ID: 1070795233

View in Genome Browser
Species Human (GRCh38)
Location 10:79212436-79212458
Sequence GGTGTAGGCCAGTGGTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795233_1070795241 18 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795241 10:79212477-79212499 ATTTTTTGCACAGATGGGGCTGG No data
1070795233_1070795238 12 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795238 10:79212471-79212493 TAAAAAATTTTTTGCACAGATGG No data
1070795233_1070795243 24 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795243 10:79212483-79212505 TGCACAGATGGGGCTGGGCATGG No data
1070795233_1070795240 14 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795240 10:79212473-79212495 AAAAATTTTTTGCACAGATGGGG No data
1070795233_1070795239 13 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795239 10:79212472-79212494 AAAAAATTTTTTGCACAGATGGG No data
1070795233_1070795244 27 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795244 10:79212486-79212508 ACAGATGGGGCTGGGCATGGTGG No data
1070795233_1070795242 19 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795233 Original CRISPR GGTGTAGGCCAGTGGTACCT AGG (reversed) Intronic
901656679 1:10773480-10773502 GGTGCAGGACAGTGGGACCCGGG + Intronic
902752503 1:18526991-18527013 GGTTTCGGCCACTGTTACCTGGG - Intergenic
904420742 1:30389646-30389668 GGTGGAGGGCAGTGGTGTCTGGG - Intergenic
904531278 1:31171273-31171295 GGTGTAGGCCAAAGTAACCTTGG + Intergenic
906032301 1:42731405-42731427 GGTGAACCCCAGTGGTACTTAGG - Intergenic
910270304 1:85387002-85387024 GGTATAGGGCAGTGGTGCCCTGG + Intronic
915682822 1:157598007-157598029 GGTGTAGGCAAGTGCTGCTTTGG - Exonic
920240562 1:204545591-204545613 GTTGTAGTCAAATGGTACCTGGG + Intronic
921067464 1:211632918-211632940 GGTGTGGCCCAAGGGTACCTCGG - Intergenic
922163912 1:223098959-223098981 GGTGTAGGCAAATGTTTCCTAGG + Intergenic
1069080324 10:64081668-64081690 GGTGAAGATCAGTGGGACCTGGG + Intergenic
1070795233 10:79212436-79212458 GGTGTAGGCCAGTGGTACCTAGG - Intronic
1073837207 10:107458177-107458199 GGTGGAGGCCAGTTGTACATGGG - Intergenic
1075265743 10:120998578-120998600 GGCTGAGGCAAGTGGTACCTGGG + Intergenic
1077224754 11:1435111-1435133 GGTCTAGGGCAGTGCTGCCTGGG + Intronic
1077361536 11:2142834-2142856 GGTGTAGCCCAGAGGGACCCGGG + Intronic
1079764791 11:24378516-24378538 TGTGTAGGTCAATGGGACCTTGG + Intergenic
1079904030 11:26222827-26222849 GGTGTAGGGCAGTGGGATCCTGG + Intergenic
1086542005 11:87924281-87924303 GGTGAAGGTCAGTGTGACCTGGG - Intergenic
1087628329 11:100621874-100621896 GGTGCAGGGCAGTGGCACCCTGG + Intergenic
1089339250 11:117746483-117746505 AGAGAAGTCCAGTGGTACCTGGG + Intronic
1089821118 11:121227004-121227026 GGTGCAGGGCAGTGGTGCCCTGG + Intergenic
1092120079 12:6037690-6037712 GGTGAAGGACTGTGGCACCTTGG + Intronic
1093587326 12:20855336-20855358 GGAGGATGCCACTGGTACCTAGG + Intronic
1093901312 12:24637270-24637292 AGTGTAGCACAGTGGTAACTGGG - Intergenic
1102804978 12:115771711-115771733 GGTGGAGAGCAGTGGTACATAGG + Intergenic
1103427024 12:120844802-120844824 GATGTAGGCCCGTGGGCCCTTGG - Intronic
1104993925 12:132642466-132642488 GTTGTGGGCCAGTGGTCCCCAGG - Intronic
1107488829 13:40859980-40860002 GCTGGAGGGCAGTGGCACCTGGG - Intergenic
1107878817 13:44815467-44815489 TGTGGTGCCCAGTGGTACCTAGG - Intergenic
1122262377 14:100530800-100530822 GGTGGGGCCCACTGGTACCTTGG + Intergenic
1122643311 14:103175213-103175235 GCTGTCTGCCAGTGGAACCTGGG - Intergenic
1123023309 14:105412120-105412142 GGAGGAGGCCTGGGGTACCTGGG + Exonic
1129206860 15:74042366-74042388 TGTGTAGGACACTGGCACCTCGG + Intronic
1133254741 16:4509789-4509811 GGGGTAGGCCAGTGGTCAGTCGG - Exonic
1134136578 16:11680378-11680400 GGTGTGAGCCAGATGTACCTGGG - Intronic
1138556751 16:57775371-57775393 GGAGCAGGCCACTGGTGCCTTGG - Intronic
1138970197 16:62134171-62134193 GGTGCAGGGCAGTGGCACCATGG + Intergenic
1139601922 16:67992492-67992514 CGTGTATCCCTGTGGTACCTGGG + Exonic
1146590489 17:34124325-34124347 TGTGTAGGTCAGTGGTGCTTCGG - Intronic
1148777822 17:50105476-50105498 GGTGTTGGCCAGGGGCATCTGGG + Intronic
1152525116 17:80884099-80884121 AGAGTAGGACAGTGGGACCTTGG + Intronic
1157621944 18:49021735-49021757 GGTGTAGGGCGGTGTGACCTTGG - Intergenic
1158388979 18:57027470-57027492 GGGGAAAGCCAGTGGTTCCTGGG + Exonic
1160971172 19:1768429-1768451 GGTGCAGGCCAGTCCTTCCTGGG - Intronic
1166222939 19:41377159-41377181 GGAGTAGGGCAGGGGTGCCTGGG + Intronic
926784656 2:16508033-16508055 GGTGAAAGCCAGAGGAACCTGGG + Intergenic
932569346 2:72930133-72930155 GCTCTAGGCAAGAGGTACCTGGG - Intronic
933919571 2:87031115-87031137 TGTGTAGGGCAGTGCTTCCTTGG - Intergenic
933932062 2:87162691-87162713 TGTGTAGGGCAGTGCTTCCTTGG + Intergenic
934003423 2:87738787-87738809 TGTGTAGGGCAGTGCTTCCTTGG + Intergenic
934564107 2:95328995-95329017 AGTGTAGCCCAGCGGTTCCTAGG + Intronic
936361054 2:111802743-111802765 TGTGTAGGGCAGTGCTTCCTTGG - Intronic
942460145 2:176162960-176162982 GGTGGAGGCCCGAGGTACCAGGG - Intronic
946038530 2:216764250-216764272 GATTTAGCCCAGTGATACCTGGG - Intergenic
947953672 2:234169769-234169791 GGTGTTTGCAAGTGGGACCTTGG - Intergenic
1171248209 20:23630107-23630129 GTTATAGTCCAGTGGTTCCTTGG + Intronic
1177529466 21:22340969-22340991 TGTGTAGGGCAGTGGGACCTTGG + Intergenic
1178975171 21:37215204-37215226 GGTGGAGGTCAGTGGGACTTTGG - Intergenic
1181583965 22:23842790-23842812 GGTGGAGACCTGTGGTTCCTCGG + Intergenic
1183337163 22:37256452-37256474 GGTGTGGGGCAGTGGGAGCTTGG - Intergenic
1184864372 22:47194156-47194178 GGTGTGGGCCAGCTGGACCTTGG + Intergenic
952759663 3:36903044-36903066 AGTGTGGGGCAGTGGCACCTGGG - Intronic
954751778 3:52818005-52818027 GGTGTGTGCCAGTGGTGTCTGGG + Intronic
961662555 3:128477386-128477408 GGTGGAGGCCAGGGGGACCTAGG + Intergenic
961941967 3:130647171-130647193 GCTGGATGGCAGTGGTACCTAGG - Intronic
968048354 3:195636295-195636317 TGAGTGGGCCAGTGGGACCTGGG + Intergenic
968099049 3:195953325-195953347 TGAGTGGGCCAGTGGGACCTGGG - Intergenic
968306255 3:197653626-197653648 TGAGTGGGCCAGTGGGACCTGGG - Intergenic
978737883 4:112104968-112104990 GGTGTAGGGGAGTGGTATGTGGG - Intergenic
979412286 4:120393873-120393895 GGTGCTGGCCTGTGTTACCTAGG + Intergenic
983204696 4:164900724-164900746 GATGTAGTCCAGTGGGCCCTGGG + Intergenic
988468217 5:31511567-31511589 GGTGTGTGCCTGTGCTACCTGGG + Intronic
993265890 5:85725906-85725928 GGAGAAAGTCAGTGGTACCTCGG - Intergenic
996791076 5:127293716-127293738 GGTGAATGTCAGTGTTACCTGGG + Intronic
998008295 5:138672281-138672303 GGTGTGTGCCTGTGGTACTTGGG + Intronic
998608719 5:143664493-143664515 TGTCTAGGCCAGTGGCACATGGG - Intergenic
1004566157 6:16799692-16799714 GATTCAGGCCAGTGTTACCTAGG + Intergenic
1005597580 6:27394281-27394303 GGTGCAGGGCAGTGGGACCCAGG - Intronic
1005604412 6:27461727-27461749 GGTGTAGGGAGGTGGAACCTAGG + Intronic
1008567667 6:52785072-52785094 GGTGGAGGCCGGTGATGCCTTGG + Intergenic
1008571802 6:52823908-52823930 GGTGGAGGCCGGTGATGCCTTGG + Intergenic
1010010155 6:71039781-71039803 GGCTTAAGCCAGTGGTGCCTAGG - Intergenic
1010367902 6:75073593-75073615 GGTGAAGGACAGTGGGACATTGG - Intergenic
1016991596 6:149933483-149933505 GGTGTAGACCAGTGTTTCCTGGG - Intergenic
1018724710 6:166602990-166603012 GGTGTTGGTCAGGGGCACCTAGG + Intronic
1019463312 7:1172813-1172835 GGTGTAGGACAGTGCTAGCCCGG + Intergenic
1019526649 7:1483424-1483446 CGTGTAGGCCTGCGGTGCCTGGG - Intronic
1019835709 7:3381250-3381272 GGTGTGGACCAGTGGTACACAGG + Intronic
1021797000 7:24265933-24265955 GGTTTAAGCCACTGGTAGCTGGG - Intergenic
1022494338 7:30843799-30843821 GGTGCAGCCCAGTGGGTCCTGGG + Intronic
1024887676 7:54163084-54163106 GATGTAGGCCCTTGCTACCTGGG - Intergenic
1030020113 7:105265483-105265505 GGTGTAGTACAGTTGTCCCTTGG - Intronic
1030951687 7:115798415-115798437 GTTTTAGTCCAGTGATACCTAGG + Intergenic
1031229759 7:119091088-119091110 GGTGTGGAACAGTGGTTCCTTGG + Intergenic
1039840430 8:41289134-41289156 GGTGAAGGCCAGTGTTCCCAGGG + Intronic
1045651123 8:104342553-104342575 GGTGTGGGCCAGTGGGCCATGGG - Intronic
1048644903 8:136409319-136409341 GGTGTAGGCCACTTGTTCCAGGG - Intergenic
1049283034 8:141760260-141760282 GGTGAGGGCCAGTGCTGCCTGGG + Intergenic
1056509322 9:87288058-87288080 GGTGCAGGCCAGTGGCAGCATGG + Intergenic
1061221407 9:129254147-129254169 GGTTTAGGCCCGTGGTCCATGGG + Intergenic
1188938920 X:36213365-36213387 GATGTACATCAGTGGTACCTGGG + Intergenic
1190203265 X:48381820-48381842 GGTGTGTGCCAGTGGTCCCGAGG + Intergenic
1190207271 X:48413584-48413606 GGTGTGTGCCAGTGGTCCCGAGG - Intergenic
1192781023 X:74293736-74293758 GGTGGAGGCCAGTGTGACCGAGG - Intergenic
1199018211 X:142845194-142845216 GGTGGAGGTCTGTGATACCTTGG - Intergenic