ID: 1070795231

View in Genome Browser
Species Human (GRCh38)
Location 10:79212428-79212450
Sequence CCAGTGGTACCTAGGTACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795231_1070795242 27 Left 1070795231 10:79212428-79212450 CCTAAGTACCTAGGTACCACTGG 0: 1
1: 0
2: 0
3: 2
4: 131
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795231_1070795240 22 Left 1070795231 10:79212428-79212450 CCTAAGTACCTAGGTACCACTGG 0: 1
1: 0
2: 0
3: 2
4: 131
Right 1070795240 10:79212473-79212495 AAAAATTTTTTGCACAGATGGGG No data
1070795231_1070795238 20 Left 1070795231 10:79212428-79212450 CCTAAGTACCTAGGTACCACTGG 0: 1
1: 0
2: 0
3: 2
4: 131
Right 1070795238 10:79212471-79212493 TAAAAAATTTTTTGCACAGATGG No data
1070795231_1070795239 21 Left 1070795231 10:79212428-79212450 CCTAAGTACCTAGGTACCACTGG 0: 1
1: 0
2: 0
3: 2
4: 131
Right 1070795239 10:79212472-79212494 AAAAAATTTTTTGCACAGATGGG No data
1070795231_1070795241 26 Left 1070795231 10:79212428-79212450 CCTAAGTACCTAGGTACCACTGG 0: 1
1: 0
2: 0
3: 2
4: 131
Right 1070795241 10:79212477-79212499 ATTTTTTGCACAGATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795231 Original CRISPR CCAGTGGTACCTAGGTACTT AGG (reversed) Intronic
904044782 1:27602864-27602886 CCAGTGGATCCTAGGGATTTGGG + Intronic
910017730 1:82547860-82547882 CCAGTAGAACTTAGGTTCTTTGG + Intergenic
911606491 1:99911565-99911587 CCTGTAGTCCCCAGGTACTTGGG - Intronic
911609047 1:99940538-99940560 CCTGTAGTCCCTAGGTGCTTGGG + Intergenic
912350212 1:109005286-109005308 CCTGTGGTCCCCAGCTACTTGGG + Intronic
913206769 1:116546049-116546071 CCTGTGGTCCCCAGCTACTTGGG + Intronic
913244261 1:116857855-116857877 CCTGTAGTCCCCAGGTACTTGGG - Intergenic
914398128 1:147290205-147290227 CCTGTGGTACAAAGCTACTTGGG - Intronic
915462449 1:156078209-156078231 TCAGTGGTCCCTGGGTAGTTTGG - Intronic
915807827 1:158873124-158873146 CCAGTGGTCCCCAGGTTCCTAGG - Intergenic
918429569 1:184444808-184444830 ACAGAGGTACTTAAGTACTTAGG + Intronic
921296178 1:213705744-213705766 CCAGTGATACCCAAGTACTATGG - Intergenic
922227474 1:223658034-223658056 CCAGGGGTTCCTTGATACTTAGG - Intronic
1069664999 10:70148663-70148685 CCTGTGGTCCCAAGCTACTTGGG + Exonic
1070795231 10:79212428-79212450 CCAGTGGTACCTAGGTACTTAGG - Intronic
1071946776 10:90654944-90654966 CCAGTGGCTCCCAGGTTCTTGGG - Intergenic
1076067552 10:127460759-127460781 CCAGGAGGACCGAGGTACTTGGG - Intergenic
1078236988 11:9494429-9494451 TCTGTGGTTCCCAGGTACTTGGG - Intronic
1079936294 11:26620777-26620799 CCAGTGGTAACCAGGTATTAAGG - Intronic
1081873741 11:46395107-46395129 CCTGTAGTCCCTAAGTACTTGGG - Intergenic
1084409884 11:69000664-69000686 CCAGTGGTGCCAGGGAACTTTGG + Intergenic
1085883512 11:80496281-80496303 CTAGTGGGACCTAGGTGCTGGGG + Intergenic
1086071165 11:82801113-82801135 CTAGTGGTATCTGGGTACTCTGG + Intergenic
1090621804 11:128567207-128567229 CCAGTGGGACATGGGTACCTGGG - Intronic
1094062605 12:26331018-26331040 ACAGTTGTACCTTGGTATTTGGG - Intergenic
1095891234 12:47236243-47236265 CCAGTGGTACATAGGGGTTTTGG + Exonic
1096371541 12:51073092-51073114 CCTGTGGTTCCCAGATACTTGGG + Intronic
1096558504 12:52418929-52418951 CCAGGGCTACCTAGGTAATCAGG - Intergenic
1098144149 12:67482004-67482026 CCAATGGAACCTTGGAACTTGGG + Intergenic
1098267880 12:68740920-68740942 CCTGTGGTTCTTAGCTACTTGGG + Intronic
1098279157 12:68845886-68845908 CCTGTGGTCCCCAGCTACTTGGG - Exonic
1098974807 12:76891470-76891492 CCTGTGGTACCAAGCTACTCAGG - Intergenic
1105382881 13:19903722-19903744 CCTGTGGTTCCCAGCTACTTGGG + Intergenic
1107195276 13:37643728-37643750 CCAGTGGTTACTAGGCACCTGGG + Intronic
1110346333 13:74451899-74451921 CCAGTCTTTGCTAGGTACTTAGG - Intergenic
1110830934 13:80030106-80030128 ACAGAGGTACCTAGGTACTCAGG + Intergenic
1111689884 13:91550341-91550363 CCAATGTAACCTATGTACTTTGG + Intronic
1114282298 14:21204232-21204254 CCAGTGGCACCTGGGACCTTGGG + Intergenic
1114805665 14:25833537-25833559 CGACTGGTACCCCGGTACTTCGG + Intergenic
1115180576 14:30621541-30621563 CCTGTAGTCCCTAGCTACTTGGG + Intergenic
1119638964 14:76299813-76299835 CCTGTGGTCCCAAGCTACTTGGG - Intergenic
1122706887 14:103627585-103627607 CCTGTAGTCCCTAGCTACTTGGG + Intronic
1123713830 15:23011983-23012005 CCTGTGGTCCCAAGCTACTTGGG + Intronic
1123722887 15:23075326-23075348 CCTGTAGTCCCTAGCTACTTAGG - Intergenic
1123818849 15:24006098-24006120 TCAGTGCTAGCTAGGTACCTGGG + Intergenic
1128065414 15:64761520-64761542 CCAGTTGTTCCTGGGTACCTTGG - Intronic
1128488644 15:68123174-68123196 CCAGTAGGTCCTAGCTACTTGGG - Intronic
1133638136 16:7689945-7689967 CCAGGGCAACCTAGCTACTTAGG - Intronic
1136542763 16:30937500-30937522 CCAGTGGAAGCCAGATACTTGGG + Intronic
1137970797 16:52982915-52982937 CCAGTATTTCCTAGTTACTTGGG + Intergenic
1139409502 16:66747946-66747968 CCATTGGTACCTAGGTTGGTTGG - Intronic
1139604767 16:68010252-68010274 CCTGTGGTCCCTAGCTACTCAGG - Intronic
1142061321 16:88031701-88031723 TCAGTGGAATCTAGGTACTATGG + Intronic
1143547956 17:7610878-7610900 CCCCAGGTTCCTAGGTACTTTGG + Intronic
1144170218 17:12652687-12652709 CCTGTGGTACCTGGGAACTGTGG - Intergenic
1146702458 17:34973214-34973236 CCTGTGGGTCCCAGGTACTTGGG + Intronic
1146978459 17:37136816-37136838 CCTGTAGTCCCTAGCTACTTGGG + Intronic
1147729517 17:42589555-42589577 CCTGTGGTCCCCAGCTACTTGGG - Intronic
1148069606 17:44900383-44900405 ACAGAGGTCCCTAGGTACCTGGG - Intronic
1148664782 17:49366234-49366256 CCTGTGGTCCCTAGCTACTCAGG - Intergenic
1148922323 17:51049719-51049741 CCTGTAGTACCCAGCTACTTGGG - Intronic
1151652545 17:75479020-75479042 CCATTGGTGCCCAGGTACATTGG + Intronic
1152114524 17:78377369-78377391 CCAGTGATATCTGTGTACTTGGG + Intergenic
1155020878 18:21896230-21896252 CCTGTGGTCCCAAGCTACTTGGG - Intergenic
1155474397 18:26223817-26223839 CCTGTGGTCCCCAGCTACTTGGG + Intergenic
1158966123 18:62623805-62623827 CCACTGTTACCTGGGTACATGGG - Intergenic
1162301142 19:9845927-9845949 CCAGAGGTACCCACCTACTTCGG - Intronic
1162999597 19:14358266-14358288 CCTGTGGTTCCCAGCTACTTGGG - Intergenic
1164455431 19:28403016-28403038 GCAGTGGGACATGGGTACTTAGG - Intergenic
1166027124 19:40096961-40096983 CCTGTGGTCCCAAGCTACTTGGG - Intergenic
1167009270 19:46796218-46796240 CCAGTGGTCCCTGGGTCCTCAGG - Intergenic
1167995759 19:53400954-53400976 CCTGTGGTTCCCAGCTACTTGGG - Intronic
1168554850 19:57329435-57329457 CCAGTGGTTGCTATGCACTTAGG + Exonic
925891683 2:8439682-8439704 ACACTGGTACCTAGGGACCTAGG + Intergenic
927691467 2:25211307-25211329 CCTGTGGTCCCAAGCTACTTGGG - Intergenic
937480561 2:122254182-122254204 CCTGTAGTACCCAGCTACTTTGG - Intergenic
944349002 2:198704767-198704789 CTAGTGGTTTCTAGGTACTGAGG - Intergenic
945126705 2:206519888-206519910 CCTGTGGTTCCCAGCTACTTGGG + Intronic
945445540 2:209933527-209933549 CACTTGGTAGCTAGGTACTTGGG - Intronic
1172983466 20:38962565-38962587 CCAGTGGTCCCGAGGGATTTGGG + Intronic
1173313341 20:41920431-41920453 CCTGTGGTCCCCAGCTACTTGGG + Intergenic
1173460383 20:43238645-43238667 CCAGTGGGACCTGGGTTCTGGGG - Intergenic
1174535828 20:51250769-51250791 CCTGTAGTTCCTAGCTACTTGGG - Intergenic
1175609856 20:60341745-60341767 CCTGTAGTACCCAGCTACTTGGG + Intergenic
1179315956 21:40244675-40244697 GCAGTGGTAGGTAGGTAGTTAGG + Intronic
1181960205 22:26617212-26617234 CCAGTGGTTCCTTGTTGCTTTGG + Intronic
1182786592 22:32912972-32912994 CCAGTGTCAACTAGGGACTTTGG + Intronic
1184702987 22:46189828-46189850 CCTGTAGTCCCTAGCTACTTGGG - Intronic
951212576 3:19991905-19991927 GCAGTGGTAACTTGGAACTTAGG + Intronic
952818553 3:37466357-37466379 CCTGTGGTACCCAGCTACTAGGG + Intronic
959538191 3:107510742-107510764 CCAGTGTTACCTAAATAATTGGG + Intergenic
961803824 3:129474422-129474444 CCAGTGGTAATAAGGAACTTGGG + Intronic
962688000 3:137865980-137866002 TCAGGGATAGCTAGGTACTTGGG - Intergenic
966572786 3:181465218-181465240 CAAGTGGTACCCAGATATTTGGG - Intergenic
966948476 3:184795104-184795126 CCAGAGGTACCCAGGTTCGTTGG - Intergenic
969036746 4:4260201-4260223 CCAGTGGTACCCGGTGACTTTGG + Intergenic
969682515 4:8651229-8651251 CCTGTGGTCCCAAGCTACTTGGG - Intergenic
978638714 4:110843207-110843229 TCAGTGGTACCTGGTTACTAGGG + Intergenic
980017787 4:127673303-127673325 CCTGTAGTCCCTAGCTACTTGGG - Intronic
986659342 5:10045098-10045120 CCAGTGCCACCCAGGTACTATGG - Intergenic
986672358 5:10153658-10153680 CCAGTGGTACCCAGGTTATCTGG - Intergenic
991199083 5:63970306-63970328 CCTGTGGTCCCCAGCTACTTAGG - Intergenic
997460553 5:134049112-134049134 CCAGTGCTACCCATGTGCTTTGG - Intergenic
1003571403 6:7258691-7258713 CCAGTGGGACCCAAGTCCTTGGG - Intergenic
1005096340 6:22120748-22120770 CCTGTGGTCCCCAGGTATTTGGG + Intergenic
1005679378 6:28190663-28190685 CCTGTGGTTCCCAGCTACTTGGG + Intergenic
1005838894 6:29727572-29727594 CCAGAGCTACATAGGTCCTTAGG - Intronic
1007322559 6:41038267-41038289 CCACTGGTACCTTGGTAGGTGGG - Intronic
1008038172 6:46769235-46769257 TCAGTGGTTTCTAGGTACTGGGG + Intergenic
1019864215 7:3690073-3690095 CCAGTGGTAATTATGTTCTTAGG + Intronic
1021279850 7:18704144-18704166 CCAGTGGCACCCAGGCACTCTGG + Intronic
1023915841 7:44588563-44588585 CCAGTGGTCCCCAGTTACTTGGG + Intergenic
1024058980 7:45684151-45684173 CCAATGGTATCTTGGGACTTGGG + Intronic
1025625668 7:63219051-63219073 CCTGTAGTTCCTAGCTACTTGGG - Intergenic
1030713266 7:112779011-112779033 CCTGTGGTCCCAAGCTACTTGGG - Intronic
1030887590 7:114957556-114957578 TCAGTGGTATCTAGGCATTTGGG + Intronic
1033740644 7:144273052-144273074 CCAGTTGTGCCTAGGTAACTGGG + Intergenic
1033753263 7:144376561-144376583 CCAGTTGTGCCTAGGTAACTGGG - Intronic
1037598949 8:20377671-20377693 CCTGTAGTCCCTAGCTACTTGGG + Intergenic
1038815229 8:30896072-30896094 CTATTGGTACCTTGGAACTTGGG + Intergenic
1043360313 8:79464448-79464470 CCAGTGGTGCCTGGGTTCTCAGG - Intergenic
1044318064 8:90772515-90772537 CCTGTGCTACCTATTTACTTTGG - Intronic
1046135264 8:110018280-110018302 TCAGTGGTATCTAAGTTCTTCGG + Intergenic
1053195109 9:36111516-36111538 CCTGTCGTTCCTAGCTACTTGGG - Intronic
1056422727 9:86445309-86445331 CCCGTGGTCCCAAGTTACTTGGG - Intergenic
1186424099 X:9449800-9449822 CCTGTGGTTCCCAGCTACTTGGG - Intergenic
1186628987 X:11327738-11327760 ACAATGGTACCTAGGAATTTGGG + Intronic
1186743740 X:12544775-12544797 CCAGTAGCAGCTAGGTACATAGG - Intronic
1186775221 X:12857742-12857764 CCAGTAGCAGCTAGGTACATAGG + Intergenic
1188616412 X:32164173-32164195 CCAGTGGTACTGAGGTAGTGAGG + Intronic
1192365267 X:70467035-70467057 CCTGTGGTCCTTAGCTACTTGGG - Intronic
1197734040 X:129836839-129836861 CCAGTGGCATCTAGGCTCTTTGG - Intronic
1198894510 X:141437990-141438012 CCTGTGGTCCCAAGCTACTTGGG - Intergenic
1199817886 X:151415451-151415473 TCAGTGGTTGCTAGGGACTTGGG - Intergenic