGG - Intronic
1055231676 9:74074160-74074182 CTCACTTCTCAGAAGGTGGGGGG + Intergenic
1055340808 9:75280795-75280817 GTCACTGCTCAGATGCTGGTGGG - Intergenic
1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG + Intergenic
1056019927 9:82430913-82430935 CTCACTTCCCAGATGGTGAGGGG + Intergenic
1056019936 9:82430953-82430975 CTCACTTCTCAGACAGTGCAGGG + Intergenic
1056548683 9:87634272-87634294 CTCATTGATCAGTTGCTGAATGG + Intronic
1056576099 9:87857253-87857275 CTCACTTCCCAGATGGTGTGGGG + Intergenic
1056576262 9:87857941-87857963 CTCACTTCCCAGATGGTGCAGGG + Intergenic
1057071907 9:92106080-92106102 CTCACTTCCCAGACGGTGCAGGG - Intronic
1057071918 9:92106120-92106142 CTCACTTCCCAGATGGTGAGGGG - Intronic
1058825778 9:108774807-108774829 CTCACTGCTCCCATGGTCCAAGG + Intergenic
1060409571 9:123391071-123391093 CACACTGCTGTGATGGTGGAGGG + Intronic
1062448372 9:136605140-136605162 CTCACTGCTCCGCTGGCCAAGGG + Intergenic
1186286483 X:8049284-8049306 TTCAGTGCTCAGATGATGCATGG + Intergenic
1186594364 X:10964959-10964981 CTCTGTCCTCATATGGTGAAAGG + Intergenic
1188137853 X:26511915-26511937 TTCACTGCTGAGATGCAGAATGG - Intergenic
1191061180 X:56298158-56298180 TTCACTCCTCAGCTGGTGAGGGG - Intergenic
1192658811 X:73021534-73021556 CTCACTTCCCAGATGATGAGCGG + Intergenic
1194414334 X:93591983-93592005 CTCACTGGTCAAATGCTGATGGG - Intergenic
1194734879 X:97500255-97500277 TTCAGAGCTCAGAAGGTGAAAGG - Intronic
1196012932 X:110907267-110907289 TTCACTGCCCACATTGTGAAGGG - Intergenic
1198308337 X:135404618-135404640 CTGAGTCCTCACATGGTGAAGGG + Intergenic