ID: 1070793663

View in Genome Browser
Species Human (GRCh38)
Location 10:79204455-79204477
Sequence AGAAGGGCCCCTGGGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070793663_1070793674 17 Left 1070793663 10:79204455-79204477 CCCTGAACCCCAGGGGCCCTTCT 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1070793674 10:79204495-79204517 CCCTGAGCTTGAACACTTCCTGG No data
1070793663_1070793676 18 Left 1070793663 10:79204455-79204477 CCCTGAACCCCAGGGGCCCTTCT 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1070793676 10:79204496-79204518 CCTGAGCTTGAACACTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070793663 Original CRISPR AGAAGGGCCCCTGGGGTTCA GGG (reversed) Intronic
900422350 1:2561041-2561063 GGGAGGGCCCCTGGGCTTCAGGG + Intronic
900595337 1:3477788-3477810 AGCAGGTCCCCAGGGGGTCAAGG - Intronic
900622569 1:3594026-3594048 AGAAGAGCCCCTGCGGCTCCAGG + Intronic
901143785 1:7052093-7052115 AGAAGTGGCCCTGGGGACCAAGG - Intronic
901458639 1:9378186-9378208 AGAAGGGCCCCCAGCGTCCAGGG - Intergenic
902721763 1:18308847-18308869 AGAAGAGACCCTGGATTTCAAGG + Intronic
902875031 1:19335864-19335886 ATGGGAGCCCCTGGGGTTCATGG - Intergenic
903236970 1:21956529-21956551 GGAAGGGCCCCTAGTGTTCTTGG - Intergenic
905441061 1:37996897-37996919 ATAAGGGGCCCTAGGGTACAGGG - Exonic
905865396 1:41373759-41373781 AGAAGGGCAGCTGGGGACCATGG - Intronic
906130084 1:43450720-43450742 AGAAGGGCCCAAGGGGTCCTCGG - Exonic
906191102 1:43900005-43900027 GGAAGGGCCCCTGGGGCTGCTGG - Intronic
907707410 1:56844850-56844872 GGTAGGGCACCTGGGTTTCAAGG - Intergenic
913536667 1:119779545-119779567 CGAAGGCCTCCTGGGGGTCAGGG - Intergenic
914244084 1:145872991-145873013 AAAAGGGTTCCTGGGGCTCAAGG - Exonic
916726101 1:167525690-167525712 AGAAGGGCCCCTGCCATTGAGGG + Intergenic
919839025 1:201595812-201595834 AGAAGGGCACCTTGGTTGCAGGG - Intergenic
919914298 1:202130322-202130344 GGAAGGGCCCCGGGGGCCCAGGG + Exonic
919918881 1:202156578-202156600 AGAAGGTACCCTGGGGACCAGGG + Intronic
921045048 1:211470236-211470258 TGAAGGCCCCCTGGTGGTCACGG - Intergenic
922243323 1:223771249-223771271 AGAAGGGCCCCTTGCCTTTAAGG + Intronic
922461470 1:225817186-225817208 CCAGGGGTCCCTGGGGTTCAGGG + Intronic
922729551 1:227942559-227942581 AGGAGGGGCCCTGGGGGCCAGGG - Intronic
1062820909 10:534040-534062 AGAAGGGGGCGTGGGCTTCATGG - Intronic
1062823067 10:549220-549242 AAAAAGGCCCCTGGGGATGAGGG - Intronic
1063623660 10:7669854-7669876 GGGAAGGCCCCCGGGGTTCACGG + Intergenic
1064132736 10:12724355-12724377 AGAAGGGACTCTGGGGGCCAGGG + Intronic
1064559071 10:16577936-16577958 AGAGGGGGCCCAGGGGTTGATGG + Intergenic
1067390674 10:45860205-45860227 AGAAGGGTCCATGGGATGCAAGG + Intergenic
1067437319 10:46287271-46287293 AGTAGGGCCCCAGGGACTCATGG - Exonic
1067500797 10:46803629-46803651 AGAAGGGCCCATGGGATGCAAGG - Intergenic
1067593783 10:47536290-47536312 AGAAGGGCCCATGGGATGCAAGG + Intronic
1067640893 10:48044399-48044421 AGAAGGGCCCATGGGATGCAAGG + Intergenic
1070793663 10:79204455-79204477 AGAAGGGCCCCTGGGGTTCAGGG - Intronic
1073177775 10:101566792-101566814 AGAAGGGCCGCGTGGTTTCACGG - Intergenic
1073423673 10:103443388-103443410 AGAAGAGCCCCTGGGGTGCTGGG + Intronic
1075521790 10:123147841-123147863 AGAAGGGTCCAAGGGGTCCAAGG + Intergenic
1075723590 10:124600688-124600710 AGGCAGGCCCCTGGGGCTCAGGG - Intronic
1077293990 11:1815476-1815498 AGAAGGGCCCCATGGGAGCAGGG + Intergenic
1081557466 11:44178735-44178757 AGAAGGCCTCCTGGGGGGCAGGG - Intronic
1081643102 11:44771012-44771034 AGATATGCACCTGGGGTTCAGGG + Intronic
1081741593 11:45444800-45444822 AGAAGGACCCCTGAGGATCTGGG - Intergenic
1083261747 11:61526897-61526919 GGAAAGGTCCCTGGGGTACACGG + Intronic
1083333774 11:61911425-61911447 AGAAGGGACCCTGGGCTCCTCGG + Intronic
1083682606 11:64358376-64358398 AGCAGGGGCCCTGGGCCTCATGG + Intergenic
1083690808 11:64407403-64407425 AGAAGGGCCCATGGGCTTCAGGG + Intergenic
1083886879 11:65577285-65577307 GGAAGGGACCATGGGGTCCAGGG + Intronic
1083923692 11:65793606-65793628 AGAAGGGTCCCTGGTGGTCTGGG - Intronic
1084464030 11:69311932-69311954 AGCAGGGTCCCTGGGGTCCCAGG - Intronic
1085104720 11:73832232-73832254 AGAATGGCCCCTAGGAATCAAGG + Intronic
1085475980 11:76789126-76789148 GGAAGGCCCCTTGGGGATCATGG - Intronic
1088787137 11:113192465-113192487 AAAAGTGCCCCTGGGGTTGGTGG + Intronic
1089268906 11:117287863-117287885 AGGAGGGCCTCTGGTGTTCCTGG - Exonic
1089937389 11:122378090-122378112 CGAAGGGCCCCTGTGGTGCCAGG - Intergenic
1091122754 11:133070357-133070379 AGAAGGGCCAAGGGGGTTCCGGG - Intronic
1091970394 12:4781826-4781848 AGCAGGACCCCTGGGAATCAAGG + Intronic
1093528667 12:20135517-20135539 AGACCAGCCCCTGGGCTTCATGG + Intergenic
1095744922 12:45647256-45647278 AGCAGGGCTTCTGGGGGTCATGG + Intergenic
1095931987 12:47636723-47636745 AGGAGGGTCCCTGTGGTTCCAGG - Intergenic
1101407290 12:104439738-104439760 GGAATGGCCCCTGGATTTCAGGG + Intergenic
1101561436 12:105861460-105861482 AGAAGAGCCCTTGAGGTTTATGG + Intergenic
1102653461 12:114460532-114460554 AGACGTGCTCCTGAGGTTCATGG + Intergenic
1103296126 12:119888686-119888708 AGAAAGGCTCCTGGAGTACAGGG + Intergenic
1104095506 12:125553483-125553505 AGCAGGTCCGCTGGGGCTCAGGG + Intronic
1104903228 12:132200194-132200216 AAAAGGGTCCCTGGGGTGGATGG - Intronic
1105016107 12:132787586-132787608 GGAAGGGTCCCAGGGGTTCTGGG - Intronic
1105068722 12:133220921-133220943 AGAAAGGCTGCTGGGGTCCAGGG + Intronic
1105418065 13:20230510-20230532 AGCAGGCCCTCTGGGGTTCCAGG + Intronic
1106418476 13:29565890-29565912 AGAAGGGATCCTGCGGTTCTGGG + Intronic
1108262737 13:48675101-48675123 TTAAGGACCCATGGGGTTCAGGG + Intronic
1108464420 13:50700526-50700548 AGAGGGGCCTCTGGGGCCCAGGG - Intronic
1110139725 13:72113756-72113778 AGAGTGGCCCATGGGCTTCAAGG + Intergenic
1113882511 13:113635544-113635566 AGAAGGGCCCATGTGCTGCAGGG - Intronic
1117593379 14:57300160-57300182 AGAAGGTCTCCTGGGGCCCAGGG + Intergenic
1118315200 14:64721791-64721813 AGGAGAGCCCCTAGGGTGCAGGG + Intronic
1118721329 14:68596307-68596329 AGAAGGGTTCCAGGGGTTCATGG + Intronic
1121950999 14:98171180-98171202 ACAAGGGACCCTGTGGCTCATGG - Intergenic
1122089138 14:99326563-99326585 AGCAGGTCTGCTGGGGTTCAAGG - Intergenic
1122558280 14:102592903-102592925 AGAAGGGCCCCGAGGTCTCAGGG + Exonic
1125587074 15:40828558-40828580 AGAAGGTCCACTGGGCTTCTGGG - Exonic
1128985815 15:72220439-72220461 AGAAGGCCCGCTGAGGTCCAAGG + Intronic
1129277102 15:74453119-74453141 AATAGCACCCCTGGGGTTCAGGG + Intronic
1129413346 15:75361578-75361600 AGCAGGCCCCCGGGGGGTCAGGG - Intronic
1130649803 15:85756083-85756105 AGCAAGGCCCCTCAGGTTCAGGG + Intergenic
1130986101 15:88845686-88845708 TGAAGGGCTCCTCGGGTTCCAGG - Exonic
1132702671 16:1228784-1228806 CGGAGGGCCCCTGGTGTGCAAGG - Exonic
1132705655 16:1242084-1242106 CGGAGGGCCCCTGGTGTGCAAGG + Exonic
1132939683 16:2500582-2500604 AGAAGAGGCCCTGGGTGTCAGGG + Intronic
1133879429 16:9766485-9766507 TGAAGGCCCCCTGAGGCTCAGGG + Intronic
1134672834 16:16068331-16068353 AGAGGGGGCCTTGGGGTTCTAGG + Intronic
1135306421 16:21371145-21371167 CGAAGGGACCCTGTGGTCCAGGG + Intergenic
1136136171 16:28258300-28258322 AGAAGGGGCTCAGGGCTTCAGGG - Intergenic
1136303164 16:29350289-29350311 CGAAGGGACCCTGTGGTCCAGGG + Intergenic
1136660907 16:31761016-31761038 TCAAGGGCCCATGGAGTTCATGG + Exonic
1137323032 16:47405574-47405596 AGAAAGGCCCTTGGGCTCCATGG + Intronic
1137443000 16:48511917-48511939 AGAAGGGAGCCTGGGGTGGAGGG + Intergenic
1138344485 16:56311689-56311711 AGCCTGGCCCCTGGGGTACAGGG - Intronic
1140218884 16:73029204-73029226 AGAAGGGGCCTTGGGGTCCCAGG - Intronic
1142342886 16:89535677-89535699 AGGTGGGTCCTTGGGGTTCAGGG + Intronic
1144628762 17:16858920-16858942 AGCAGGGCCCTTGGGGATCTTGG - Intergenic
1144956107 17:19019700-19019722 AGAAGGCCCCCTGGGGAGGAGGG - Exonic
1148212460 17:45816804-45816826 ACTAAGGCCCCTGGGGCTCAGGG + Intronic
1148456484 17:47814080-47814102 GGAGGGGCTCCTGGGGTGCAGGG - Intronic
1148875032 17:50682013-50682035 AGAACGGGCCGTGGGGTTGAGGG - Intronic
1149321921 17:55490249-55490271 AGAAGGGCACTTGGGGTCCTGGG + Intergenic
1149915236 17:60602150-60602172 AGAGGGGCCCCTGGGATGGATGG - Intronic
1150158990 17:62878193-62878215 AGGAGGAGCCCTAGGGTTCAAGG - Intergenic
1150837357 17:68576510-68576532 AGAAGGGAGCCTTGGGCTCAGGG - Intronic
1151206927 17:72514783-72514805 AGAAGGGCCCCTTGGAATGAAGG + Intergenic
1152942439 17:83179905-83179927 TGAAGGCCACCTGGGGTTCACGG + Intergenic
1155526532 18:26721532-26721554 AGAAAGGACCCTGGGGAGCAGGG - Intergenic
1156472713 18:37387685-37387707 AGAAGGGCTGCTAGGGTACAAGG - Intronic
1158179010 18:54691420-54691442 AGAAGGCCACCTGGGGTTGCTGG - Intergenic
1160254872 18:77239734-77239756 TGAAGGGCCCCTGAGTCTCAAGG + Intergenic
1160774953 19:851090-851112 AGAATGAGCCCTGAGGTTCAGGG + Intronic
1161983495 19:7642396-7642418 AGGAGGGAGCCTGGGGGTCAGGG - Intronic
1162495688 19:11022136-11022158 ACAAGGGCCCCAGGGGAGCAGGG + Intronic
1164590891 19:29506215-29506237 AGAAGGGCCCCGGGGGTCCTGGG - Intergenic
1164656553 19:29926029-29926051 TGGAGGGCTCCTGGGGTTCTAGG + Intronic
1165767324 19:38359623-38359645 AGAGGGGCCCCTGGGGTTTGGGG - Intronic
1165956130 19:39503184-39503206 AGAGGGGTGCCTGGGGTACATGG - Intronic
1167574189 19:50309841-50309863 ACAGGGGCCCGTGGGGTCCAGGG - Exonic
1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG + Exonic
1168193416 19:54756250-54756272 AGAGGGGACCCTGGGGTGCTCGG + Intronic
1168195482 19:54770985-54771007 AGAAGGGACCCTGGGGTGCTGGG + Intronic
1168203861 19:54835215-54835237 AGAGGGGACCCTGGGGTGCTCGG + Intronic
925014081 2:508555-508577 AAAAGGGCCCAATGGGTTCATGG + Intergenic
925804369 2:7633735-7633757 AGAAGGGCTACGGGAGTTCAAGG + Intergenic
925922093 2:8645067-8645089 AGGGGGCCCCCTGGTGTTCACGG - Intergenic
926113507 2:10196975-10196997 AGAAGGGGCTCTGGGGTCCAGGG + Intronic
927075389 2:19571938-19571960 AAAGGCGTCCCTGGGGTTCAGGG - Intergenic
927841668 2:26448949-26448971 AGGATGGCCCCTGGACTTCAGGG + Intronic
928989277 2:37215079-37215101 AGAAGGGACTCTGGAGTGCAAGG + Intronic
929870229 2:45752960-45752982 AGGAGGGTCCTTGGGGTTTATGG + Intronic
929902878 2:46021060-46021082 AGAAGGGCCACTGTGGAACAGGG + Intronic
931989839 2:67779106-67779128 AGAAGGGCCCTTGGGCCTTAAGG + Intergenic
932446896 2:71786941-71786963 GGAATGGCCCCTGGGGTCGAGGG - Intergenic
932494009 2:72137725-72137747 AGAAGGGCCCCGGGGGACCTGGG + Intronic
932897118 2:75650986-75651008 AGAAGGGCCTCTGCTGTTCTGGG + Intronic
933715096 2:85354308-85354330 AGGAGGGACCCTGGGGTCCGGGG - Intronic
933858465 2:86441544-86441566 AGACGGGCGCCCGGGGTTCGGGG + Intronic
937203715 2:120222956-120222978 GAACAGGCCCCTGGGGTTCATGG + Exonic
938181614 2:129189775-129189797 TGAAGGGCTCCGGGGGCTCAAGG + Intergenic
939993898 2:148902202-148902224 AGAAGTGCCCCTCGTGTTCCTGG + Intronic
940897468 2:159094685-159094707 AGACTGGCCCCTGTGGTTCTGGG + Intronic
946176865 2:217927648-217927670 ATGAGGGCCCCTAGGCTTCAGGG - Intronic
946409102 2:219507649-219507671 AGAGGGGCACATGGGGGTCATGG - Intergenic
948028924 2:234800684-234800706 GGAAGGGCTCCCGGGGGTCATGG - Intergenic
948885603 2:240881684-240881706 AGAAGGGCCGCTGGGGGCCGGGG - Intergenic
948982659 2:241502370-241502392 TGAATGGCCCCTGGGGGTGAGGG + Intronic
1169079306 20:2785971-2785993 AGGAGGGGCCCAGGAGTTCAAGG + Intergenic
1170032811 20:11959981-11960003 AAAAGGGACCCTGGGGGTCTGGG + Intergenic
1171460754 20:25296644-25296666 AGGAGGGGCCATGGGGGTCAGGG + Exonic
1172446650 20:34996872-34996894 AGATGGGGCACTGGGGTGCAGGG + Intronic
1173183724 20:40823136-40823158 CGGTGGGCCCCTGGGGTTCATGG - Intergenic
1175097548 20:56553399-56553421 GGAGGGGCTCCTGGGCTTCATGG + Intergenic
1175833442 20:61979357-61979379 AGAAGGGCCTGTGGGGACCAGGG + Intronic
1176708867 21:10133695-10133717 AGAAGGGTCCTTGGGCTCCAGGG + Intergenic
1178137408 21:29642790-29642812 AGAAGGGCCCCTGGGCTGTGAGG + Intronic
1178507204 21:33171713-33171735 CTGAGGGCCCCTGGGGTGCAGGG + Intergenic
1178703302 21:34852355-34852377 GAAAGGGCCCCTGGGGTGAATGG - Intronic
1179898871 21:44378619-44378641 AGGAGGGCACCTGGGCTCCAGGG - Intronic
1180074460 21:45455665-45455687 GCAGGGGCCCCTGGGGCTCAGGG - Exonic
1180784388 22:18538784-18538806 AGAAGAGCTACTGGGGTGCAAGG - Intergenic
1180800014 22:18627329-18627351 AGGAGGGCCCCTGTGGTGCTGGG + Intergenic
1181039296 22:20184360-20184382 ACAGGGGCCTGTGGGGTTCATGG - Intergenic
1181127962 22:20712837-20712859 AGAAGAGCTGCTGGGGTGCAAGG - Intronic
1181221701 22:21367937-21367959 AGGAGGGCCCCTGTGGTGCTGGG - Intergenic
1181241291 22:21478141-21478163 AGAAGAGCTACTGGGGTGCAAGG - Intergenic
1181637067 22:24179541-24179563 AGGAGGGCCCCTGCGGTGCTGGG - Intergenic
1181680682 22:24494420-24494442 AAAAGGGGCCCTAGGGTGCAGGG + Intronic
1182777303 22:32840398-32840420 AGAAGGGCCCTGGGGGACCAGGG + Intronic
1183109320 22:35637512-35637534 AGAGGGGCTTCTGGGCTTCAGGG - Intronic
1184307817 22:43618853-43618875 AAAAGGGGCCCTGTGATTCAAGG + Intronic
1184587986 22:45460620-45460642 AGAAGGGTCCATGGGGACCATGG - Intergenic
1184649349 22:45912572-45912594 AGAGGGGCCTGTGGGGTCCAGGG + Intergenic
1184669817 22:46006769-46006791 AGAGGGCCCCCTGGACTTCAGGG - Intergenic
1184984169 22:48118106-48118128 GGAAGGGCCTCTGGGGTGCAGGG + Intergenic
1185085168 22:48737046-48737068 AGCAGAGCCCCTGGGGACCAGGG - Intronic
949931417 3:9081339-9081361 AGAAAGGCCTCTGGGGCACAAGG + Intronic
950031961 3:9859579-9859601 AGGAAGGCCCCTGAGGTGCAAGG + Intergenic
950096860 3:10335649-10335671 AGAAGGGTCACTGTGGGTCAAGG - Intronic
950449140 3:13055833-13055855 CGGAGGGGCCCTGGGGTGCAGGG + Intronic
950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG + Intronic
952738495 3:36713522-36713544 AGAAGGGGCCCTGTGGAGCAGGG - Exonic
954277421 3:49551848-49551870 AGCAGGCCCTCTGGGGCTCATGG - Intergenic
954363722 3:50135520-50135542 AGCAGGGTCCCTGGGGCTCCAGG + Intergenic
954700885 3:52450399-52450421 AGATGAGCCTCTGAGGTTCACGG + Intergenic
955535349 3:59917542-59917564 TGAAGGGCCCATTGAGTTCAGGG + Intronic
956202506 3:66721008-66721030 AGAAGGGGTCCTGGGGTTAGAGG - Intergenic
960517307 3:118616541-118616563 AAAACAGCCCCAGGGGTTCAGGG + Intergenic
961114650 3:124318320-124318342 AGAGGGCACCCTGTGGTTCATGG + Intronic
961391898 3:126557374-126557396 AGAGGAGCCCCTGGGGAACACGG + Intronic
962743788 3:138382564-138382586 GGAAGGGCCCCTCGGGTGCAGGG - Intronic
962947234 3:140183052-140183074 AGCAGGGACCATGGGTTTCATGG + Intronic
964060147 3:152512299-152512321 AGAAAGCTCCATGGGGTTCAGGG - Intergenic
966310368 3:178587354-178587376 AGAAGGACCCCTAGAGTCCAAGG + Intronic
966544131 3:181125622-181125644 ATAAGGGCACATGGGGTTTAGGG + Intergenic
966891264 3:184409283-184409305 AGTGGGGCCCCTGGAGATCACGG + Intronic
967963991 3:194946232-194946254 AGAAGGGGCTCTGGGGGCCATGG - Intergenic
968597909 4:1494866-1494888 AGAAAGGCTCCTGGTGCTCAGGG - Intergenic
969100965 4:4767982-4768004 AGCTGGGCCCAGGGGGTTCAAGG + Intergenic
974003547 4:56534049-56534071 GGACGGGCACATGGGGTTCAAGG - Intronic
974856160 4:67464108-67464130 AGATGTGCCACTGTGGTTCATGG + Intergenic
976362558 4:84196857-84196879 AGAAGGGCTCCTTGCCTTCATGG - Intergenic
981258507 4:142691741-142691763 AGAAGGGACCCTGCAGTCCAAGG - Intronic
981516776 4:145618963-145618985 AGAAGGGCCTCCGGGGGTCCCGG + Exonic
985548737 5:522870-522892 AGAAGGGCCCCTGGGGCATCAGG - Intronic
986796786 5:11220384-11220406 AGAAGATCCCCTGGGATTTAAGG + Intronic
987053191 5:14165762-14165784 AGGAGGGCACCTGGGATCCAGGG - Intronic
989742307 5:44788102-44788124 ACAATGGCGGCTGGGGTTCAGGG - Intergenic
990056363 5:51584759-51584781 AGAAGGGCCCCACGGGAGCAGGG + Intergenic
990909402 5:60838607-60838629 AGCAGGGCTGCTGGTGTTCATGG + Intronic
992002795 5:72451953-72451975 AGCATGGCCACTGGGGTTCATGG - Intronic
992400341 5:76404927-76404949 AGCAGAGCCCGTTGGGTTCAAGG + Intronic
992674091 5:79088262-79088284 AGAAAGGCCCCTGGCATTAATGG + Intronic
994196061 5:96924264-96924286 TGGAGGGCCCCTGGTGTGCAGGG - Intronic
994252174 5:97548889-97548911 AGAAGGTTGCTTGGGGTTCAAGG + Intergenic
994913840 5:105947107-105947129 AGATTGGCACCTGGGGTGCAGGG + Intergenic
996943768 5:129042538-129042560 AGAAGGGACCATGAGGTACAAGG - Intergenic
997689014 5:135813038-135813060 AGAGGGGCCCCCGGGGTTGTTGG + Intergenic
999306141 5:150520961-150520983 AGAAGTGCCCCAGGGCGTCAGGG - Exonic
999893272 5:156001836-156001858 AGAAGGGCCACTGAGGGTGAAGG + Intronic
1002606984 5:180389392-180389414 AGAAGGGCCCATGGTGCCCAGGG - Intergenic
1004170990 6:13295520-13295542 AGGGGGGTCCCTGGGGTCCATGG + Intronic
1006034784 6:31202702-31202724 AGGAGGGGCCCTTGGGTTCTGGG - Exonic
1006234420 6:32616076-32616098 AGAAGGACCTCTGGTGTCCAGGG + Intergenic
1006307703 6:33234579-33234601 AGAAGAGCCTCAGAGGTTCAAGG + Intergenic
1007395914 6:41577793-41577815 AGAAGAGCTGTTGGGGTTCAGGG - Intronic
1008723753 6:54391530-54391552 AGGACTGCTCCTGGGGTTCATGG + Intergenic
1009870935 6:69451495-69451517 AGAAAGGCTCCTGGGCTTAAAGG - Intergenic
1012487416 6:99737635-99737657 AGAAGGGCTTCCAGGGTTCAGGG - Intergenic
1014219436 6:118785485-118785507 AGAAGGGCACATGGGGCCCATGG - Intergenic
1018181224 6:161225331-161225353 AGCAGGGGCCATGGGCTTCAGGG + Intronic
1019290103 7:246106-246128 AGAAGGGCCCATGGGGAGCTGGG + Intronic
1019309826 7:354598-354620 AGGAGGGCCTTTGGGGTTCCAGG + Intergenic
1019395416 7:815789-815811 AGAAGGGCGCCTGGGGAGGAGGG + Intergenic
1019731710 7:2632572-2632594 ACTAAGGCCCCTGGGTTTCATGG + Intronic
1021485723 7:21166335-21166357 AGAAGGGCCACTTCGTTTCAAGG - Intergenic
1023027957 7:36068885-36068907 AGATGGGCTGCTGGGGTTAAGGG - Intergenic
1023221384 7:37922757-37922779 AGAATGGCTCCTGGCTTTCAGGG + Intronic
1024711433 7:52019233-52019255 AGAAAGGACCCTGGGGTTCGGGG + Intergenic
1026526818 7:71160923-71160945 AGAAGGGCCGCTTGAGTTCAAGG - Intronic
1029664354 7:101985337-101985359 AGACAGGCCCTGGGGGTTCAGGG + Intronic
1032227297 7:130042913-130042935 AGGAGGGCCTCAGGCGTTCAAGG - Intronic
1033422914 7:141218720-141218742 ACCAGGGACCCTGGGGTTCAAGG - Intronic
1034346631 7:150389275-150389297 GGAAGGGGCCCTGGGGTCTATGG - Intronic
1034401394 7:150863972-150863994 GGAAGGGGCCCTGGGATTCTTGG - Intergenic
1035144065 7:156795348-156795370 AGATGGGCCTCTGGCCTTCAAGG - Intronic
1035454970 7:159002147-159002169 AGAAGGGACCCTCGGGTCCGTGG - Intergenic
1035699530 8:1627377-1627399 AGAAGGGTCCCTGGGCACCACGG + Intronic
1037579496 8:20236216-20236238 AGCTGGGCCCCTGGAGGTCAAGG + Intergenic
1038781143 8:30569180-30569202 ACATGGGCCCCTGGGGTTGATGG - Intronic
1039659152 8:39444645-39444667 CAAAGGCCCCCTGAGGTTCATGG + Intergenic
1040658095 8:49535677-49535699 AAAAGGACCCCTGGGGTTTGTGG - Intergenic
1041331950 8:56736270-56736292 AGAAGGCCCTATGGGGATCATGG - Intergenic
1045064546 8:98434070-98434092 AGAAGGGGCCCTGAGGTGTATGG + Intronic
1046130287 8:109959194-109959216 AGAAGAGGCCATGGGATTCATGG + Intergenic
1048080220 8:131118702-131118724 AGAGGAGGCCCTGAGGTTCATGG + Intergenic
1048286341 8:133144651-133144673 AGCTGGGGCTCTGGGGTTCAGGG - Intergenic
1048878295 8:138853768-138853790 AGAAGGGCTGCTGGAGGTCATGG - Intronic
1049171944 8:141166974-141166996 AGCAGGTGCCCTGGGGGTCAAGG - Intronic
1049411048 8:142474192-142474214 AGAAGGGCCCCAGGGCCTCTTGG - Intronic
1049659096 8:143811746-143811768 GAAAGGGACTCTGGGGTTCAGGG - Intronic
1050128769 9:2387798-2387820 AGAAGGGCACCTAGGGCTCATGG - Intergenic
1052792649 9:32890108-32890130 TGTAGGGACCTTGGGGTTCAGGG + Intergenic
1056623469 9:88234779-88234801 AGAGGGGCTCCTGGGCTCCATGG - Intergenic
1057048272 9:91902548-91902570 AGGAGGGCCCTTGGTGTTAACGG - Intronic
1058166901 9:101630011-101630033 AGAACAGCCCCGGGGGTTCAAGG - Intronic
1060743236 9:126113278-126113300 ACAGGGGCTCCTGGGGCTCATGG + Intergenic
1061291923 9:129655305-129655327 AAGAGGCCCACTGGGGTTCACGG + Intergenic
1061841510 9:133360985-133361007 AGAAGGGGCCCTGGAGTGCAGGG - Intronic
1062080062 9:134619047-134619069 AGAAGGGCACCTTGGGAACAGGG - Intergenic
1062232633 9:135490580-135490602 AGAAGACCTCCTGAGGTTCAGGG + Intergenic
1062272608 9:135716765-135716787 GGAAAGGCCCATGGGGTACAGGG + Intronic
1202793628 9_KI270719v1_random:102665-102687 AGAAGGGTCCTTGGGCTCCAGGG + Intergenic
1186749138 X:12603454-12603476 AGAAGGGCTCCAAGAGTTCAAGG + Intronic
1187003078 X:15201895-15201917 AGAAGGGTAACTGGGGTTCCTGG - Intergenic
1187392632 X:18896032-18896054 ACAGGGGCCCCTGTGCTTCATGG - Intronic
1190733985 X:53243233-53243255 TAAAGGGCACCTGGGGCTCAGGG + Intronic
1191253317 X:58269468-58269490 CGCAGGGCCTCAGGGGTTCATGG - Intergenic
1192585710 X:72316764-72316786 TGAAGAGCTCCTGGGGTTCCAGG + Intergenic
1198612025 X:138411964-138411986 TGAAGAGCCCCTGGGCTTTAAGG + Intergenic
1199654698 X:149982751-149982773 AGAAGAACCCCTGGGGCCCATGG + Intergenic
1199975608 X:152893413-152893435 AGCAGGGCCCCTGGGGGGCGGGG + Intergenic