ID: 1070792108

View in Genome Browser
Species Human (GRCh38)
Location 10:79195672-79195694
Sequence AGCCCAGTGATGTAAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070792098_1070792108 18 Left 1070792098 10:79195631-79195653 CCAGGTGCGTGTCACCTCCCAAA 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1070792108 10:79195672-79195694 AGCCCAGTGATGTAAGTGACTGG No data
1070792102_1070792108 4 Left 1070792102 10:79195645-79195667 CCTCCCAAAGGTGGCCGGTGTGC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1070792108 10:79195672-79195694 AGCCCAGTGATGTAAGTGACTGG No data
1070792107_1070792108 -10 Left 1070792107 10:79195659-79195681 CCGGTGTGCAGGGAGCCCAGTGA 0: 1
1: 0
2: 1
3: 24
4: 277
Right 1070792108 10:79195672-79195694 AGCCCAGTGATGTAAGTGACTGG No data
1070792097_1070792108 21 Left 1070792097 10:79195628-79195650 CCACCAGGTGCGTGTCACCTCCC 0: 1
1: 0
2: 2
3: 18
4: 243
Right 1070792108 10:79195672-79195694 AGCCCAGTGATGTAAGTGACTGG No data
1070792103_1070792108 1 Left 1070792103 10:79195648-79195670 CCCAAAGGTGGCCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1070792108 10:79195672-79195694 AGCCCAGTGATGTAAGTGACTGG No data
1070792105_1070792108 0 Left 1070792105 10:79195649-79195671 CCAAAGGTGGCCGGTGTGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1070792108 10:79195672-79195694 AGCCCAGTGATGTAAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070792108 Original CRISPR AGCCCAGTGATGTAAGTGAC TGG Intronic
No off target data available for this crispr