ID: 1070791816

View in Genome Browser
Species Human (GRCh38)
Location 10:79194105-79194127
Sequence CCACTGGCACCGCTTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070791810_1070791816 16 Left 1070791810 10:79194066-79194088 CCTCTGCTCGCGGGCTGTAGGCA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1070791816 10:79194105-79194127 CCACTGGCACCGCTTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070791816 Original CRISPR CCACTGGCACCGCTTGCCCC AGG Intronic
No off target data available for this crispr