ID: 1070795230

View in Genome Browser
Species Human (GRCh38)
Location 10:79212425-79212447
Sequence GTGGTACCTAGGTACTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795230_1070795239 24 Left 1070795230 10:79212425-79212447 CCTCCTAAGTACCTAGGTACCAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070795239 10:79212472-79212494 AAAAAATTTTTTGCACAGATGGG No data
1070795230_1070795241 29 Left 1070795230 10:79212425-79212447 CCTCCTAAGTACCTAGGTACCAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070795241 10:79212477-79212499 ATTTTTTGCACAGATGGGGCTGG No data
1070795230_1070795240 25 Left 1070795230 10:79212425-79212447 CCTCCTAAGTACCTAGGTACCAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070795240 10:79212473-79212495 AAAAATTTTTTGCACAGATGGGG No data
1070795230_1070795238 23 Left 1070795230 10:79212425-79212447 CCTCCTAAGTACCTAGGTACCAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070795238 10:79212471-79212493 TAAAAAATTTTTTGCACAGATGG No data
1070795230_1070795242 30 Left 1070795230 10:79212425-79212447 CCTCCTAAGTACCTAGGTACCAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795230 Original CRISPR GTGGTACCTAGGTACTTAGG AGG (reversed) Intronic
901312140 1:8277651-8277673 GTGGTCCCCAGCTACTTGGGAGG - Intergenic
902337516 1:15762208-15762230 GTAGTCCCCAGCTACTTAGGAGG - Intronic
903191061 1:21656295-21656317 GTGGCACCCAGCTACTCAGGAGG + Intronic
904674895 1:32192894-32192916 GTGGTGACCAGGTAGTTAGGTGG + Intronic
906433868 1:45778394-45778416 GTGGCACCTAGCTACTCGGGAGG - Intergenic
907006690 1:50921622-50921644 GTGGTGCCTAGCTACTAGGGAGG + Intronic
907208142 1:52793377-52793399 GCGGCTCCTAGCTACTTAGGAGG + Intronic
908962073 1:69710155-69710177 GTAGTCCCAAGGTACTTGGGAGG + Intronic
911601582 1:99853766-99853788 GTGGTCCCCAGCTACCTAGGAGG + Intronic
911606490 1:99911562-99911584 GTAGTCCCCAGGTACTTGGGAGG - Intronic
911609048 1:99940541-99940563 GTAGTCCCTAGGTGCTTGGGAGG + Intergenic
912350213 1:109005289-109005311 GTGGTCCCCAGCTACTTGGGAGG + Intronic
913206770 1:116546052-116546074 GTGGTCCCCAGCTACTTGGGAGG + Intronic
913244260 1:116857852-116857874 GTAGTCCCCAGGTACTTGGGAGG - Intergenic
914398127 1:147290202-147290224 GTGGTACAAAGCTACTTGGGAGG - Intronic
915462448 1:156078206-156078228 GTGGTCCCTGGGTAGTTTGGAGG - Intronic
917621985 1:176805865-176805887 GTGGTCCCCAGATACTCAGGAGG + Intronic
917998532 1:180467527-180467549 GTAGTCCCTAGCTACTCAGGAGG + Intronic
918429570 1:184444811-184444833 GAGGTACTTAAGTACTTAGGAGG + Intronic
920360154 1:205409720-205409742 GTGGTCCCAAGCTACTCAGGAGG - Intronic
924108667 1:240675418-240675440 GTAGTCCCAAGCTACTTAGGAGG + Intergenic
1068743093 10:60497181-60497203 GTGGTCCCCAGTTACTCAGGAGG + Intronic
1069468927 10:68668861-68668883 GTAGTCCTTAGGTAATTAGGAGG + Intronic
1069665000 10:70148666-70148688 GTGGTCCCAAGCTACTTGGGAGG + Exonic
1070795230 10:79212425-79212447 GTGGTACCTAGGTACTTAGGAGG - Intronic
1072479493 10:95796949-95796971 GTAGTCCCTAGCTACTCAGGAGG + Intronic
1075096787 10:119477020-119477042 GTGGTCCCAAGCTACTCAGGAGG - Intergenic
1076092985 10:127704500-127704522 CAGGTTCCTAGGTACTTAGGAGG + Intergenic
1076261508 10:129070661-129070683 TTGGTATCTAGCTACTTTGGTGG - Intergenic
1076712140 10:132343191-132343213 TGTGTTCCTAGGTACTTAGGAGG + Intronic
1077755103 11:5019877-5019899 GTGGTTCCCAGGGACTTAAGGGG - Intergenic
1080289161 11:30651733-30651755 GTGGTCCCCAGCTTCTTAGGAGG + Intergenic
1080302696 11:30801766-30801788 GTGGTACCTAGAGAGTTATGTGG - Intergenic
1080376456 11:31718521-31718543 ATGGTACCTAGGTACTCAGTTGG + Intronic
1080483879 11:32684170-32684192 ATAGTACCCAGCTACTTAGGAGG - Intronic
1081873740 11:46395104-46395126 GTAGTCCCTAAGTACTTGGGAGG - Intergenic
1082274100 11:50202733-50202755 GTAGTTCCTAGCTACTTGGGAGG - Intergenic
1084308160 11:68300017-68300039 ATGGTGGCTAGCTACTTAGGAGG - Intergenic
1085883513 11:80496284-80496306 GTGGGACCTAGGTGCTGGGGTGG + Intergenic
1091372471 11:135072540-135072562 GTGACACCTAGGTCCTTGGGAGG + Intergenic
1093461215 12:19408425-19408447 GTGGTGCATAGTTACTTGGGAGG + Intronic
1094216010 12:27943564-27943586 GTGGGTCCTAGCTACTCAGGAGG - Intergenic
1096371542 12:51073095-51073117 GTGGTTCCCAGATACTTGGGAGG + Intronic
1097070746 12:56352939-56352961 GTAGTCCCTAGCTACTCAGGAGG - Intronic
1098253128 12:68589730-68589752 GTAGTCCCAAGCTACTTAGGAGG + Intergenic
1098267881 12:68740923-68740945 GTGGTTCTTAGCTACTTGGGAGG + Intronic
1098279156 12:68845883-68845905 GTGGTCCCCAGCTACTTGGGAGG - Exonic
1098974806 12:76891467-76891489 GTGGTACCAAGCTACTCAGGAGG - Intergenic
1100425065 12:94476705-94476727 GAGGTAGCTAGGTCCCTAGGAGG - Intergenic
1101303837 12:103507555-103507577 GTAGTTCCAAGCTACTTAGGAGG + Intergenic
1102193097 12:111004113-111004135 GTAGTTCCCAGGTACTCAGGAGG - Intergenic
1102275995 12:111582322-111582344 GTGGTCCCAAGCTACTCAGGAGG + Intronic
1102934541 12:116885311-116885333 GTGGTTCCCAGCTACTCAGGCGG + Intergenic
1103171109 12:118820860-118820882 GTGGTTCCCAGCTACTCAGGAGG - Intergenic
1103817957 12:123673844-123673866 GTTGTTCCCAGCTACTTAGGAGG + Intronic
1105382882 13:19903725-19903747 GTGGTTCCCAGCTACTTGGGAGG + Intergenic
1106860124 13:33896588-33896610 GTGGTCCCCAGTTACTTGGGAGG + Intronic
1110439585 13:75512861-75512883 GTAGTCCCCAGCTACTTAGGAGG - Intergenic
1112400680 13:99075472-99075494 GTAGTCCCTAGCTACTCAGGAGG - Intronic
1115758366 14:36552530-36552552 GTAGTCCCCAGCTACTTAGGAGG - Intergenic
1117692773 14:58325402-58325424 GTGGTCCCAAGCTACTCAGGAGG - Intronic
1119638963 14:76299810-76299832 GTGGTCCCAAGCTACTTGGGAGG - Intergenic
1121086743 14:91152273-91152295 GTGGTCCCAAGCTACTCAGGAGG + Intronic
1122576819 14:102748084-102748106 GTGGTCCCCAGCTACTCAGGAGG - Intergenic
1122582816 14:102781912-102781934 GTGGTCCCCAGCTACTCAGGAGG - Intronic
1122706888 14:103627588-103627610 GTAGTCCCTAGCTACTTGGGAGG + Intronic
1123713831 15:23011986-23012008 GTGGTCCCAAGCTACTTGGGAGG + Intronic
1123722886 15:23075323-23075345 GTAGTCCCTAGCTACTTAGGAGG - Intergenic
1123779890 15:23615795-23615817 GTGAAACTTAGGAACTTAGGAGG - Intronic
1123881379 15:24679614-24679636 GTGGGCCCTAGGTACTTTGTTGG - Exonic
1129364516 15:75046091-75046113 GTGGTCCCCAGCTACTCAGGAGG + Intronic
1135689971 16:24528330-24528352 GTGGGTCCTAGCTACTCAGGAGG + Intergenic
1136092659 16:27931673-27931695 GTGGATCCTTGGTCCTTAGGAGG + Intronic
1137880071 16:52036842-52036864 CAGGTACCTAGGTACCCAGGAGG - Intronic
1139604766 16:68010249-68010271 GTGGTCCCTAGCTACTCAGGAGG - Intronic
1139868178 16:70080425-70080447 GTGGTCCCCAGCTATTTAGGAGG + Intergenic
1139974900 16:70801715-70801737 GTGGTACCTGAGATCTTAGGTGG - Intergenic
1140387156 16:74551423-74551445 GTGGTCCCCAGCTATTTAGGAGG - Intronic
1141178110 16:81733997-81734019 GTGGGACCTAGCTACTCGGGAGG + Intergenic
1144170217 17:12652684-12652706 GTGGTACCTGGGAACTGTGGAGG - Intergenic
1145109125 17:20146219-20146241 GTGGTTGCCAGGCACTTAGGAGG - Intronic
1146186548 17:30728081-30728103 GTGGTGCCCAGCTACTTGGGAGG - Intergenic
1146432034 17:32806483-32806505 GTAGTCCCCAGCTACTTAGGAGG - Intronic
1146707901 17:35015086-35015108 GTAGTCCCCAGGTACTCAGGAGG - Intronic
1146978460 17:37136819-37136841 GTAGTCCCTAGCTACTTGGGAGG + Intronic
1147729516 17:42589552-42589574 GTGGTCCCCAGCTACTTGGGAGG - Intronic
1148175637 17:45561858-45561880 CTTGTACCTAGCTACTTAAGAGG + Intergenic
1148295741 17:46501144-46501166 CTTGTACCTAGCTACTTAAGAGG - Intergenic
1148664781 17:49366231-49366253 GTGGTCCCTAGCTACTCAGGAGG - Intergenic
1148872204 17:50665144-50665166 GAGGGACCTAGGTTCTGAGGAGG - Exonic
1148922322 17:51049716-51049738 GTAGTACCCAGCTACTTGGGAGG - Intronic
1150113347 17:62521524-62521546 GTGGCACCTAGCTACTCAGGAGG - Intronic
1150406856 17:64908804-64908826 CTTGTACCTAGCTACTTAAGAGG + Intronic
1150612284 17:66743203-66743225 GTAATACCTAGCTACTCAGGAGG + Intronic
1150760683 17:67958208-67958230 GTCCTAGCTAGGTACTTGGGAGG + Intronic
1150785536 17:68160254-68160276 CTTGTACCTAGCTACTTAAGAGG + Intergenic
1155020877 18:21896227-21896249 GTGGTCCCAAGCTACTTGGGAGG - Intergenic
1155051018 18:22147638-22147660 GTGGTCCCCAGCTACTCAGGAGG - Intergenic
1155070134 18:22307799-22307821 GTGGTACACAGGTACCAAGGAGG + Intergenic
1155474398 18:26223820-26223842 GTGGTCCCCAGCTACTTGGGAGG + Intergenic
1155956228 18:31959248-31959270 TTGGTACTTAGCTACTTGGGGGG - Intergenic
1157497398 18:48166243-48166265 GTGGTACCAAGGTTCAGAGGAGG - Intronic
1159122018 18:64182046-64182068 GTGGTAACTAGGTCTTTTGGTGG + Intergenic
1161392757 19:4029763-4029785 GTGGTCCCAAGCTACTCAGGAGG - Intronic
1162999596 19:14358263-14358285 GTGGTTCCCAGCTACTTGGGAGG - Intergenic
1163119126 19:15205839-15205861 GTGGTGGCTAGCTACTTGGGGGG - Intergenic
1163259072 19:16175932-16175954 GTGGTATCCAGCTACTTGGGAGG + Intergenic
1164227398 19:23257934-23257956 GTGGTGGCTAGCTACTAAGGAGG + Intergenic
1166027123 19:40096958-40096980 GTGGTCCCAAGCTACTTGGGAGG - Intergenic
1168463585 19:56583457-56583479 GTGGCACCTAGCTACTCGGGAGG + Intronic
926591880 2:14749300-14749322 AAGGGACCTAGGGACTTAGGGGG - Intergenic
927691466 2:25211304-25211326 GTGGTCCCAAGCTACTTGGGAGG - Intergenic
929461303 2:42103608-42103630 CTGGTACCTAGGAACTCAGTGGG + Intergenic
929975026 2:46625191-46625213 GTAGTCCCCAGCTACTTAGGAGG - Exonic
930658319 2:54029041-54029063 GTGGTCCCCAGCTACTCAGGAGG + Intronic
932353048 2:71047241-71047263 CTGGTAACTGGGTCCTTAGGGGG - Intergenic
935002293 2:99030527-99030549 GTGCCACCTAGCTACTTGGGAGG + Intronic
935487201 2:103672600-103672622 GTGGCACATAGCTACTTTGGAGG - Intergenic
936887862 2:117334716-117334738 TAGATACCTAGGCACTTAGGTGG + Intergenic
937351836 2:121170461-121170483 GTGGTCCCCAGCTACTCAGGAGG - Intergenic
938859877 2:135357219-135357241 GTAGTCCCCAGGTACTCAGGAGG - Intronic
939530894 2:143360261-143360283 GTAGTCCCAAGCTACTTAGGAGG + Intronic
943566806 2:189525861-189525883 GTGGTCCCAAGCTACTTGGGAGG - Intergenic
943977064 2:194496215-194496237 GTGGTTACTAGGGACTGAGGAGG - Intergenic
945126706 2:206519891-206519913 GTGGTTCCCAGCTACTTGGGAGG + Intronic
946401144 2:219469033-219469055 GTGGTACCTGGGGCCTGAGGCGG - Exonic
947696048 2:232190210-232190232 GTGGTTCCCAGCTACTCAGGAGG + Intronic
948381745 2:237555153-237555175 GTCGTACCTACTTACTTAGGAGG + Exonic
1169741797 20:8902878-8902900 ATGACTCCTAGGTACTTAGGAGG + Intronic
1172005205 20:31814834-31814856 GTGGTCCCAAGCTACTCAGGAGG - Intergenic
1172333037 20:34089210-34089232 GTGGGACCTTGAGACTTAGGAGG - Exonic
1173216346 20:41088379-41088401 GTCGTCCCCAGGTACTCAGGAGG + Intronic
1173879372 20:46400014-46400036 GTAGTCCCTAGCTACTCAGGAGG + Intronic
1174535827 20:51250766-51250788 GTAGTTCCTAGCTACTTGGGAGG - Intergenic
1175609857 20:60341748-60341770 GTAGTACCCAGCTACTTGGGAGG + Intergenic
1177299926 21:19230051-19230073 GGGCAACCTAGGTATTTAGGAGG + Intergenic
1184702986 22:46189825-46189847 GTAGTCCCTAGCTACTTGGGAGG - Intronic
949529998 3:4946522-4946544 GTGGTCCCAAGCTACTCAGGAGG - Intergenic
951218587 3:20046459-20046481 GTAGTCCCTAGCTACTCAGGAGG + Intronic
951960891 3:28319024-28319046 GTGGTACCTATCTACTTGGCAGG + Intronic
952798106 3:37261047-37261069 GTGGTCCCAAGCTACTTAAGAGG + Intronic
952818554 3:37466360-37466382 GTGGTACCCAGCTACTAGGGAGG + Intronic
953467628 3:43137601-43137623 GTGGCACATAGCTACTTGGGAGG - Intergenic
954543933 3:51416768-51416790 GTGGTTCTTAAGTACTTACGTGG + Exonic
954662395 3:52233050-52233072 GTGGGGCCTAGGCACTTAGATGG - Intronic
956388009 3:68741668-68741690 GTAGTCCCAAGCTACTTAGGAGG + Intronic
956991257 3:74768593-74768615 TTGATACCTTGGTATTTAGGAGG + Intergenic
964177684 3:153844662-153844684 ATGGCACTTAGGTACTTAGAAGG + Intergenic
968840767 4:3003856-3003878 GTGGTAGGTAGCTACTTGGGAGG - Intronic
969682514 4:8651226-8651248 GTGGTCCCAAGCTACTTGGGAGG - Intergenic
973715776 4:53674426-53674448 GTGGTGCAAAGGCACTTAGGTGG - Intronic
975129640 4:70820199-70820221 GTGGTGCCTATCTACTTAAGGGG - Exonic
975780657 4:77836198-77836220 GTAGTCCCCAGCTACTTAGGAGG - Intergenic
976585878 4:86796518-86796540 GTAGTCCCTAGCTACTCAGGAGG + Intronic
983177687 4:164610903-164610925 GTGGTCCCAAGCTACTTGGGAGG + Intergenic
983870219 4:172816984-172817006 GTAGTCCCAAGCTACTTAGGAGG + Intronic
984162246 4:176267491-176267513 GTGTGTCCTAGCTACTTAGGAGG + Intronic
984929680 4:184835569-184835591 ATGGTAACCAGGTACCTAGGAGG - Intergenic
986766344 5:10931604-10931626 GTGGAACCTACGTGCTTAGATGG - Intergenic
991199082 5:63970303-63970325 GTGGTCCCCAGCTACTTAGGAGG - Intergenic
991310612 5:65237264-65237286 GTGGTGCCTAGCTACTCAGGAGG + Intronic
992830243 5:80586977-80586999 GTGGGACCAAGGTGCATAGGCGG - Intergenic
994101075 5:95893504-95893526 GTGGTTCCCAGCTACTGAGGAGG - Intronic
996974942 5:129420979-129421001 GTGGTGCCCAGCTACTCAGGAGG - Intergenic
997991445 5:138547541-138547563 GTAGTCCCTAGCTACTCAGGAGG + Intergenic
999468012 5:151825327-151825349 CTGGGACCTAGTTACGTAGGGGG + Intronic
1002041185 5:176515502-176515524 GTGGTGCCTAGCTACGTAGGAGG - Intergenic
1004261492 6:14111398-14111420 GTGGTGCCCAGCTACTTGGGAGG + Intergenic
1005096341 6:22120751-22120773 GTGGTCCCCAGGTATTTGGGAGG + Intergenic
1005679379 6:28190666-28190688 GTGGTTCCCAGCTACTTGGGAGG + Intergenic
1005838893 6:29727569-29727591 GAGCTACATAGGTCCTTAGGAGG - Intronic
1008053983 6:46927751-46927773 CTGGTACCTAGGTAAGTGGGTGG - Intronic
1010088548 6:71951610-71951632 GTCCTACCTAGCTACTTAGGAGG - Intronic
1010119554 6:72358841-72358863 GTAGCACCTAGGTAGTTAGCTGG - Intronic
1012200157 6:96396052-96396074 TTGGTCCCTAGCTACTCAGGAGG - Intergenic
1013114160 6:107088130-107088152 GTCCTAGCTAGCTACTTAGGAGG - Intronic
1015610820 6:135016005-135016027 GTAATTCCTAGGTACTTGGGAGG - Intronic
1017308444 6:152948823-152948845 GTGGTTCCTAAGGCCTTAGGAGG - Intergenic
1019529155 7:1495041-1495063 GTGGTCCCTGGGTTCTTTGGTGG - Intronic
1020262417 7:6537726-6537748 GTGGCACCCAGCTACTTGGGAGG + Intronic
1020969035 7:14910117-14910139 GTAGTCCCTAGCTACTTGGGAGG + Intronic
1025625667 7:63219048-63219070 GTAGTTCCTAGCTACTTGGGAGG - Intergenic
1029122876 7:98280488-98280510 GTGGTCCCCAGCTACTGAGGAGG + Intronic
1030713265 7:112779008-112779030 GTGGTCCCAAGCTACTTGGGTGG - Intronic
1031309995 7:120184394-120184416 GTGGTCCCAAGCTACTCAGGAGG + Intergenic
1031766151 7:125780287-125780309 TTGGTACCTATGTATTTAAGAGG - Intergenic
1032042561 7:128575472-128575494 GTAGCACCTAGCTACTCAGGAGG - Intergenic
1032815566 7:135470249-135470271 GTGGGTCCTAGCTACTCAGGAGG - Intronic
1037598950 8:20377674-20377696 GTAGTCCCTAGCTACTTGGGAGG + Intergenic
1043838229 8:85068934-85068956 GGGGTAACAAGGTACTTAGTAGG - Intergenic
1044787579 8:95810761-95810783 GTGGTGCCTACTTTCTTAGGAGG - Intergenic
1045033988 8:98163221-98163243 GTGGCTCCCAGATACTTAGGAGG - Intergenic
1046135265 8:110018283-110018305 GTGGTATCTAAGTTCTTCGGTGG + Intergenic
1046327817 8:112672972-112672994 GTGGTACTTAGGTGCTCAGAAGG + Intronic
1048344713 8:133568040-133568062 GTAGTACCCAGCTACTCAGGAGG - Intronic
1051044258 9:12854735-12854757 GTAGTTCCCAGCTACTTAGGAGG - Intergenic
1053111392 9:35463053-35463075 GTGGTTCCCAGCTACTTAGGAGG + Intergenic
1053195108 9:36111513-36111535 GTCGTTCCTAGCTACTTGGGAGG - Intronic
1053335308 9:37264692-37264714 GTGCTAGCTCTGTACTTAGGAGG - Intronic
1055626132 9:78178999-78179021 GAGGTACCAAGGTACCAAGGAGG - Intergenic
1056422725 9:86445306-86445328 GTGGTCCCAAGTTACTTGGGAGG - Intergenic
1057778858 9:98033843-98033865 GTGGTCCCCAGCTACTCAGGAGG + Intergenic
1060604470 9:124901554-124901576 GTAGTCCCTAGCTACTCAGGAGG - Intronic
1061068880 9:128296466-128296488 GTGGTACCCAGCTACTCAGGAGG + Intergenic
1186477458 X:9868682-9868704 GTGGCACCCAGCTACTCAGGAGG - Intronic
1186732923 X:12429496-12429518 GTGGAAGCTAGGTGCTTTGGTGG - Intronic
1187469575 X:19556797-19556819 GTGGTAGCTAGCTAATTGGGAGG - Intronic
1188770263 X:34145713-34145735 GTGGTACCCAGCTACTCGGGAGG + Intergenic
1191843161 X:65527413-65527435 GTTGGTCCTAGCTACTTAGGAGG + Intronic
1192412692 X:70948515-70948537 GTAGTCCCAAGCTACTTAGGAGG - Intergenic
1198894509 X:141437987-141438009 GTGGTCCCAAGCTACTTGGGAGG - Intergenic
1199817885 X:151415448-151415470 GTGGTTGCTAGGGACTTGGGTGG - Intergenic
1201053019 Y:9959430-9959452 GAGTTACCTTGGTACTCAGGAGG + Intergenic