ID: 1070790433

View in Genome Browser
Species Human (GRCh38)
Location 10:79186067-79186089
Sequence TGTTTTTGAGGGCACTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070790427_1070790433 3 Left 1070790427 10:79186041-79186063 CCAGTGTTCACTTTCAGGTCCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070790433 10:79186067-79186089 TGTTTTTGAGGGCACTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070790433 Original CRISPR TGTTTTTGAGGGCACTGTAG AGG Intronic
No off target data available for this crispr