ID: 1070790427

View in Genome Browser
Species Human (GRCh38)
Location 10:79186041-79186063
Sequence AGGGACCTGAAAGTGAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070790427_1070790439 29 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790439 10:79186093-79186115 GAAAGGGTGTGAAGAGACTTGGG No data
1070790427_1070790430 -8 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790430 10:79186056-79186078 AGGTCCCTGGATGTTTTTGAGGG No data
1070790427_1070790435 7 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790435 10:79186071-79186093 TTTGAGGGCACTGTAGAGGAGGG No data
1070790427_1070790437 13 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790437 10:79186077-79186099 GGCACTGTAGAGGAGGGAAAGGG No data
1070790427_1070790433 3 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790433 10:79186067-79186089 TGTTTTTGAGGGCACTGTAGAGG No data
1070790427_1070790429 -9 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790429 10:79186055-79186077 CAGGTCCCTGGATGTTTTTGAGG No data
1070790427_1070790434 6 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790434 10:79186070-79186092 TTTTGAGGGCACTGTAGAGGAGG No data
1070790427_1070790436 12 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790436 10:79186076-79186098 GGGCACTGTAGAGGAGGGAAAGG No data
1070790427_1070790438 28 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790438 10:79186092-79186114 GGAAAGGGTGTGAAGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070790427 Original CRISPR AGGGACCTGAAAGTGAACAC TGG (reversed) Intronic
900914067 1:5622036-5622058 AGAGACCTGGACGTGAAGACAGG - Intergenic
902828609 1:18995248-18995270 AGGGATCTGAGAGTGAATATGGG - Intergenic
903680734 1:25095058-25095080 AGGGTGCTGAATCTGAACACGGG + Intergenic
904924216 1:34033563-34033585 AGGGACCTGATTGTGCACACAGG + Intronic
906458360 1:46018029-46018051 TGGGAACTGAAAGTGGCCACAGG - Intronic
906667418 1:47631679-47631701 AGGCACTTGAATGTGAAAACGGG - Intergenic
907176197 1:52524899-52524921 ATGCAGCTGAAAGGGAACACAGG - Intronic
907602041 1:55781746-55781768 AGCTGCCTGAAAGTGAACAGGGG - Intergenic
908322880 1:62994943-62994965 AGGAACCTAAAATTGAACATGGG + Intergenic
911391392 1:97248620-97248642 AGGGTACAGAAAGTGTACACAGG + Intronic
912089885 1:106058435-106058457 ATGGAGCTGATAGTGAACTCTGG + Intergenic
914263773 1:146020489-146020511 AGGGCCCTAAAAGTGGCCACAGG - Intronic
916057638 1:161079116-161079138 TGGGTCCTGAATGTGAACACAGG - Intronic
916244722 1:162675867-162675889 AGAGAGCTGAAAGTGTAGACAGG + Intronic
916497812 1:165360945-165360967 AGAGATCTGAATGTCAACACAGG - Intergenic
916722923 1:167498387-167498409 AGGGAGCTGAAGATGAGCACAGG + Intronic
916808560 1:168284293-168284315 ATGGACATGAAAGGGAATACTGG - Intronic
917881464 1:179341106-179341128 AGGGAACTGAAAATGTAGACAGG - Exonic
921989495 1:221349183-221349205 ATGGGCCTGAAAGTGATCCCTGG + Intergenic
922075361 1:222238357-222238379 AGGGAGCTGAAAGAGAGCCCAGG - Intergenic
1063590746 10:7393552-7393574 ACATACCTGAAAGTGCACACAGG + Intronic
1063792609 10:9471086-9471108 AGGGAACTAAAAGAGAAAACAGG + Intergenic
1064621548 10:17222518-17222540 AGGGAACTGAAAGTTAACGTGGG - Intergenic
1067112072 10:43408194-43408216 AGGGCTCTGAAAGTGAGAACAGG - Intronic
1070583802 10:77745769-77745791 ATTGACCTGAGAGTGAAGACTGG + Intergenic
1070696605 10:78568610-78568632 AGGGGCTTGAAAGAGAACCCTGG + Intergenic
1070790427 10:79186041-79186063 AGGGACCTGAAAGTGAACACTGG - Intronic
1072179527 10:92967937-92967959 AGGGAACTGATTATGAACACTGG + Intronic
1073076325 10:100827526-100827548 GGGAACCTGGAAGTTAACACAGG - Exonic
1074395718 10:113096509-113096531 AGAGACGTGACAGAGAACACTGG - Intronic
1077480307 11:2811516-2811538 AGGGGACAGAAGGTGAACACAGG + Intronic
1083980165 11:66160948-66160970 CGGGACCTGAATATGAACCCAGG - Intronic
1086402648 11:86473273-86473295 AGGGACCACAAAGTGTACATTGG + Intronic
1089615272 11:119691550-119691572 AGGGACCTGGATGTGTCCACAGG - Intronic
1090618599 11:128540872-128540894 AGGGAGGTGAAAATCAACACAGG + Intronic
1092120501 12:6040337-6040359 AGGTCTCAGAAAGTGAACACTGG + Intronic
1093005467 12:14046338-14046360 AGGCACCTGAAAGTAGACAGAGG + Intergenic
1093160944 12:15745654-15745676 AAGGATTTGAAAGTGAACAATGG - Intronic
1093603286 12:21057627-21057649 AGGGACTAGAAAGTGACCATTGG + Intronic
1094009158 12:25788342-25788364 AGGCATCTCAAAGTGAAGACAGG + Intergenic
1094469590 12:30791399-30791421 AGGGCCCTGAAAGACAACTCAGG + Intergenic
1096795773 12:54076625-54076647 AGGGACCAAAAAGGGGACACTGG + Intergenic
1098124396 12:67275160-67275182 AGGGACCTCACAGAGAAAACTGG + Intronic
1101287598 12:103331576-103331598 AGGGAGCTGAAGGGGAACAGAGG + Intronic
1103364097 12:120369554-120369576 AGGGACCTGAGAGGGAAGACCGG - Intergenic
1104966938 12:132512600-132512622 AGGGGCCTGAAAGTGGAAAGAGG - Intronic
1107149956 13:37099515-37099537 AGGGATCTGAAAGTGAGGCCCGG + Intergenic
1107559283 13:41545658-41545680 AGGGACCAGAAAGGGAGCATGGG - Intergenic
1108709004 13:53015218-53015240 AGGTCCCTGAAAGTGAGAACAGG - Intergenic
1109125979 13:58517410-58517432 AGGAAGTTAAAAGTGAACACGGG + Intergenic
1109617560 13:64855446-64855468 AGAGACCTCAAAGTGAAAAGTGG - Intergenic
1110320731 13:74157571-74157593 GGGGAGCTCAAAGTGATCACTGG + Intergenic
1110767552 13:79298227-79298249 AGGGAACTCAACGTGAACAGTGG - Intergenic
1111127986 13:83936512-83936534 TGGGATGTGAAAGTGAACAGAGG + Intergenic
1112448749 13:99490655-99490677 AAGGATCTGAAAGTGAAAAATGG - Intergenic
1114166013 14:20219079-20219101 AGGTGCCTGCCAGTGAACACAGG + Intergenic
1116375991 14:44201769-44201791 AGGGAAATGAAAGTGAACTGTGG - Intergenic
1119233983 14:73004374-73004396 AGGCACCTGAAAGTGGGGACGGG + Intronic
1119563274 14:75607744-75607766 AGGGCACTAAAAGTCAACACTGG - Intronic
1119757540 14:77129575-77129597 ATGGCCCTGAAGGTGAAAACGGG - Intronic
1119945270 14:78686819-78686841 AGTGAGCTAGAAGTGAACACAGG - Intronic
1121935405 14:98013959-98013981 AGAGTCCTGACAGTGAAGACTGG + Intergenic
1122288013 14:100664094-100664116 AGGCACAGGAATGTGAACACAGG - Intergenic
1124841671 15:33247857-33247879 AGAGAAATGAAAGTGATCACAGG - Intergenic
1125518792 15:40337119-40337141 AGGGACCTCAAAGAGACCCCGGG + Intronic
1127632439 15:60839764-60839786 TGGTGCCTGTAAGTGAACACAGG - Intronic
1132032937 15:98453124-98453146 AGGGATCTGAGAGAGAACACAGG - Intronic
1132480900 16:165675-165697 AGGAACCGGAGAGAGAACACCGG - Intronic
1132684639 16:1157224-1157246 AGGGACCAGAAGGTGACCAAGGG + Intronic
1132787439 16:1665596-1665618 AGAGACGTGGAAGTCAACACTGG - Intronic
1133483721 16:6197435-6197457 GGGGACCTGCAAGCCAACACTGG + Intronic
1134207665 16:12251005-12251027 AGGGCCCTGAAGGTGAAGAAGGG - Intronic
1135061430 16:19274349-19274371 ATTGACCTGAAAGTTAAGACTGG - Intergenic
1135531287 16:23256915-23256937 AGGGGACTGAATGTGAACATGGG - Intergenic
1136668988 16:31839310-31839332 TGGGACAGGGAAGTGAACACTGG + Intergenic
1137835937 16:51592596-51592618 AGTGGCCAGTAAGTGAACACCGG + Intergenic
1139655089 16:68382628-68382650 AGGGAACTGAGAGTGGACTCAGG + Intronic
1141466129 16:84206899-84206921 AGGGACAAGACAGTGAACAGGGG - Intergenic
1141930983 16:87202705-87202727 AGTGACCTCAAAATGAACACAGG + Intronic
1143424239 17:6821117-6821139 AGGGTCCTGAAATTTCACACTGG + Intronic
1144819190 17:18059483-18059505 AGGGACCGGGAATGGAACACGGG + Intronic
1149529084 17:57380535-57380557 GGGGACCTGTAAGTGCCCACTGG + Intronic
1151669425 17:75563895-75563917 CGGGACCTGAGAGTGTTCACTGG - Intronic
1152373619 17:79906107-79906129 AGGGACCAGGAAATGACCACTGG + Intergenic
1155576214 18:27250024-27250046 AAGGCCCTGTAAGTGAAAACGGG - Intergenic
1156507677 18:37608725-37608747 AGGGACCTGAGGGTGCTCACTGG + Intergenic
1156797454 18:41064137-41064159 AAGGACATGAAAGTGAACTGAGG + Intergenic
1159491635 18:69142944-69142966 AAGGACCTGATGGTGAAGACTGG - Intergenic
1160880256 19:1316423-1316445 AGGACCCAGAAAGTGGACACAGG - Intergenic
1162049260 19:8022556-8022578 AGGATCCAGAAAGTGAACTCTGG - Intronic
1163232563 19:16014475-16014497 AGGAACATGAAAGTGACCATTGG + Intergenic
1164071050 19:21768464-21768486 AGAGACCAGATAGTGAACAAAGG + Intergenic
1165828445 19:38718851-38718873 AGGGACGTGCCAGTGAACATGGG - Intronic
1167118389 19:47501425-47501447 AGGGAACAGAATGTGAACAGAGG - Intronic
925423322 2:3729016-3729038 AGGGACATCAGAGAGAACACTGG - Intronic
925507422 2:4584076-4584098 AGGGTCCTGAAAATGAACATGGG - Intergenic
926978041 2:18534529-18534551 AGAGACTAGAAAGTGACCACTGG - Intergenic
927104146 2:19809736-19809758 GGGGATCTGAAAGTGAGCGCTGG - Intergenic
927333309 2:21891424-21891446 AGGGAAGTGAAAGTGAGCCCGGG - Intergenic
929321050 2:40543896-40543918 AGAGACTTGAATGTGAACCCTGG + Intronic
931116056 2:59168034-59168056 AGGGAGCTATAAGTGAACATAGG + Intergenic
932439975 2:71728407-71728429 AAGGACTTGAATGTGAACAAGGG + Intergenic
933471858 2:82735915-82735937 AAGGATCTGAGAGTGAACAAAGG + Intergenic
935921524 2:108020919-108020941 AGTGACCCACAAGTGAACACAGG + Intergenic
936464132 2:112732287-112732309 TGGGACCTGAAAGTCAAACCAGG - Intronic
938065868 2:128281738-128281760 AGGGACCTGAATGAGATGACAGG + Intronic
938237732 2:129720452-129720474 GGGGAACTGAAAGTGAACGCTGG + Intergenic
938960076 2:136332974-136332996 AGAGACCTGAAAGGCAACAGAGG + Intergenic
939298224 2:140297558-140297580 AGGGAGCTGAGGGTGTACACAGG + Intronic
941738854 2:169011569-169011591 AGGTACCTGACAGAAAACACAGG - Intronic
943945585 2:194058386-194058408 AGGGATCAGAAAGAGAACAGTGG + Intergenic
946604329 2:221386355-221386377 AGTAGCCTAAAAGTGAACACAGG + Intergenic
947142614 2:227033476-227033498 AGGGACCTGAAAAACACCACAGG + Exonic
947424652 2:229972525-229972547 AGTGACCAGCAAGTGAACAGAGG + Intronic
1169624486 20:7548952-7548974 TGTGACCTGTAAATGAACACTGG - Intergenic
1172530886 20:35630693-35630715 AGGACCCTGAAACTGAAAACAGG + Intronic
1174764035 20:53235019-53235041 AGGGGACTGAAAGTGAACAATGG - Intronic
1175370172 20:58483024-58483046 AGGGAACTGAAAGAGAAGAGGGG + Intronic
1175448152 20:59040753-59040775 AGGCACCTGAAAATGAAAAGCGG + Intronic
1176241874 20:64079220-64079242 AGGCACCTGGAGGAGAACACAGG - Intronic
1177404485 21:20646874-20646896 AGGGAGTTAAAAGTGAACAGAGG - Intergenic
1177817078 21:25988851-25988873 AGGGAACTGAATATGAAAACGGG + Intronic
1178230280 21:30775855-30775877 AGGGACCAGAAAATAAACACAGG + Intergenic
1179980028 21:44891014-44891036 AGGGACCTGAAGGTGAGGAAGGG + Intronic
1180934873 22:19618811-19618833 TGGTACCTGAAAGTGACCTCTGG + Intergenic
1181743048 22:24936630-24936652 AGGGAACTGAAAGTAGACAAGGG - Intronic
1183272009 22:36868175-36868197 AGAGACCTGATAGTGACCTCAGG + Intronic
1184605788 22:45574120-45574142 AGGGACAGCAAAGTGAACAAGGG - Intronic
950304161 3:11905519-11905541 AGGGACCTGTGGGTGAACAGTGG + Intergenic
950474579 3:13207389-13207411 AGGGACCTGGCAGAGAAGACGGG - Intergenic
950556258 3:13697773-13697795 AGGGACCTGGAGGGGCACACAGG + Intergenic
952647016 3:35672378-35672400 AGGTACCTGAAAGTAAAACCAGG - Intronic
953177915 3:40568549-40568571 ATGGACCTGAATGTGAGCCCTGG - Intronic
954105234 3:48406211-48406233 AGGGGCCTGAGAGTGACCTCAGG - Intronic
954997696 3:54896637-54896659 GGGGTTCTAAAAGTGAACACTGG + Intronic
955107047 3:55908464-55908486 AGGGGACTGAGAGTGAACAGAGG + Intronic
955928335 3:64030203-64030225 AGGAACAAGAAAGTGAACATTGG + Intergenic
956263653 3:67373623-67373645 ACTGACCTGAAACTGATCACTGG + Intronic
957410675 3:79835697-79835719 AAGGAGGTGAAAGTGAGCACTGG - Intergenic
959084128 3:101833576-101833598 TGGAAACTGAAAGTGATCACTGG + Intronic
959102435 3:102026737-102026759 AATGACCTGAAAGTAAACCCTGG + Intergenic
959150673 3:102603544-102603566 AGGGACCAGCAAGTGATCAAGGG - Intergenic
960292341 3:115900778-115900800 AGGTACCTGAAAGCGAATAATGG - Intronic
961341706 3:126227537-126227559 AGGTGCCTGGAAGTCAACACTGG + Intergenic
962826679 3:139105538-139105560 AGTGACCTGTCAGAGAACACAGG - Intronic
963554075 3:146763963-146763985 AGAGACCTGAATTTGAACTCTGG - Intergenic
965770632 3:172178119-172178141 AAGGAGCAGAAATTGAACACTGG + Intronic
966370451 3:179246053-179246075 AGGAACCGGTAAGTAAACACAGG - Intronic
967800508 3:193653244-193653266 AGTGACCTGAAAGTTAGCAGTGG + Intronic
968682196 4:1928987-1929009 AGGGACCCCACAGGGAACACTGG + Intronic
968974208 4:3812578-3812600 AGGGACCTCAGACTGCACACAGG - Intergenic
970886132 4:20989389-20989411 AGGGACTTGGAAGTGGACACAGG + Intronic
971177022 4:24292061-24292083 ACAGACCTAAAGGTGAACACAGG + Intergenic
971239574 4:24875895-24875917 AGGTACCTGAAACTGAGGACAGG - Intronic
971308505 4:25504571-25504593 AGGGACCTGGAAGTGAACCGGGG + Intergenic
971462731 4:26919487-26919509 AGGGATCTGAAAGAGAACAAAGG - Exonic
971570821 4:28208653-28208675 AGGGACTTGCAAGTTAATACTGG - Intergenic
972812163 4:42602241-42602263 AGGCACCTTAAATTGATCACTGG + Intronic
974994503 4:69137876-69137898 AGGGACAGTAAATTGAACACTGG + Intronic
975017679 4:69444004-69444026 AGGGACAATAAATTGAACACTGG + Intergenic
975212121 4:71712978-71713000 AGGGGCATCTAAGTGAACACAGG + Intergenic
976246521 4:83010930-83010952 AGGGCCGTGCAAGTGCACACGGG + Intronic
977286101 4:95108954-95108976 AGGAAACTGAAACAGAACACTGG - Intronic
986119852 5:4824385-4824407 AGGGAGGGGAAAGTGAAGACTGG - Intergenic
986334669 5:6745018-6745040 AGGGATGTGGCAGTGAACACAGG - Intronic
991016293 5:61936187-61936209 AGGGGCCTTAAAGTGAAAATCGG + Intergenic
995647432 5:114328804-114328826 AAGGATCTGAAAGTGACCCCTGG - Intergenic
997855383 5:137368364-137368386 AGGGTCCTGAGAGGGAACAATGG + Intronic
998216529 5:140241843-140241865 AGGGATCAGAAAGAGAACAGAGG - Intronic
998633202 5:143924023-143924045 AAGAAACTGAAAGAGAACACAGG - Intergenic
999193068 5:149763093-149763115 AGGGACCTGAAGGTGCTCAAGGG - Intronic
1000374719 5:160568649-160568671 AGGGACCAGAATGTGTTCACAGG - Intronic
1002272460 5:178081720-178081742 AGGGAGCTGAAAGGGAGCAGAGG - Intergenic
1003732005 6:8835539-8835561 AGGGAACCGAAAATGAACAAGGG + Intergenic
1003925706 6:10875863-10875885 AGGGAGCTGATAGTGCACAGTGG - Intronic
1004026266 6:11822417-11822439 AGGAAGCTAAAAATGAACACTGG + Intergenic
1005882181 6:30070212-30070234 AAGGACCGGAAAATGAAAACCGG - Exonic
1007599057 6:43070675-43070697 CAGGACCTGAAAGGGAACAAAGG - Exonic
1010390145 6:75327467-75327489 AGAAACGGGAAAGTGAACACAGG + Intronic
1011101164 6:83724156-83724178 AGGGGAGTGAAAGTGAAAACAGG - Intergenic
1012427769 6:99132650-99132672 ATGGACCTGAAAATAAACTCAGG + Intergenic
1015813329 6:137183006-137183028 AAGGAAATGAAAGTGAAGACAGG - Intergenic
1017883141 6:158575720-158575742 AGGGACCTCATTGTGGACACAGG + Intronic
1018662838 6:166104381-166104403 AGGGAGATGTAAGTGACCACTGG - Intergenic
1020582998 7:10029398-10029420 GGGGACCTAGAATTGAACACTGG + Intergenic
1022212067 7:28220919-28220941 AGTGAAATGACAGTGAACACTGG + Intergenic
1022530628 7:31064814-31064836 AGGGGCCTGTAGGAGAACACAGG - Exonic
1022840462 7:34159197-34159219 AGGAACCTTAGAGGGAACACAGG + Intergenic
1028536300 7:91891586-91891608 AGGAACCAGAAATTGAACCCAGG + Intergenic
1030745308 7:113158958-113158980 AAGGAACTGAAAGTGAACCCTGG - Intergenic
1035769304 8:2134169-2134191 TGGGACCTGAGATTCAACACAGG - Intronic
1036749362 8:11434313-11434335 AGGGGCCTGAAAGAGAACCCAGG - Intronic
1037373714 8:18206305-18206327 AAGGCACTGAAAGTGAACAGAGG - Intronic
1043619546 8:82172198-82172220 AGGGATCTAAAAGTGACCAGTGG - Intergenic
1050144329 9:2549954-2549976 AGGTACATGAAAATGAAGACAGG - Intergenic
1050270053 9:3934033-3934055 AGGGATCTAAAAGTGAACAATGG + Intronic
1050939275 9:11439334-11439356 GGGGACCTGAATGTTAACAGTGG + Intergenic
1051342975 9:16128515-16128537 AGAGACATGCAAGAGAACACTGG - Intergenic
1051536649 9:18166210-18166232 AGGGACCTGAGAATCAACAGAGG - Intergenic
1052083727 9:24238558-24238580 AGGGGCCTAAAAGTGAGCATAGG - Intergenic
1054788271 9:69230602-69230624 AGTGTCCTGAAATTGAACAAAGG + Intronic
1055780144 9:79812005-79812027 AGCCACCTGAAAGTTAAGACCGG + Intergenic
1055892904 9:81142175-81142197 AGGGAGCTGCTAATGAACACAGG + Intergenic
1056111402 9:83398903-83398925 AGTTGCCTGAAAGTGAGCACTGG + Intronic
1057582961 9:96303702-96303724 AGTGAGCTGAGAGTGAGCACAGG - Intergenic
1057832397 9:98417350-98417372 AGAGGCCTGAAGGTGATCACAGG + Intronic
1060114877 9:120932042-120932064 AGGAACAAGAAAATGAACACAGG + Intergenic
1062199114 9:135291755-135291777 GGGGCCCTGGTAGTGAACACAGG + Intergenic
1187573318 X:20528239-20528261 GAGGACCTGAAAGTAAACAAGGG - Intergenic
1188486445 X:30687355-30687377 AGGGAGCAGAAAGGGAACAAAGG - Intronic
1189390411 X:40571535-40571557 ATGGCCATGAAAGTGAACTCTGG - Intergenic
1190093750 X:47462513-47462535 AGGGACAACAAAGGGAACACAGG - Intronic
1192434035 X:71131648-71131670 ATGGAGCTGAACGTGAGCACAGG - Intronic