ID: 1070792804

View in Genome Browser
Species Human (GRCh38)
Location 10:79199704-79199726
Sequence TCTCCTAGAAAGGGCACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070792798_1070792804 3 Left 1070792798 10:79199678-79199700 CCAGAAGGGGGACTGATGGCACT No data
Right 1070792804 10:79199704-79199726 TCTCCTAGAAAGGGCACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070792804 Original CRISPR TCTCCTAGAAAGGGCACCAG GGG Intronic