ID: 1070795234

View in Genome Browser
Species Human (GRCh38)
Location 10:79212444-79212466
Sequence GGTGTGATGGTGTAGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1566
Summary {0: 1, 1: 0, 2: 9, 3: 168, 4: 1388}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795234_1070795239 5 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795239 10:79212472-79212494 AAAAAATTTTTTGCACAGATGGG No data
1070795234_1070795244 19 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795244 10:79212486-79212508 ACAGATGGGGCTGGGCATGGTGG No data
1070795234_1070795240 6 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795240 10:79212473-79212495 AAAAATTTTTTGCACAGATGGGG No data
1070795234_1070795243 16 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795243 10:79212483-79212505 TGCACAGATGGGGCTGGGCATGG No data
1070795234_1070795238 4 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795238 10:79212471-79212493 TAAAAAATTTTTTGCACAGATGG No data
1070795234_1070795241 10 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795241 10:79212477-79212499 ATTTTTTGCACAGATGGGGCTGG No data
1070795234_1070795242 11 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795234 Original CRISPR GGTGTGATGGTGTAGGCCAG TGG (reversed) Intronic
900157625 1:1209627-1209649 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
900464022 1:2815303-2815325 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
901189035 1:7393403-7393425 GGTGTGGTGGTGCATGCCTGTGG - Intronic
901372355 1:8810464-8810486 GGTGTGATGGTGCATGCCTATGG + Intronic
901486454 1:9566176-9566198 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
901674633 1:10875741-10875763 GGTGTGGTGGTGAACGCCTGTGG - Intergenic
901697611 1:11020772-11020794 GGTGTGGTGGTGCACGCCTGTGG + Intronic
901706582 1:11078133-11078155 GGTATGGTGGTGTATGCCTGTGG + Intronic
901893933 1:12292577-12292599 GGTGTGATGGTGCATGCCTGTGG - Intronic
901950677 1:12743423-12743445 GGTGTGGTGGTGTATGACTGTGG - Intergenic
902276371 1:15342933-15342955 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
902748294 1:18488273-18488295 GGCGTGATGGTGTGTGCCTGTGG + Intergenic
902917919 1:19649799-19649821 GGTGTGGTGGTGCATGCCTGTGG - Intronic
903067211 1:20706747-20706769 GGTGTGGTGGTGCATGCCTGTGG + Intronic
903204059 1:21767187-21767209 GGTGTGGTGGCGTATGCCTGTGG - Intronic
903207079 1:21790667-21790689 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
903484767 1:23681452-23681474 GGTGTGATGGTGCATACCTGTGG + Intergenic
903706313 1:25288314-25288336 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
903897571 1:26618463-26618485 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
904357427 1:29949708-29949730 GATTTGATCATGTAGGCCAGAGG - Intergenic
904369802 1:30041112-30041134 GGAGTGATGGAGTAAGGCAGGGG + Intergenic
904445544 1:30570646-30570668 GGGGTGACGGGGTAGGGCAGGGG + Intergenic
904522919 1:31109967-31109989 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
904564428 1:31419687-31419709 GGTGTGGTGGTGCATGCCTGTGG + Intronic
904690134 1:32287589-32287611 GGAGTGTTGGTGTATGCCTGTGG - Intergenic
904704932 1:32382719-32382741 GGTGTGGTGGTGCACGCCTGTGG + Intronic
904704999 1:32383305-32383327 GGTGTGGTGGTTCACGCCAGTGG + Intronic
904898386 1:33836101-33836123 GGTGTGTTGGTGTTTGCCGGAGG + Intronic
904969941 1:34411591-34411613 GGTGTAATGATGTATGCCTGTGG - Intergenic
905065474 1:35177490-35177512 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
905072360 1:35238179-35238201 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
905248012 1:36628085-36628107 GATGAGATGGGGAAGGCCAGGGG - Intergenic
905339516 1:37268689-37268711 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
905419872 1:37834085-37834107 GGTGTGGTGGTGCATGCCTGTGG + Intronic
905857527 1:41323830-41323852 GGGGTGCTGGGGTAGGGCAGCGG - Intergenic
906043226 1:42805639-42805661 GGTGTGGTGGTGCAAGCCTGTGG + Intergenic
906215407 1:44035447-44035469 AGTGTGATGGTGTTGGCGTGAGG + Intergenic
906226426 1:44126161-44126183 GGTGTGCTGGTGGATGCCTGTGG - Intronic
906358936 1:45135998-45136020 GGCGTGATGGTGCATGCCTGTGG - Intronic
906721700 1:48010615-48010637 GGTGTGGTGGTGCAAGCCTGTGG - Intergenic
907037721 1:51230922-51230944 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
907250159 1:53132704-53132726 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
907407778 1:54264160-54264182 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
907775795 1:57513235-57513257 AGTGTGAAGGTCTAGGGCAGAGG - Intronic
908126012 1:61030898-61030920 GGTGTGGTGGCGCATGCCAGTGG + Intronic
908126116 1:61031832-61031854 GGTGTGGTGGTGCACGCCTGTGG - Intronic
908357430 1:63336654-63336676 GGTGTGGTGGTGAAAGCCTGTGG - Intergenic
908696067 1:66843058-66843080 GGTGTGGTGGTGCACGCCTGTGG + Intronic
908733853 1:67255576-67255598 GGTGTGGTGGTGCATGCCTGTGG - Intronic
908762931 1:67528533-67528555 GGGGTGGTAGTGTTGGCCAGGGG + Intergenic
908838120 1:68249290-68249312 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
909016401 1:70384556-70384578 GGTGTGGTGGTGCAGGCCTTTGG + Intronic
909623432 1:77689943-77689965 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
909832244 1:80207091-80207113 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
910144677 1:84065766-84065788 GTTGTGATTTTGTAGCCCAGAGG + Intergenic
910458568 1:87424281-87424303 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
910593016 1:88947950-88947972 GGTGTGGTGGTGCATGCCTGTGG + Intronic
910849093 1:91633827-91633849 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
910890120 1:92009686-92009708 GGTGTGGTGGTGCATGCCTGTGG - Intronic
910896699 1:92077473-92077495 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
911457056 1:98138691-98138713 TGTGTGATGATTTATGCCAGAGG + Intergenic
911704849 1:100999308-100999330 GGTGTGGTGGCGTATGCCTGTGG + Intronic
912335608 1:108859603-108859625 GGTGTGGTGGTATATGCCTGTGG - Intronic
912353297 1:109035104-109035126 GGCGTGGTGGTGCAGGCCTGAGG + Intronic
912561361 1:110554016-110554038 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
912647726 1:111410923-111410945 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
912772546 1:112478092-112478114 GGTGTGATGGTGCATGCCTGTGG + Intronic
912774235 1:112494505-112494527 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
913298025 1:117340989-117341011 GGAGTCATGGTGAAGGTCAGTGG - Intergenic
914321048 1:146560443-146560465 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
914337959 1:146733086-146733108 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
914348170 1:146817518-146817540 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
914413479 1:147455258-147455280 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
914922526 1:151857113-151857135 GGTGTGGTGGTGTGTGCCTGCGG + Intergenic
915075755 1:153307174-153307196 TCTGTGATGATGTAGGCCACAGG + Exonic
915410716 1:155699751-155699773 GGTGTGGTGGTGTGAGCCTGTGG - Intronic
915422510 1:155795364-155795386 GGTGTGGTGGCGTATGCCTGTGG - Intronic
915641780 1:157233113-157233135 GGTGTGGTGGTGTACACCTGTGG + Intergenic
915780404 1:158543503-158543525 GGTGTGGTGGTGTACGCCTGTGG - Intergenic
915989737 1:160502062-160502084 GGTGTTGTGGTGTGGCCCAGAGG + Intronic
916235487 1:162583765-162583787 GGTGTGGTGGTGCACGCCTGTGG - Intronic
916552174 1:165859685-165859707 GGTGTGGTGGTGCATGCCTGTGG + Intronic
917137693 1:171803327-171803349 GGAGTGATGGAGTAGGACAGAGG + Intronic
917240307 1:172941025-172941047 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
917328285 1:173855790-173855812 GGCGTGATGGTGTGTGCCTGTGG - Intronic
917339964 1:173966000-173966022 GGTGTGGTGGTGCATGCCTGTGG + Intronic
917551904 1:176041486-176041508 GGTGTGGTGGTGCAGGCCTGTGG - Intronic
917855312 1:179094737-179094759 GGTGTGGTGCTGTACGCCTGTGG + Intronic
918095426 1:181330277-181330299 GGGGTGGTGGTGAAAGCCAGAGG - Intergenic
918540540 1:185627186-185627208 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
919106017 1:193151782-193151804 GGTGTGGTGGTGCATGCCAGTGG + Intronic
919393705 1:197019187-197019209 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
919561454 1:199125221-199125243 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
919674972 1:200372637-200372659 GGTGTGGTGGGGTATGCCTGTGG - Intergenic
919683434 1:200458540-200458562 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
920143096 1:203834409-203834431 GGTATGGTGGTGTAGGCCTATGG - Intronic
920214561 1:204352843-204352865 GGTGTGGTGGTGCATGCCTGTGG + Intronic
920630623 1:207648022-207648044 GGTGTGATGTTGCATGCCTGTGG + Intronic
920641413 1:207754979-207755001 GGTGTGATGTTGCATGCCTGTGG + Intronic
920686994 1:208117029-208117051 GGTGTGGTGGTGCATGCCTGTGG + Intronic
921192487 1:212723183-212723205 GGTGTGGTGGTGTACGCCTGTGG - Intergenic
921595749 1:217051901-217051923 GGTGTGGTGGTGTGAGCCTGTGG - Intronic
921678517 1:218004629-218004651 GGTGTGGTGGTGTACACCTGTGG + Intergenic
921918000 1:220634393-220634415 GTTGTGCTGGGGTAGGGCAGGGG - Intronic
921933429 1:220774204-220774226 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
922088075 1:222369849-222369871 GGAGTGATGGTATAGGCTGGAGG - Intergenic
922528156 1:226322240-226322262 GGTGTGGTGATGCATGCCAGTGG - Intergenic
922910392 1:229210923-229210945 GTTGAGATGGTGGAGGGCAGAGG - Intergenic
923004502 1:230036190-230036212 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
923732435 1:236565426-236565448 GGTGTGATGGTGTTAGCCTGTGG - Intronic
923776310 1:236981760-236981782 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
924082107 1:240409279-240409301 GGCGTGGTGGTGTACGCCTGCGG - Intronic
924531268 1:244895849-244895871 AGTGTGGTGGTGCAGGCCAGTGG - Intergenic
1062999201 10:1898706-1898728 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1063353530 10:5377201-5377223 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1063357327 10:5412960-5412982 GGGGTGTTGGTGAGGGCCAGGGG + Intronic
1063376848 10:5559192-5559214 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1063577448 10:7274713-7274735 GGTGTGCTGGTGCATGCCTGTGG + Intronic
1063645539 10:7878865-7878887 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1063700598 10:8380881-8380903 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1063723504 10:8610406-8610428 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1063816409 10:9779200-9779222 TGTGGGATGGTGTAAGCCTGTGG - Intergenic
1063881567 10:10537663-10537685 AGCGTGAGGGTGTGGGCCAGTGG - Intergenic
1063923133 10:10951281-10951303 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1064000319 10:11658410-11658432 GGTGTGGTGGTGCATGCCTGGGG + Intergenic
1064352501 10:14589040-14589062 GGTGTGGTGGTGCATGCCGGTGG + Intronic
1064550958 10:16500387-16500409 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1064742372 10:18446917-18446939 GGTGTGATGGTGTGCACCTGTGG + Intronic
1064830592 10:19461702-19461724 GGTGTGGTGGTGTACACCTGTGG + Intronic
1064869408 10:19920695-19920717 GGTGTGATGGTGCATGCCTGTGG - Intronic
1065001432 10:21341129-21341151 GGTGTGGTGGTGTGTGCCTGCGG - Intergenic
1065005423 10:21375392-21375414 GGAGTGGTGGTGTGGGCCTGTGG + Intergenic
1065058940 10:21877132-21877154 GGTGTGGTGGTGTATGCTTGTGG + Intronic
1065220779 10:23493742-23493764 GGTGTGGTGGTGCATGCCTGAGG - Intergenic
1065231552 10:23603693-23603715 GGTGTGATGGTGTGTGCCTGTGG + Intergenic
1065300039 10:24312773-24312795 GGTGTGATGGTGCAGACCTGTGG + Intronic
1065322255 10:24520704-24520726 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1065449608 10:25843201-25843223 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1065475285 10:26130242-26130264 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1065485034 10:26229052-26229074 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1065526775 10:26630343-26630365 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1065712468 10:28532033-28532055 GGTGTGGTGGTGCATGCCCGTGG + Intergenic
1065729231 10:28695266-28695288 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1065945285 10:30600611-30600633 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1066203350 10:33162868-33162890 GGTGTGATGGTGTGTGCCTATGG - Intergenic
1066325654 10:34355187-34355209 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1066363077 10:34749880-34749902 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1066365962 10:34777263-34777285 GGTGGGATGGTGGAGGGAAGGGG - Intronic
1066373562 10:34837653-34837675 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1066417300 10:35233122-35233144 GTTGTGAGGGTGTCGCCCAGTGG - Intergenic
1066467128 10:35662371-35662393 GGTGTGGTGGTGTATTCCTGTGG + Intergenic
1066629301 10:37443021-37443043 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1066692749 10:38047038-38047060 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1067075355 10:43176702-43176724 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1067099540 10:43324572-43324594 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1067138380 10:43632221-43632243 GGTGTGGTGGTGCATGCCTGGGG + Intergenic
1067173412 10:43925755-43925777 AGTGTGATGGTGCTGGGCAGTGG - Intergenic
1067310573 10:45109679-45109701 GGTGTGATGGTGTGCACCTGTGG - Intergenic
1067377798 10:45743886-45743908 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1067485199 10:46642457-46642479 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1067488179 10:46672456-46672478 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1067606623 10:47669573-47669595 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1067609559 10:47699206-47699228 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1067885498 10:50084568-50084590 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1068048909 10:51923965-51923987 GGTGTGATGGTGCACACCTGTGG - Intronic
1068411334 10:56659983-56660005 GGTGTGGTGGTGGTGGCCATGGG - Intergenic
1069494449 10:68890294-68890316 GGTGTGGTGGTGCAAGCCTGTGG - Intronic
1069673157 10:70227509-70227531 GGCGTGGTGGTGTATGCCTGTGG + Intronic
1069736450 10:70658313-70658335 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1069779732 10:70947325-70947347 GGTGTGATGGTGCATGCCTCTGG + Intergenic
1069927774 10:71863026-71863048 GGTGTCATTGTGGAGGCCAGGGG - Intergenic
1069939809 10:71947580-71947602 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1069986479 10:72287656-72287678 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1069995403 10:72339125-72339147 GGTGTGGTGGTGTGGGCCTGTGG + Intronic
1070055144 10:72927277-72927299 GGTGTGGTGGTATATGCCTGTGG - Intronic
1070143654 10:73757770-73757792 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1070227432 10:74524530-74524552 GGTGTGTTGGTGTGTGCCTGTGG - Intronic
1070268061 10:74923934-74923956 GATATGATGGTTTAGGCCAGTGG + Intronic
1070544059 10:77438934-77438956 GGGGTGATGGTGCATGCCTGTGG + Intronic
1070795234 10:79212444-79212466 GGTGTGATGGTGTAGGCCAGTGG - Intronic
1070868534 10:79726420-79726442 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1070904156 10:80056991-80057013 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1071028315 10:81141505-81141527 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1071342153 10:84659144-84659166 GCTGTGATGGTGAAGGTCAAAGG - Intergenic
1071625149 10:87160849-87160871 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1071635448 10:87248626-87248648 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1071659792 10:87489345-87489367 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1071944552 10:90628099-90628121 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1072104951 10:92265020-92265042 GGTGTGATGGTGTGCGCCTGTGG + Intronic
1072284098 10:93896128-93896150 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1072616452 10:97052234-97052256 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1072918988 10:99559629-99559651 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1072948214 10:99829764-99829786 GGTGTGATGGTGCATGCCTGTGG - Intronic
1073039828 10:100596020-100596042 GGCGTGGTGGTGTATGCCTGTGG + Intergenic
1073104524 10:101024639-101024661 GGTGTAGTGGTGTATGCCTGTGG + Intronic
1073198769 10:101717612-101717634 GGTGTGGTGGTGTGTGCCAGTGG - Intergenic
1073220418 10:101867690-101867712 GGTGTGATGGTGCATGCCTGTGG + Intronic
1073249247 10:102111709-102111731 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1073307367 10:102514022-102514044 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1073346580 10:102787446-102787468 GGTGTGGTGGCGTATGCCTGTGG + Intronic
1073370172 10:102981208-102981230 GGTGTGATGGCGTGTGCCTGTGG + Intronic
1073449229 10:103599989-103600011 GGTGTGGTGGGGTAGGGTAGGGG + Exonic
1073534051 10:104258712-104258734 GGTGTGATGGTGCACGCCTGTGG + Intronic
1073538003 10:104295380-104295402 GGTGTGAAGGTGTAGGCTTTAGG + Intronic
1073914383 10:108385555-108385577 GGAGAGATTGTTTAGGCCAGGGG + Intergenic
1074960740 10:118443105-118443127 GGTGTGGTGGTGTGTGCCAGTGG + Intergenic
1075039357 10:119095533-119095555 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1075249978 10:120859405-120859427 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1075446637 10:122517964-122517986 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1075692226 10:124404902-124404924 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1075725596 10:124609210-124609232 GTTGCTATTGTGTAGGCCAGAGG - Intronic
1075862240 10:125686578-125686600 GGTGAGCTCTTGTAGGCCAGGGG + Intergenic
1076047325 10:127304740-127304762 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1076573851 10:131451098-131451120 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1077127928 11:952006-952028 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1077301214 11:1847848-1847870 GGTGTGGTGGTGTATGTCTGTGG + Intergenic
1077487441 11:2845594-2845616 GGTCTGACGGTCCAGGCCAGAGG - Intronic
1077602844 11:3585547-3585569 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1077656131 11:4020734-4020756 GGTGTGGTGGTTTATGCCTGTGG - Intronic
1077949476 11:6940442-6940464 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1078173752 11:8952548-8952570 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1078218557 11:9332499-9332521 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1078629373 11:12988306-12988328 GGTGTGATGGTGCACACCTGTGG - Intergenic
1078769927 11:14339977-14339999 GGTGTGGTGGTGCAGGCCAGTGG + Intronic
1078871385 11:15348400-15348422 GCTGTGTTGGTGCAGGCCTGTGG + Intergenic
1079122636 11:17696312-17696334 TGTGTGATGGTGTGGTCCGGGGG + Intergenic
1079168189 11:18066535-18066557 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1080327924 11:31099856-31099878 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1080376521 11:31719117-31719139 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1080500256 11:32863875-32863897 GGTGTGGTGGTGTACGCCTGTGG - Intergenic
1080652451 11:34233488-34233510 GGTGTGGTGGTGTACCCCTGTGG - Intronic
1080661714 11:34301845-34301867 GGTGTGGTGGTGTATGCCTGTGG + Intronic
1081568277 11:44273811-44273833 GGCGTGGTGGTGTATGCCTGTGG + Intronic
1081604098 11:44516235-44516257 GGTGTGATAGTGTGTGCCTGTGG + Intergenic
1081633136 11:44702854-44702876 TGTGTGCTGGTGGAGGCCAGAGG + Intergenic
1082009866 11:47442603-47442625 GATGAGGTGGTGTGGGCCAGGGG - Intronic
1082069476 11:47927318-47927340 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1082090153 11:48082381-48082403 GGTATGGTGGTGTAAGCCTGTGG - Intronic
1082709216 11:56533093-56533115 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1083185467 11:61015429-61015451 GGCGTGATGGTGCATGCCTGTGG + Intronic
1083231188 11:61321022-61321044 GGGGTGATGGTGCATGCCTGTGG - Intronic
1083670006 11:64294376-64294398 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1083694500 11:64433678-64433700 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1083744964 11:64730247-64730269 AGTGGGATGGGTTAGGCCAGCGG - Intronic
1083889302 11:65588071-65588093 GCTGTGATGGGGGAGGCCATGGG + Intronic
1084017613 11:66395000-66395022 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1084052124 11:66606728-66606750 GGTGTGATGGTGCATGCTTGTGG + Intergenic
1084180239 11:67442462-67442484 GCGGTGATTGTGGAGGCCAGTGG - Exonic
1084187389 11:67481749-67481771 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1084222602 11:67693204-67693226 GGTGTGGTGGCGTGGGCCTGTGG + Intergenic
1084258726 11:67960082-67960104 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1084318913 11:68362549-68362571 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1084434360 11:69130230-69130252 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1084814018 11:71635098-71635120 GGTGTGGTGGTGTATGCCTGTGG - Intergenic
1084835795 11:71801074-71801096 GGTGGGACTGTGTTGGCCAGAGG - Exonic
1085139402 11:74127145-74127167 GGTGTGGTGGCGTATGCCTGTGG - Intronic
1085178197 11:74508939-74508961 GGTGTGATGGTGCATGCCTGTGG + Intronic
1085564446 11:77500702-77500724 GGTGTGATGATGCATGCCTGTGG + Intergenic
1085635583 11:78156964-78156986 GGTGGGATAGTGCAGGGCAGTGG + Intergenic
1085669184 11:78445818-78445840 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1085701589 11:78751017-78751039 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1085713641 11:78852887-78852909 GGTGCGATGGTGCATGCCTGCGG - Intronic
1085886549 11:80529428-80529450 GGTGGGATGGAGCAGGACAGTGG + Intergenic
1086103461 11:83125834-83125856 GGCGTGATGGTGCAGGCCTGTGG - Intergenic
1086106503 11:83153546-83153568 GGTGTAGTGGTGCAGGCCTGTGG + Intergenic
1086468882 11:87085615-87085637 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1087080050 11:94161957-94161979 GGTGTGTTGGAGTTTGCCAGAGG + Intronic
1087114957 11:94514782-94514804 GGCGTGATGGTGCATGCCTGTGG - Intergenic
1087970420 11:104474161-104474183 GGAGTGATGGTGTGTGCCTGTGG + Intergenic
1088230926 11:107672532-107672554 GGTGTGGTGGTGGATGCCTGTGG - Intergenic
1088355800 11:108942673-108942695 GGTGTGGTGGTGCATACCAGTGG + Intergenic
1088854944 11:113740442-113740464 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1089241924 11:117088814-117088836 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1089248399 11:117138803-117138825 GGTGAGAAGGTGTTGGACAGGGG + Intergenic
1089258307 11:117205758-117205780 GGTGAGAAGGTGTTGGACAGGGG - Exonic
1089283419 11:117390494-117390516 GGTTTGATGGTGCATGCCTGTGG + Intronic
1089435341 11:118460424-118460446 GGTGTGCTGGTGCATGCCTGTGG - Intronic
1089785666 11:120905213-120905235 CGTGTGATGGGGAGGGCCAGGGG - Intronic
1090373396 11:126272430-126272452 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1090786775 11:130056266-130056288 GGTGTAATGGTGCATGCCTGTGG - Intergenic
1090792653 11:130105274-130105296 GGTGTGATGGCGCATGCCTGTGG + Intronic
1090851010 11:130570695-130570717 GGTGGGATGGGGTGGGTCAGGGG - Intergenic
1091138830 11:133217904-133217926 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1091423552 12:365190-365212 GGTATGGTGGTGTGCGCCAGTGG - Intronic
1091488855 12:915852-915874 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1091589574 12:1835295-1835317 GGCATGATGGCGTCGGCCAGGGG - Exonic
1091751548 12:3024515-3024537 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1092006286 12:5073260-5073282 GGTGTGATGGTCGGGGCAAGAGG - Intergenic
1092190954 12:6520380-6520402 GGTGTAATGGTGTGTGCCTGTGG - Intronic
1092190958 12:6520402-6520424 GGTGTGATGGTGTGTGCCTGTGG - Intronic
1092190962 12:6520424-6520446 GGTGTGATGGTGTGTGCCTGTGG - Intronic
1092190966 12:6520446-6520468 GGTGTGATGGTGTATGCCTGTGG - Intronic
1092190970 12:6520468-6520490 GGTGTGATGGTGTGTGCCTGTGG - Intronic
1092205154 12:6610300-6610322 GGTGTGGTGGTGTATGCCCGTGG - Intergenic
1092313824 12:7388602-7388624 GGTGTGATGGCGCATGCCAGTGG + Intronic
1092407528 12:8231329-8231351 GGTGGGACTGTGTTGGCCAGAGG + Intergenic
1092430058 12:8401079-8401101 GGTGTGGTGGTGTATGTCTGTGG + Intergenic
1093025968 12:14245788-14245810 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1093683768 12:22032631-22032653 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1093793613 12:23285418-23285440 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1093904501 12:24674183-24674205 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1093935979 12:25001303-25001325 AGTGTGATGGTGCACGCCTGTGG + Intergenic
1094107430 12:26829478-26829500 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1094193585 12:27721947-27721969 GGTGTGATGGCGCATGCCTGTGG + Intronic
1094649834 12:32364809-32364831 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1094822734 12:34239356-34239378 GGTGTGGTGGTGCAGGCCTGTGG - Intergenic
1094840992 12:34342682-34342704 GGTGGCATGGGGGAGGCCAGGGG - Intergenic
1095440362 12:42233649-42233671 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1095449685 12:42317067-42317089 GGTGTGATGGTGCATGCCTGTGG + Intronic
1095594613 12:43944969-43944991 GGCGTGGTGGTGTAGGCCTGTGG + Intronic
1095767960 12:45917641-45917663 GGTGTGGTGGTGTATACCTGTGG - Intergenic
1095821937 12:46487798-46487820 GGAGTGATGGTTAAGGCCACAGG - Intergenic
1095973046 12:47917865-47917887 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1096064387 12:48727909-48727931 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1096087537 12:48875794-48875816 GGTGTGCTGGTGCATGCCTGTGG - Intergenic
1096122614 12:49097914-49097936 GGAGTGAGGGTGCAGGCTAGTGG - Intronic
1096355221 12:50935626-50935648 GGTGTGCTGGTGCATGCCTGTGG - Intergenic
1096483169 12:51956897-51956919 GGTGTGGTGGTGTACACCTGAGG - Intronic
1096988232 12:55776292-55776314 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1097123614 12:56755185-56755207 GGTGTGGTGGCGCAGGCCTGTGG + Intronic
1097409278 12:59230368-59230390 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1097666221 12:62480423-62480445 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1097798903 12:63891197-63891219 GGTGTGGCGGTGAAGGCCACTGG - Intronic
1097818576 12:64103117-64103139 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1097868666 12:64581577-64581599 GGTATGGTGGTGTATGCCTGCGG + Intergenic
1097997894 12:65909875-65909897 GGTGTGAATGTGGAAGCCAGAGG - Intronic
1098089699 12:66888193-66888215 GGTGTGATGGTGTGCGCCTGTGG - Intergenic
1098272872 12:68785932-68785954 GGTATGATGGTGTGAGCCTGTGG + Intronic
1098336143 12:69406952-69406974 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1098895945 12:76060951-76060973 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1099206987 12:79739957-79739979 GGTGTGATGGTATGCGCCTGTGG - Intergenic
1099226948 12:79981062-79981084 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1099299049 12:80868426-80868448 GGTGTGATGGCGCATGCCTGTGG + Intronic
1099449333 12:82790060-82790082 GGTGTGGTGATGTATGCCTGTGG + Intronic
1099754329 12:86824048-86824070 GGTAGGATGGTGCAGGACAGTGG - Intronic
1100300711 12:93305052-93305074 GGTGTGGTGATGTATGCCTGTGG + Intergenic
1100368371 12:93942567-93942589 GCTGTGTTGGCCTAGGCCAGGGG + Intergenic
1100659603 12:96682513-96682535 GGTGTGGTGGTGTGAGCCTGTGG - Intronic
1101601736 12:106215590-106215612 GGTGGGTTGGTGGAAGCCAGTGG + Intergenic
1101734078 12:107449784-107449806 AGTGTGGTGGTGTAGGCCTGTGG - Intronic
1101882116 12:108632652-108632674 GGTGTAGTGGTGTATGCCTGTGG - Intronic
1101916186 12:108897805-108897827 GGCGTGATGGTGTATGCCTATGG + Intronic
1102055755 12:109895347-109895369 GGTGTGATGGTGCACACCTGTGG - Intergenic
1102065408 12:109970927-109970949 TGTGTGATGGTGCATGCCTGTGG - Intronic
1102162495 12:110781074-110781096 GGTGTTTTGGTGTATGCCTGTGG + Intergenic
1102256819 12:111420226-111420248 GGCGTGGTGGTGTACGCCTGTGG + Intronic
1102292201 12:111710225-111710247 GGTGTGGTGGTGTATGCCTCTGG - Intronic
1102365019 12:112325934-112325956 AGTGTGGTGGTGCAGGCCTGTGG - Intronic
1102872775 12:116426943-116426965 GGCATGATGGTGTGGGCCTGTGG + Intergenic
1102900690 12:116634173-116634195 GGTGTGATGGCACAGGCCTGTGG - Intergenic
1103000759 12:117383770-117383792 GGCATGATGGTGTATGCCTGTGG - Intronic
1103039894 12:117686186-117686208 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1103061139 12:117859594-117859616 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1103070184 12:117934963-117934985 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1103140342 12:118542540-118542562 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1103170924 12:118819195-118819217 TGTGTGATGGTGCATGCCCGTGG + Intergenic
1103258203 12:119561575-119561597 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1103365411 12:120378892-120378914 GGTGTGGTGGTGTGAGCCTGTGG + Intergenic
1103529920 12:121593990-121594012 GGTGTGATGGTGGGCGCCTGTGG - Intergenic
1103584140 12:121938459-121938481 GGTGTGGTGGTGTACACCTGTGG - Intronic
1103654090 12:122456650-122456672 GGTGTGGTGGTGTGCGCCTGTGG + Intergenic
1103710744 12:122910728-122910750 GGCGTGGTGGTGTATGCCTGTGG - Intergenic
1103805979 12:123573384-123573406 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1103818658 12:123679499-123679521 GGTGTGATGGTTCATGCCTGTGG - Intronic
1103959503 12:124600088-124600110 GGTAAGATGGAGGAGGCCAGAGG + Intergenic
1103992243 12:124807059-124807081 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1104006402 12:124895858-124895880 GGTGTGATGGTGTGTGCTTGTGG + Intergenic
1104209198 12:126671031-126671053 GGTGTGATGGTGCATTCCTGTGG + Intergenic
1104236932 12:126947976-126947998 GGTGTGTTGGTGCAGGCCTGCGG - Intergenic
1104270689 12:127280091-127280113 GGTGTGATGGTTCAGGCCTGTGG + Intergenic
1104323401 12:127773220-127773242 GGCATGATGGTGTGGGCCTGTGG + Intergenic
1104684998 12:130779085-130779107 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1104904690 12:132206923-132206945 GGTGTGGTGGTGCATGCCTGCGG + Intronic
1104995306 12:132650473-132650495 GGTGTGGTTGTGTGGGCCTGTGG + Intronic
1105367216 13:19776324-19776346 GGTGTGGTGGTGTGTGCCTGCGG + Intronic
1105410833 13:20169857-20169879 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1105456959 13:20549788-20549810 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1105838846 13:24235615-24235637 GGTGTGGTGGTGCAAGCCTGTGG + Intronic
1106065543 13:26344625-26344647 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1106090528 13:26588935-26588957 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1106239039 13:27894087-27894109 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1106474551 13:30087168-30087190 AGTGTGATGGTGTGTGCCTGTGG + Intergenic
1106669475 13:31889240-31889262 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1106711260 13:32336019-32336041 GGTGTGGTGGTGTATGCCTGTGG - Intronic
1107036296 13:35905806-35905828 GGTGTGGTGGTGTGGGACTGTGG + Intronic
1107361698 13:39625174-39625196 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1107859396 13:44646601-44646623 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1108299521 13:49060502-49060524 GGTGTGGTGGCATATGCCAGTGG + Intronic
1108303550 13:49106450-49106472 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1108474855 13:50804581-50804603 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1109059343 13:57594091-57594113 GGCATGATGGTGCAGGCCTGTGG - Intergenic
1110446000 13:75581487-75581509 GGTGTGATGGTACATGCCTGTGG - Intronic
1110460148 13:75736026-75736048 GGTTTGTTGTTGTTGGCCAGTGG + Intronic
1110573507 13:77030790-77030812 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1110963823 13:81665712-81665734 GGTGCAATGGTGTAGAGCAGTGG + Intergenic
1111564512 13:89997444-89997466 GGTGTGGTGGTGTGAGCCTGTGG - Intergenic
1111853221 13:93603147-93603169 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1111924513 13:94448105-94448127 GGTGTGATAGTGTGTGCCTGTGG + Intronic
1111957304 13:94773734-94773756 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1112016403 13:95334969-95334991 GGTGTGATGGTGCACACCTGTGG + Intergenic
1112361651 13:98724362-98724384 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1112645637 13:101328449-101328471 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1113161015 13:107381338-107381360 GGTGTAGTGGTGCATGCCAGTGG - Intronic
1113443929 13:110351186-110351208 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1113614320 13:111670191-111670213 GGTCTGATGGTGATGGCTAGAGG - Intronic
1113619788 13:111755105-111755127 GGTCTGATGGTGATGGCTAGAGG - Intergenic
1113871683 13:113563763-113563785 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1114070301 14:19099894-19099916 GGTGTGGTGGTGCGGGCCTGTGG + Intergenic
1114091960 14:19300108-19300130 GGTGTGGTGGTGCGGGCCTGTGG - Intergenic
1114195926 14:20476111-20476133 GGTGTGGTAGTGTACGCCTGTGG - Intronic
1114301731 14:21384703-21384725 AGTGGGATGGTGTAAGTCAGAGG + Intergenic
1114320234 14:21541132-21541154 GGTGTGGTGGCGCATGCCAGTGG + Intergenic
1114502294 14:23179667-23179689 GGTGTCGTGGTGTATGCCTGTGG + Intronic
1115220197 14:31051114-31051136 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1115353766 14:32425448-32425470 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1115578174 14:34731434-34731456 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1115670807 14:35609780-35609802 GGTGTGATGGTGCACACCAGTGG + Intronic
1115995387 14:39190325-39190347 GGTGTGATGGTGCAGGCCTGTGG - Intergenic
1116169670 14:41384240-41384262 ACTGTGATGGTGGAGGCAAGAGG + Intergenic
1116638129 14:47424281-47424303 GGTGTGATGGTTTGTGCCTGTGG + Intronic
1116830395 14:49713745-49713767 GGTGTGGTGGCGTACGCCTGTGG + Intronic
1116903418 14:50382731-50382753 GGTGTGGTGGTGTGCACCAGTGG - Intronic
1117017232 14:51530618-51530640 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1117131681 14:52693627-52693649 GGTGTGATGGTGTGCGCCTGTGG - Intronic
1117330484 14:54707241-54707263 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1117492833 14:56269301-56269323 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1117544363 14:56780088-56780110 GATGTGATGGTGCATGCCTGTGG + Intergenic
1117593594 14:57303189-57303211 GGTGTGGTGGTGTGAGCCTGTGG + Intergenic
1117804586 14:59478442-59478464 GGTGTGATGGGGCATGCCTGTGG + Intronic
1117961161 14:61163429-61163451 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1118017862 14:61678763-61678785 GGTGTGGTGGAGTGGGCCTGAGG + Intergenic
1118202843 14:63693066-63693088 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1118239384 14:64041708-64041730 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1118245779 14:64109013-64109035 GGCGTGATGGTGTGTGCCTGTGG - Intronic
1118348901 14:64959731-64959753 GGTGTGATGGTGTCCACCTGTGG + Intronic
1118349265 14:64961767-64961789 GGTGTGGTGGTATATACCAGTGG + Intronic
1118570847 14:67194222-67194244 GGTGTGATGGCACAGGCCTGTGG + Intronic
1118776027 14:68974536-68974558 TGTGTGATGTTGTAGGACAGAGG - Intronic
1118990807 14:70795446-70795468 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1119218243 14:72885541-72885563 GGTGTGGTGGTGTACACCTGTGG - Intronic
1119296123 14:73534547-73534569 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1119300062 14:73564464-73564486 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1119356747 14:74013605-74013627 GGAGAGATGGTGTAGACCAGGGG - Intronic
1119429527 14:74557120-74557142 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1119603327 14:75992683-75992705 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1119653889 14:76402928-76402950 GGTGTGATGGTGTATGCCTGTGG - Intronic
1119804414 14:77473544-77473566 GGTGTGGTGGCGTGGGCCTGTGG + Intergenic
1119825942 14:77657120-77657142 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1119949134 14:78726656-78726678 GGTGTGATGGTACATGCCTGTGG - Intronic
1120202973 14:81557923-81557945 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1120291648 14:82580943-82580965 TGTGTGGTGGTGAGGGCCAGGGG + Intergenic
1120779372 14:88472728-88472750 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1120801093 14:88689592-88689614 GGTATGGTGGTGTACGCCTGTGG + Intronic
1120888842 14:89473513-89473535 GGTATGATGGTGTGCGCCTGTGG - Intronic
1121138696 14:91521881-91521903 GGTGTGGTGGTACAGGCCTGTGG - Intergenic
1121266637 14:92607474-92607496 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1121354414 14:93201785-93201807 GGTGTGCTGGTGCATGCCTGTGG + Intronic
1121752243 14:96366818-96366840 GGTGAGAGGCTGTATGCCAGAGG + Intronic
1122207085 14:100153114-100153136 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1122308829 14:100782033-100782055 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1122338296 14:101007975-101007997 GGTGTGTTGGTGCATGCCTGCGG + Intergenic
1122343151 14:101041835-101041857 GGTGTCATGGTGTGCGCCTGTGG + Intergenic
1122427854 14:101622141-101622163 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1122495156 14:102148398-102148420 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1122521294 14:102345628-102345650 GGTGTCATGGTGCATGCCTGTGG - Intronic
1122866308 14:104605727-104605749 AGTGTGATGGGGTAGGGGAGGGG - Intergenic
1122951310 14:105046728-105046750 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1123687402 15:22808807-22808829 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1123910438 15:24960477-24960499 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1124006042 15:25796263-25796285 GGTGTGGTGGTGTACCCCTGTGG + Intronic
1124009347 15:25824332-25824354 GGTGTGATGGTGTACACTTGTGG + Intronic
1124218025 15:27825554-27825576 GGAGTGATGGTGTGGGTCACAGG + Intronic
1124250448 15:28103658-28103680 GGTGTGTTGGTGTAACCCATGGG + Intergenic
1124267695 15:28251658-28251680 GGCGTGGTGGTGTACGCCTGTGG + Intronic
1124357334 15:29005398-29005420 GGTGTGGTGGTGTGTGCCTGAGG - Intronic
1124911035 15:33920913-33920935 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1125014422 15:34917842-34917864 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1125018555 15:34962159-34962181 GGTATGGTGGTGTATGCCTGTGG - Intronic
1125596653 15:40891558-40891580 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1125631868 15:41153886-41153908 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1125838863 15:42779267-42779289 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1125860658 15:42996455-42996477 GGTGTGGTGGTGTAAGCCTGTGG + Intronic
1126146831 15:45482277-45482299 GGTGTGGTGGTGCATGCCTGTGG + Exonic
1126159430 15:45596335-45596357 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1126410805 15:48371249-48371271 GGTGTGATGGTGCACACCTGTGG - Intergenic
1126521494 15:49600512-49600534 GGTGTGGTGGTGTCTGCCTGTGG + Intronic
1126847701 15:52776589-52776611 GGTGTGTTGGTGCAGCCCAAAGG - Intronic
1127062996 15:55206479-55206501 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1127475724 15:59330907-59330929 GGCGTGATGGTGCATGCCTGTGG - Intronic
1127585929 15:60377946-60377968 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1127876371 15:63114936-63114958 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1127876805 15:63118791-63118813 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1127949193 15:63787823-63787845 GGCGTGGTGGTGTATGCCTGTGG + Intronic
1127987949 15:64089386-64089408 GGTGTAGTGGTGCAGGCCTGTGG + Intronic
1128086411 15:64889580-64889602 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1128102620 15:65015696-65015718 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1128189669 15:65679668-65679690 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1128451480 15:67808182-67808204 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1128461602 15:67872668-67872690 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1128473882 15:67980436-67980458 GGTTTGGTGGTGTATGCCTGTGG + Intergenic
1128486072 15:68090340-68090362 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1128583519 15:68826599-68826621 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1128858600 15:71044644-71044666 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1128926561 15:71661533-71661555 GGTGTGTTGGTGCACGCCTGTGG - Intronic
1129185209 15:73901949-73901971 GGTGAGGTGGTGTATGCCTGTGG - Intergenic
1129304455 15:74649030-74649052 GGTGTGATGGTATGTGCCTGTGG - Intronic
1129364513 15:75046072-75046094 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1129395580 15:75243665-75243687 GGTGTGGTGGTGCACGCCCGTGG + Intergenic
1129614324 15:77085853-77085875 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1129754573 15:78089658-78089680 GGTGTGGTGGTGTACACCTGTGG - Intronic
1130111489 15:80969049-80969071 GGTGTGATGGTGCACACCTGTGG + Intronic
1130360281 15:83178522-83178544 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1131421657 15:92311365-92311387 GGTGTGGTGGCGCAGGCCTGTGG - Intergenic
1132062341 15:98702796-98702818 GGTGTTATGGTGTACCCCTGTGG + Intronic
1132250084 15:100329393-100329415 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1132396103 15:101475623-101475645 AGTGTGGTGGTGTACGCCTGTGG - Intronic
1132401653 15:101511753-101511775 GGTGTCATGGTGCATGCCTGTGG + Intronic
1132575382 16:661509-661531 GGAGGGAGGGTGGAGGCCAGGGG + Intronic
1132589058 16:718421-718443 GGGGTGGGGGTGGAGGCCAGAGG + Exonic
1132620246 16:862716-862738 GGCGTGGTGGTGTGGGCCTGTGG + Intronic
1132712276 16:1274358-1274380 GGCATGGTGGTGTAGGCCTGTGG - Intergenic
1132752202 16:1463611-1463633 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1132754493 16:1475954-1475976 GGTGTGGTGGTGCAGGCCTGTGG - Intergenic
1132774733 16:1586844-1586866 GGTGTGATGGTGTACAGCGGTGG - Intronic
1132797259 16:1731187-1731209 AGTGTGATGGTGCATGCCTGTGG + Intronic
1132956180 16:2594981-2595003 GGCATGGTGGTGTATGCCAGTGG + Intronic
1133004801 16:2873829-2873851 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1133105289 16:3503728-3503750 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1133192761 16:4146673-4146695 GATGTGATGGTGCACACCAGTGG - Intergenic
1133405322 16:5519583-5519605 GGTGTGGTGGTGTATACCTGTGG + Intergenic
1133515441 16:6504330-6504352 TGTCTGATGGTGAAGGGCAGGGG - Intronic
1133740876 16:8650282-8650304 GCTGTGAGGGTGTAGTGCAGTGG - Intergenic
1133772474 16:8875301-8875323 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1134027766 16:10967508-10967530 GGTGTGATGGTGTGCACCTGTGG - Intronic
1134066113 16:11229492-11229514 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1134115244 16:11543199-11543221 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1134176439 16:12010484-12010506 GGTGCGGTGGTGCAGGCCTGTGG + Intronic
1134319051 16:13146046-13146068 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1134324635 16:13195946-13195968 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1134458415 16:14411347-14411369 GGTGTGATGGTGTGCACCTGTGG + Intergenic
1134478770 16:14599180-14599202 GGTGTGGTGGTATATGCCTGTGG - Intronic
1134562441 16:15222201-15222223 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1134595202 16:15490420-15490442 GGTGTGGTGGCATATGCCAGTGG - Intronic
1134681248 16:16127344-16127366 GGTGTGATGGCATATGCCCGTGG - Intronic
1134802226 16:17095748-17095770 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1134922983 16:18133828-18133850 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1135072703 16:19366016-19366038 GGTGTGATGGTGCACACCTGTGG + Intergenic
1135078398 16:19413382-19413404 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1135133275 16:19869933-19869955 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1135278389 16:21133212-21133234 GGTGTGGTGGTGTGGGTCTGTGG + Intronic
1135287611 16:21207697-21207719 GGTGTGGTGGTATATGCCTGTGG + Intronic
1135581784 16:23633841-23633863 GGTGTGGTGGTATATGCCTGTGG - Intronic
1135627848 16:24011654-24011676 GGTGTGGTGGTGTATGCCTGTGG - Intronic
1135730995 16:24894983-24895005 GGTGTGGTGGTGTATGCCTGTGG + Intronic
1135784079 16:25332329-25332351 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1135824337 16:25713386-25713408 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1135827968 16:25746986-25747008 GGTGTGATGGTGCACACCTGTGG - Intronic
1135859351 16:26041200-26041222 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1136221041 16:28829140-28829162 GGTGTGGTGGTGCATGCCTGGGG - Intronic
1136401326 16:30020880-30020902 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1136466941 16:30450824-30450846 GGTGTGAGGGTGGTGGCCATAGG - Intergenic
1136536118 16:30900655-30900677 GGCGTGGTGGTGTATGCCTGTGG + Intronic
1137440421 16:48494056-48494078 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1137619313 16:49866249-49866271 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1137667138 16:50257880-50257902 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1137738890 16:50745516-50745538 GGTGTGGTGGTGTCTGCCTGTGG - Intronic
1137813469 16:51375535-51375557 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1138174219 16:54882100-54882122 GGTGTGATGGTGCATGCCTATGG + Intergenic
1138413037 16:56854619-56854641 GGAGTGATGAAGTAGGCCTGTGG + Intergenic
1138568792 16:57854079-57854101 GGTGTGATGGTGTGCACCTGTGG - Intronic
1138697999 16:58833649-58833671 GGTGTGATAGTGTGTGCCTGTGG - Intergenic
1139167367 16:64583255-64583277 GGTGTGGTGGTGAATGCCTGTGG + Intergenic
1139412083 16:66770988-66771010 GGTGTGGTGTTGTATGCCTGTGG - Intronic
1139439805 16:66960629-66960651 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1139494636 16:67307451-67307473 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1139604769 16:68010268-68010290 GGTGTGGTGGTGAATGCCTGTGG - Intronic
1139715923 16:68813075-68813097 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1139734739 16:68977823-68977845 GGCGTGGTGGTGTGGGCCTGTGG - Intronic
1139789248 16:69419198-69419220 GGTGTGATGGTGGGAGCCTGTGG + Intergenic
1139985867 16:70898027-70898049 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1139996320 16:70984250-70984272 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1140065822 16:71610358-71610380 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1140377361 16:74455260-74455282 GCTGAGATGGTGTGGCCCAGAGG + Intronic
1140384498 16:74522821-74522843 GGTGTGGTGATGCAGGCCTGTGG - Intronic
1140428247 16:74879216-74879238 GGCATGATGGTGTATGCCTGTGG + Intronic
1140445022 16:75019862-75019884 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1140486310 16:75296375-75296397 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1140679527 16:77371073-77371095 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1140843550 16:78864900-78864922 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1141049380 16:80746698-80746720 GGTGTGAGGGTGTGGGGCAGGGG + Intronic
1141063865 16:80898596-80898618 GGTGTGATGGTGTGCACCTGTGG - Intergenic
1141510348 16:84507834-84507856 GGTGTGGTGGGGTACGCCGGTGG - Intronic
1141515471 16:84541464-84541486 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1141708974 16:85687079-85687101 GGTGTGGTGGCGCACGCCAGTGG + Intronic
1141770076 16:86084634-86084656 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1141966686 16:87449903-87449925 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1142317720 16:89358963-89358985 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1142318967 16:89368764-89368786 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1142652833 17:1367452-1367474 GGTGTGGTGGTGTGTGCCTGCGG + Intronic
1143051350 17:4128597-4128619 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1143094617 17:4471603-4471625 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1143131292 17:4679163-4679185 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1143384046 17:6516031-6516053 GGTGTGGTAGTGCAGGCCTGTGG + Intronic
1143472281 17:7183338-7183360 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1143505304 17:7361246-7361268 GGTGTGATGGCGCATGCCTGTGG + Intergenic
1143557715 17:7672662-7672684 GGTATGGTGGTGTATGCCTGTGG + Intronic
1143575504 17:7790360-7790382 GGTGTGATGGCGCACGCCTGCGG - Intronic
1143783563 17:9241487-9241509 GGTGTGAGGATGTGGGCCAGAGG - Exonic
1144113255 17:12060036-12060058 CGTGTGATGGTGTGCGCCTGTGG + Intronic
1144726135 17:17503685-17503707 GGTGTGAGGGTGAAGCGCAGGGG + Intergenic
1144891114 17:18494844-18494866 GGTCAGTTGGTGGAGGCCAGTGG - Exonic
1145141110 17:20449474-20449496 GGTCAGTTGGTGGAGGCCAGTGG + Intronic
1145282077 17:21475520-21475542 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1145794817 17:27649459-27649481 GGTCAGGTGGTGGAGGCCAGTGG - Exonic
1145809311 17:27755178-27755200 GGTCAGTTGGTGGAGGCCAGTGG - Intergenic
1145841654 17:28000189-28000211 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1145899214 17:28479072-28479094 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1145987803 17:29059077-29059099 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1146006044 17:29161385-29161407 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1146175800 17:30665837-30665859 GGTGTGATAGTGTATACCTGTGG - Intergenic
1146180146 17:30692975-30692997 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1146196387 17:30816627-30816649 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1146289110 17:31595523-31595545 GGTGTGGTGGTGTTCGCCTGTGG - Intergenic
1146325660 17:31883814-31883836 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1146326428 17:31890134-31890156 GGCGTGATGGTGTATGCATGTGG - Intronic
1146349252 17:32081942-32081964 GGTGTGATAGTGTATACCTGTGG - Intergenic
1146675248 17:34768846-34768868 GGTGTGGTGGTGCAGGTGAGAGG - Intergenic
1147028560 17:37610261-37610283 GGTGTGGTGGTGCATGCCTGTGG - Exonic
1147154151 17:38534990-38535012 AGTGTGATGGTGTGTGCCTGTGG + Intronic
1147158676 17:38558557-38558579 GGTGGGATGGCGAAGGGCAGGGG + Intronic
1147174295 17:38643568-38643590 GGTGTGGTGGTGCAAGCCTGTGG + Intergenic
1147213041 17:38883238-38883260 AGTGTGGTGGTGTGGGCCTGTGG + Intronic
1147283224 17:39379837-39379859 GGTGTGGTGGTATATGCCTGTGG + Intronic
1147354629 17:39885035-39885057 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1147416994 17:40299285-40299307 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1147444334 17:40465736-40465758 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1147603804 17:41762533-41762555 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1147884325 17:43674645-43674667 GGTGTGATGGTGCACACCTGTGG - Intergenic
1147955570 17:44132138-44132160 GGAGTGATGGTTCAGGCCTGTGG + Intergenic
1148040360 17:44701994-44702016 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1148088799 17:45010255-45010277 AGTCTGATGGGGGAGGCCAGAGG + Intergenic
1148207243 17:45786778-45786800 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1148264333 17:46213245-46213267 GCTGTGATGGAGAAGGCAAGGGG + Intronic
1148440254 17:47708512-47708534 GGTGAGATGGGGCAGGGCAGGGG + Exonic
1148473455 17:47911084-47911106 GGTGTGGTGGTGTGCACCAGTGG + Intronic
1148531240 17:48394479-48394501 GGTGTGGTGGTATATGCCTGTGG - Intronic
1148600008 17:48887120-48887142 GGTGTGATGGTGTATGCCTGTGG + Intergenic
1148656834 17:49290557-49290579 GATGTGATGGTGGTGGCCTGCGG + Intronic
1149126151 17:53235871-53235893 AGTGTGATGGTGTGAGCCTGTGG + Intergenic
1149431604 17:56598486-56598508 GTTGAGATGGAGAAGGCCAGGGG + Intergenic
1149444912 17:56705860-56705882 GGTGTGGTGGTGTACGCCTGTGG - Intergenic
1149471796 17:56923073-56923095 GATGTGCTGGTGTACGCCAGTGG - Intergenic
1149657316 17:58317054-58317076 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1149708024 17:58713478-58713500 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1149796873 17:59528995-59529017 GGTGTGGTGGTGCAAGCCTGTGG - Intergenic
1149892492 17:60402388-60402410 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1149905110 17:60519099-60519121 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1149911226 17:60568810-60568832 GGTGTTGTGGTGTGGGCCTGTGG - Intronic
1149968379 17:61190929-61190951 GGTGTGATGGCATATGCCTGTGG + Intronic
1150021139 17:61614787-61614809 GGTGTGATGGTGCGTGCCTGTGG - Intergenic
1150106070 17:62463415-62463437 GGTGTGGTGGTGCACGCCTGCGG + Intronic
1150111245 17:62501825-62501847 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1150128080 17:62651697-62651719 GATGTGGTGGTGTATGCCTGAGG - Intronic
1150237360 17:63603877-63603899 GGTGTGGTGGTGCACACCAGTGG + Intronic
1150288428 17:63967075-63967097 GGTGTGATGAAGGAGGACAGGGG + Intronic
1150352891 17:64459292-64459314 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1150420070 17:65025844-65025866 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1150421313 17:65038548-65038570 GGTACGATGGTGTATGCCTGTGG - Intronic
1150474126 17:65461348-65461370 GGTGTGGTGGTATATGCCTGTGG - Intergenic
1150513861 17:65786724-65786746 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1150615698 17:66769216-66769238 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1150677217 17:67254870-67254892 GGCGTGGTGGTGCATGCCAGTGG + Intergenic
1150679603 17:67274178-67274200 GGTGTGGTGGTGTGTACCAGTGG - Intergenic
1150753752 17:67891041-67891063 GGTGTGCTGGTGCATGCCTGTGG + Intronic
1150792615 17:68210806-68210828 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1150851607 17:68708561-68708583 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1151437598 17:74107654-74107676 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1151616615 17:75217197-75217219 GGCGTGGTGGTGCAGGCCTGTGG - Intronic
1151742359 17:75992366-75992388 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1151752415 17:76047255-76047277 GGTGTGATGGTGCACACCTGTGG - Intronic
1151753107 17:76053123-76053145 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1151951681 17:77357752-77357774 GGTGTGGTGGTGGATGCCTGCGG - Intronic
1152057952 17:78046318-78046340 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1152102477 17:78310383-78310405 GGTGTGCTGGTGTGTGCCCGTGG - Intergenic
1152146993 17:78574361-78574383 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1152158586 17:78652143-78652165 GGTGTGATGATGTGTGCCTGTGG + Intergenic
1152346409 17:79755047-79755069 GGTGTGGTGGTGTACACCTGTGG + Intergenic
1152401714 17:80070459-80070481 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1152497931 17:80687542-80687564 AGTGTGCTGGTGTGGGGCAGAGG - Intronic
1152670812 17:81604848-81604870 GGTGTGATGGTGCATGCCTGTGG + Intronic
1152674354 17:81630424-81630446 GGTGTGGTGGTGCAAGCCTGTGG - Intronic
1152823652 17:82450140-82450162 GGTGTGGTGGTGTACGCCTGTGG + Intronic
1153539712 18:6140495-6140517 GGGCTGAGGGTGCAGGCCAGTGG - Intronic
1153899744 18:9607219-9607241 GGCGTGGTGGTGCAGGCCTGTGG + Intronic
1153926701 18:9841068-9841090 GGTGTGATGGTGTGTGCTTGTGG - Intronic
1154276189 18:12962605-12962627 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1154307083 18:13238594-13238616 GGTGGTGTGGTGCAGGCCAGAGG + Intronic
1154327589 18:13402903-13402925 GTTTTGATTGTGAAGGCCAGTGG - Intronic
1155083401 18:22432130-22432152 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1155283164 18:24261691-24261713 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1155460237 18:26071686-26071708 GGCATGATGGTGTATGCCTGTGG + Intronic
1155484903 18:26331006-26331028 CATGTGAAGGTATAGGCCAGTGG - Intronic
1155715641 18:28940247-28940269 GGAGAAATGGTGTAGGCCAGGGG + Intergenic
1155727894 18:29112448-29112470 TGTGTGTTTGTATAGGCCAGGGG + Intergenic
1155765972 18:29633208-29633230 GGTGTGTTGGTGTACGCCTGTGG - Intergenic
1156336013 18:36172124-36172146 GGTGTGATGGTGCATGACTGTGG + Intronic
1157287235 18:46385187-46385209 GGTGTGATGTCATGGGCCAGGGG + Intronic
1157813202 18:50712285-50712307 GGTGTGTTGGTGTGCGCCTGTGG + Intronic
1157834913 18:50891938-50891960 GGTGTGGTGGTGTACACCTGTGG - Intronic
1157957634 18:52115969-52115991 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1158249949 18:55476613-55476635 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1158262387 18:55622365-55622387 GGCGTGGTGGTGTATGCCCGTGG + Intronic
1158456763 18:57615039-57615061 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1158565317 18:58550032-58550054 GGTGTGAGGGTGTGGACAAGTGG - Intronic
1159024195 18:63167784-63167806 GGTGTGATGGTGCATGCCTGTGG + Intronic
1159508427 18:69364674-69364696 GATGTGATATTGAAGGCCAGAGG - Intergenic
1160406082 18:78647173-78647195 TCTGTGATGGTGTAGGCATGTGG - Intergenic
1160408210 18:78657332-78657354 GGTGTGGTGGCGTATGCCTGTGG - Intergenic
1160444854 18:78919345-78919367 GGTGTGGTGGTGCATGCCGGTGG - Intergenic
1161077299 19:2292046-2292068 CATGTGGTGGTGTAGGCCTGTGG + Intronic
1161101204 19:2422915-2422937 GGCGTGATGGTGCATGCCTGTGG + Intronic
1161316275 19:3619035-3619057 GGGGTGAGGGTGCAGGTCAGAGG + Intronic
1161359655 19:3840668-3840690 TGTGTGATGGTGCATGCCTGTGG - Intronic
1161395217 19:4041904-4041926 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1161403084 19:4077615-4077637 GGGGTGGTGGTGGAGGGCAGTGG - Intergenic
1161415231 19:4143020-4143042 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1161476258 19:4487394-4487416 GGTGTGGCGGTGTGGGCCTGCGG - Intronic
1161484286 19:4526359-4526381 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1161533638 19:4805175-4805197 GGTGTGATGGTGTGCACCTGTGG + Intergenic
1161537042 19:4826019-4826041 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1161587211 19:5112111-5112133 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1161624127 19:5316055-5316077 GGTGTGATGGTGTGTGCCTGTGG - Intronic
1161652150 19:5492011-5492033 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1161659517 19:5537421-5537443 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1161705630 19:5819706-5819728 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1161750175 19:6090099-6090121 GGTGTGGTGGTGTGGGCCTCTGG - Intronic
1161775019 19:6256317-6256339 GATGTGGTGGTGCAGGCCCGTGG + Intronic
1161806418 19:6445935-6445957 GATGTGATGGTGCATGCCTGTGG + Intronic
1161915750 19:7226586-7226608 GGTGCGATGGTGTACACCTGTGG + Intronic
1161940654 19:7401423-7401445 GGCGTGATGGTGTGTGCCTGTGG - Intronic
1162024427 19:7885681-7885703 GGTGTGATGGTGTGCACCTGTGG - Intergenic
1162126848 19:8504044-8504066 GGTGTGATGGTGCACGCCTGTGG + Intergenic
1162182169 19:8877549-8877571 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1162318853 19:9959052-9959074 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1162353722 19:10167333-10167355 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1162365428 19:10245866-10245888 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1162365943 19:10249720-10249742 GGTGTGATGGTATATGCCTGTGG - Intergenic
1162384898 19:10354914-10354936 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1162399337 19:10435419-10435441 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1162428650 19:10613195-10613217 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1162469218 19:10862342-10862364 AGTGTGGTGGTGTATGCCTGTGG - Intronic
1162539513 19:11286110-11286132 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1162576360 19:11501316-11501338 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1162778498 19:12994621-12994643 GGTGTGGTGGTGGATGCCTGTGG - Intergenic
1162801140 19:13111181-13111203 GGTGTGGTGGTGGATGCCTGTGG - Intronic
1162830415 19:13281236-13281258 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1162848995 19:13416238-13416260 GGCGTGGTGGTGCAGGCCTGTGG - Intronic
1162983168 19:14252018-14252040 GGTGTGATAGTGTATACCTGTGG + Intergenic
1163402948 19:17105353-17105375 GGTGTGGTGGTGTTTGCCTGTGG + Intronic
1163432700 19:17277737-17277759 GGCGTGGTGGTGTACGCCTGTGG + Intronic
1163462961 19:17449702-17449724 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1163476279 19:17527829-17527851 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1163498302 19:17660033-17660055 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1163644494 19:18480771-18480793 GGTGTGTTGGTGTGTGCCTGTGG - Intronic
1163731544 19:18952460-18952482 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1164658425 19:29941479-29941501 GATGTGTTGGTGCGGGCCAGTGG + Intronic
1164683737 19:30153064-30153086 GGTGGGCTGGGGAAGGCCAGAGG + Intergenic
1164980025 19:32606989-32607011 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1164981136 19:32615442-32615464 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1165085226 19:33340957-33340979 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1165134261 19:33656674-33656696 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1165180514 19:33963550-33963572 GGTATGGTGGTATAGGCCTGTGG - Intergenic
1165205325 19:34180057-34180079 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1165269432 19:34692427-34692449 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1165316442 19:35059340-35059362 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1165430082 19:35767393-35767415 GGTGCAAGGGTGGAGGCCAGGGG - Intronic
1165716824 19:38051734-38051756 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1165782361 19:38441902-38441924 TGTGTGATGGTGGAGGCAGGAGG + Intronic
1165791345 19:38494492-38494514 GGTGAGATGGTGTACGCCCGCGG - Exonic
1165807797 19:38592132-38592154 GTTGTGGTGGTGTATGCCTGTGG + Intronic
1165836206 19:38757939-38757961 GGTGTGGTGGTGTATACCTGTGG - Intronic
1165884948 19:39071374-39071396 GGTGTGGTGGTGTGTGCCCGTGG - Intergenic
1165899505 19:39162393-39162415 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1165959255 19:39520674-39520696 GGTGTGGTGGTGTGTGCCTGTGG + Exonic
1166073496 19:40400120-40400142 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1166099721 19:40564695-40564717 GGTGTGATGGTGTGCACCTGTGG + Intronic
1166190422 19:41173058-41173080 GCTGGGATGGGGGAGGCCAGGGG - Intergenic
1166505826 19:43370956-43370978 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1166550969 19:43665801-43665823 GGTGTGGTGATGTAAGCCTGTGG - Intronic
1166719777 19:44990300-44990322 GGTGTGAGGATGCAGGCCAAGGG + Intronic
1166814899 19:45538279-45538301 GGTGTGGTGGTGTATGCCTGTGG + Intronic
1166892561 19:46002553-46002575 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1167047586 19:47059621-47059643 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1167098926 19:47392039-47392061 GATGTGGTGGTGCAGGCCTGTGG - Intergenic
1167201960 19:48072004-48072026 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1167215345 19:48160870-48160892 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1167298691 19:48666821-48666843 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1167385931 19:49163629-49163651 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1167409676 19:49337480-49337502 GGTGTGATGGTGTGCACCTGGGG + Intronic
1167591843 19:50408518-50408540 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1167595472 19:50425578-50425600 GGTGTGGTGGTGTACGCCTGTGG - Intronic
1167747841 19:51363268-51363290 GGGATGATGGAGTAGGGCAGTGG + Intronic
1167925890 19:52820924-52820946 CGTGTGATCGTGTGGGCCAAAGG - Intronic
1167940988 19:52945798-52945820 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1167994519 19:53391572-53391594 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1168367246 19:55799125-55799147 GGTGTGGTGGTGTACCCCTGTGG + Intronic
1168423801 19:56222870-56222892 GGGGTGATGGGGTGGTCCAGGGG - Intronic
1168444992 19:56404155-56404177 GGTGGGATTCTGAAGGCCAGCGG + Intronic
1168595327 19:57670999-57671021 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1168677696 19:58290911-58290933 GGTGTGGTGGTGCATGCCTGTGG + Intronic
924994776 2:349354-349376 GGTGTGTTGGTGTGTGCCTGTGG + Intergenic
924997818 2:379981-380003 GGTGTGATGGTATGCGCCTGTGG + Intergenic
925845870 2:8032566-8032588 AGTGTGATGGTGCACGCCTGTGG + Intergenic
926027631 2:9558341-9558363 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
926138102 2:10351617-10351639 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
927155335 2:20217976-20217998 GGTGGGATGGGCAAGGCCAGTGG - Intronic
927599862 2:24431401-24431423 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
927601340 2:24444346-24444368 GGTGTGGTGGTGTATGCCTGTGG - Intergenic
927782188 2:25948410-25948432 GGTGTGGTGGTGCATGCCTGTGG + Intronic
927802342 2:26112621-26112643 GGTGTGGTGGTGTACACCTGTGG + Intronic
927903765 2:26842725-26842747 GGTGTGATGGTGCACGCCTGTGG - Intergenic
927918848 2:26955954-26955976 GGAGTGATGGTGCATGCCTGTGG - Intergenic
928004159 2:27548466-27548488 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
928157510 2:28890153-28890175 GGTGTGATGGAGTGTGCCTGTGG - Intergenic
928410351 2:31049576-31049598 GGGGTGAGGGTGGAGGTCAGAGG + Intronic
928670719 2:33600487-33600509 GGTGTGGTGGTGAACGCCTGTGG - Intergenic
928978910 2:37118172-37118194 GGTGTGGTGGTGTACACCTGTGG + Intronic
929159435 2:38817068-38817090 GGCGTGATGGTGCACGCCTGTGG - Intronic
929396374 2:41527996-41528018 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
929564304 2:42975135-42975157 GGTGTGATGGGGGAGACAAGAGG + Intergenic
929709863 2:44255946-44255968 GGCGTGGTGGTGTACGCCTGTGG - Intergenic
930009809 2:46928029-46928051 GGCGTGGTGGTGTATGCCAGTGG - Intronic
930564734 2:53004984-53005006 GGTGTGGTGGTGGGGGCCTGTGG - Intergenic
930605500 2:53489207-53489229 GGTGTGGTGGTGTATACCTGTGG - Intergenic
930688814 2:54337995-54338017 GGTGTAATGGTGTACGCCTGTGG + Intronic
931036849 2:58253389-58253411 GGTGTGATGGTGCATGCTTGTGG + Intergenic
931231585 2:60379677-60379699 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
931278378 2:60764563-60764585 GGTGTGGTGGTGCATGCCTGTGG - Intronic
931369731 2:61651001-61651023 GGTGTGGTGGTATATGCCTGTGG - Intergenic
931447482 2:62338815-62338837 GGTGTGATGGTGTGCACCTGTGG + Intergenic
931854566 2:66288362-66288384 GGTGTGATGGTGAGTGCCTGTGG - Intergenic
931927117 2:67085662-67085684 GGTGGGAAGGTGGAGGCCATTGG - Intergenic
932106663 2:68949557-68949579 GGTGTGGTGGTGCGGGCCTGTGG - Intronic
932201474 2:69831744-69831766 GGTGTGGTGGTGCATGCCTGTGG - Intronic
932488002 2:72097385-72097407 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
932538256 2:72622568-72622590 GGTGTGGTGGCGTATGCCTGTGG + Intronic
932726031 2:74180301-74180323 GGCGTAATGGTGTGTGCCAGTGG + Intergenic
933612164 2:84447867-84447889 GGTGTGGTGGTGCATGCCTGTGG - Intronic
933645001 2:84804951-84804973 GGTGTGGTGGTGTATACCTGTGG - Intronic
933929619 2:87135765-87135787 GGTGTGATGGTGTGCACCTGTGG - Intergenic
934000951 2:87711556-87711578 GGTGTGATGGTGTGCACCTGTGG - Intergenic
934072897 2:88401617-88401639 GGTGTGATGGTGTGAGCCTGTGG - Intergenic
934475850 2:94592961-94592983 GGTGTTGTGGTGTATGCCTGTGG - Intronic
935158800 2:100510838-100510860 GGTGTGGTGGTGTGGGCCTGTGG + Intergenic
935238543 2:101158138-101158160 GGTGTGGTGGTGCATGCCTGTGG - Intronic
935649506 2:105370233-105370255 GGTGTGGTGGTGTGTGCCTGAGG + Intronic
936169887 2:110161024-110161046 GGCATGGTGGTGTAGGCCTGTGG + Intronic
936363316 2:111827613-111827635 GGTGTGATGGTGTGCACCTGTGG + Intronic
936953937 2:118005615-118005637 GGCGTGGTGGTGTATGCCTGTGG + Intronic
937098088 2:119248620-119248642 GGGGTGATGTTGCAGGCCACGGG + Intronic
937183695 2:120018786-120018808 GGTGTGGTGGTGCATGCCTGTGG - Intronic
937485851 2:122314159-122314181 GGCGTGGTGGTGTATGCCTGTGG + Intergenic
937697778 2:124827058-124827080 GGTGTGGTGTTGCAGGCCTGTGG - Intronic
938026941 2:127957532-127957554 GGCGTGGTGGTGTATGCCTGTGG + Intronic
938055448 2:128210931-128210953 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
938222083 2:129578307-129578329 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
938545613 2:132327503-132327525 GGTAAGATGGAGTAAGCCAGTGG + Intergenic
938713629 2:133998557-133998579 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
938871152 2:135477847-135477869 GGTATGATGGTATATGCCTGTGG + Intronic
939531996 2:143374640-143374662 GGTGTGGTGGTGCATGCCTGTGG - Intronic
939877111 2:147589915-147589937 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
939946785 2:148420864-148420886 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
940161818 2:150721613-150721635 GGTGTGATGGTGCAGGCCTGTGG + Intergenic
940837344 2:158537888-158537910 GGTGTGATGGTGTGCGCCTGTGG + Intronic
941672339 2:168308586-168308608 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
941960653 2:171250152-171250174 TGTGTGTTGGTGTGGGCCTGTGG + Intergenic
942150040 2:173066517-173066539 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
942507304 2:176656788-176656810 GGTTTGATGGTGTATGTCTGTGG + Intergenic
942629164 2:177937455-177937477 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
942646496 2:178116010-178116032 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
942848894 2:180459189-180459211 TGTGTGATTGTGTAAGCCAATGG - Intergenic
942937776 2:181578437-181578459 GGTCTGGTGGTGTATGCCTGTGG - Intronic
943356050 2:186857172-186857194 GGTGTGGTGATGTGGGCCTGTGG - Intergenic
943490095 2:188541966-188541988 GGTGTGGTGGTGTGTGCCAGTGG + Intronic
943834344 2:192500358-192500380 GGTGGGATGGGGTGGGCCATGGG - Intergenic
944695603 2:202197722-202197744 GGTGTGGTGGTGAATGCCTGTGG + Intronic
945310629 2:208308259-208308281 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
945559991 2:211327953-211327975 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
945940959 2:215949419-215949441 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
946223853 2:218251591-218251613 GCTGTGATGGTGCATGCCTGTGG - Intronic
946224714 2:218258094-218258116 GGTGTGGCGGTGCAGGCCTGTGG - Intergenic
946256777 2:218448118-218448140 GGTGTGGTGGTGCATGCCTGTGG + Intronic
946273937 2:218616575-218616597 GGTGTGGTGCTGTACGCCTGTGG + Intronic
946663732 2:222028253-222028275 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
946712510 2:222520897-222520919 GGTGTGATGGTGTATGCCTGTGG - Intronic
946726087 2:222662789-222662811 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
947190996 2:227504330-227504352 GGCGTGGTGGTGTATGCCTGTGG - Intronic
947213584 2:227729587-227729609 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
947506158 2:230709988-230710010 GGTGTGGTGGCGTGCGCCAGTGG - Intergenic
947628625 2:231637210-231637232 GGTGTGGTGGTGTACACCTGTGG + Intergenic
947633357 2:231667309-231667331 GGTGTGACGGTGCACGCCTGTGG + Intergenic
947690177 2:232128088-232128110 GGTGTGATGGTGTACACCTGTGG - Intronic
947897189 2:233686692-233686714 GGTGGGAGGGTGCAGGCCAGAGG - Intronic
947900237 2:233715630-233715652 GGTGTGATGGTGCACACCTGTGG + Intronic
948307369 2:236959263-236959285 GGTGTGATGGTGTGTGCCTGTGG - Intergenic
948364145 2:237443738-237443760 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
948819707 2:240534957-240534979 GGTGTGATGGTGCATGCCTATGG + Intronic
948964884 2:241371342-241371364 GGTGTGATGGCGCATGCCTGTGG + Intronic
1168973930 20:1949965-1949987 TGTGAGATGGGGAAGGCCAGTGG - Intergenic
1169055486 20:2617256-2617278 GACATGATGGTGTAGGCCACCGG - Exonic
1169119607 20:3087160-3087182 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1169129876 20:3160802-3160824 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1169222286 20:3831797-3831819 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1169271361 20:4201900-4201922 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1169562545 20:6817625-6817647 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1169885216 20:10391186-10391208 GGTGTGGTGGTGTGAGCCTGTGG - Intergenic
1170231541 20:14052123-14052145 GGTGTGTTGGGGTAGAGCAGTGG + Intronic
1170361523 20:15551726-15551748 GATGTGATGGTGTGGGCCTGTGG + Intronic
1170476400 20:16719117-16719139 GGTGTGATGGTGTGTGCCTGTGG + Intergenic
1170590850 20:17770826-17770848 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1170799541 20:19579676-19579698 GGTGTGATGGCGTGAGCCAGTGG + Intronic
1170894885 20:20403952-20403974 GCTGGGATGGTGGAGGCCACTGG + Intronic
1170946285 20:20893973-20893995 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1171874475 20:30560278-30560300 GGTAAGATGGAGTAAGCCAGTGG + Intergenic
1171974764 20:31587585-31587607 GGTGTGGTGGAGGAGGCTAGAGG + Intergenic
1172014247 20:31863533-31863555 GAGGTGATGGTGCAGGGCAGTGG - Intronic
1172153863 20:32810126-32810148 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1172406242 20:34691833-34691855 GGCGTGGTGGTGTAGCCCTGTGG - Intergenic
1172499797 20:35417643-35417665 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1172711019 20:36923673-36923695 GGTGTGACGGTGCAGGCCTGTGG + Intronic
1172772250 20:37388606-37388628 GGTGTGGTGGCGCATGCCAGTGG + Intronic
1172796967 20:37546862-37546884 CGTGTGGTGGTGTGGGCCTGTGG - Intergenic
1172806722 20:37617306-37617328 GGTGTTATGGTGGAAGCTAGAGG + Intergenic
1172876844 20:38169599-38169621 GGTGGGATGGGGTGGGGCAGGGG + Intergenic
1173491087 20:43482396-43482418 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1173618547 20:44418913-44418935 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1173782368 20:45766855-45766877 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1173798054 20:45876476-45876498 GGTGTGGTGGTGTATTCCTGTGG - Intronic
1173932335 20:46831155-46831177 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1174004148 20:47396898-47396920 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1174096182 20:48091397-48091419 GGTGTGGTGGTGCAAGCCTGTGG + Intergenic
1174249012 20:49204261-49204283 GGTGTGGTGGTGAGGGCCTGTGG - Intergenic
1174312525 20:49668999-49669021 GATGTGGTGGTGTACGCCTGTGG - Intronic
1174326069 20:49779882-49779904 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1174358494 20:50013911-50013933 GGTGTGGTGGTGTGGGCCTCTGG - Intergenic
1174423209 20:50414114-50414136 GGTGTGCTGGTGCACGCCTGTGG - Intergenic
1174501240 20:50986265-50986287 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1174650271 20:52119001-52119023 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1174710305 20:52697469-52697491 GGTGTGGTGGTGCATGCCAGTGG - Intergenic
1174826527 20:53773529-53773551 GGCATGCTGGTGTAGGGCAGAGG + Intergenic
1174904247 20:54533289-54533311 GGAGTGATGGTGTCCCCCAGTGG - Intronic
1174926015 20:54760882-54760904 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1175195717 20:57242020-57242042 GGTGGGAAGCCGTAGGCCAGGGG - Intronic
1175318380 20:58068291-58068313 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1175568420 20:59999590-59999612 GGTCAGATGTTGAAGGCCAGAGG + Exonic
1175879805 20:62250783-62250805 GGTATGATGGTGTACGCCTGTGG + Intronic
1176169880 20:63691969-63691991 GCTGTGATGCTGACGGCCAGGGG + Intronic
1176409421 21:6439943-6439965 GGTGTGGTGGTGTACACCTGTGG + Intergenic
1176983871 21:15413480-15413502 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1178135940 21:29627485-29627507 GGGGTGATGGTGTGGGGCACGGG - Intronic
1178324461 21:31632500-31632522 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1178416017 21:32405757-32405779 GGTGTGGTGGTGTACGCCTGTGG + Intergenic
1178468042 21:32866614-32866636 GGTGTGGTGGTACATGCCAGTGG - Intergenic
1178641726 21:34350064-34350086 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1178681292 21:34674223-34674245 GGTGTAATGGTGTGTGCCTGTGG - Intronic
1178862920 21:36304332-36304354 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1178866714 21:36334113-36334135 GGTATGGTGGTGCAGGCCTGTGG + Intronic
1178944868 21:36938636-36938658 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1179008875 21:37537880-37537902 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1179208244 21:39303681-39303703 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1179218511 21:39386997-39387019 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1179306461 21:40157832-40157854 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1179345139 21:40549063-40549085 GGTGTGGTGGTGTGCGCCCGAGG + Intronic
1179462227 21:41544251-41544273 GGTGTGCTGGTGCATGCCTGTGG + Intergenic
1179543521 21:42099818-42099840 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1179676991 21:42989957-42989979 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1179684914 21:43048265-43048287 GGTGTGGTGGTGTACACCTGTGG + Intergenic
1179815423 21:43903226-43903248 AGTGTGATGGTGGGTGCCAGGGG + Intronic
1180488772 22:15822456-15822478 GGTGTGGTGGTGCGGGCCTGTGG + Intergenic
1180664243 22:17497153-17497175 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1180781420 22:18522068-18522090 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1180973037 22:19825480-19825502 GGTGTGGTGGTGTATGCCTGTGG + Intronic
1180999233 22:19980295-19980317 GGTGTGATGGGGCAGCTCAGAGG - Intronic
1181238304 22:21461411-21461433 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1181259321 22:21586073-21586095 GGTGTGTTGATGTATGCCTGTGG - Intronic
1181290673 22:21790629-21790651 GGTGTGGTGGTGTATGCCTGTGG - Intronic
1181295686 22:21836728-21836750 GGGGTGATGGTGTGCGCCTGTGG + Intronic
1181616833 22:24060749-24060771 GGTGTGGTGGTGTACGGCTGTGG - Intronic
1181691538 22:24565021-24565043 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1181926057 22:26359663-26359685 GGCATGATGGTGCACGCCAGTGG + Intronic
1182460597 22:30481029-30481051 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1182668499 22:31976149-31976171 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1183121511 22:35733453-35733475 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1183394772 22:37565325-37565347 GGTGTGGTGGTGTATGCCTGTGG - Intronic
1183530253 22:38349491-38349513 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1183657390 22:39195612-39195634 GGTGTGATGGTGCCAGCCTGTGG + Intergenic
1183664329 22:39238719-39238741 TGTGTGATGCTGAGGGCCAGTGG - Intronic
1183672617 22:39282075-39282097 GGCGTGATGGTGCACGCCTGTGG - Intergenic
1183680107 22:39323396-39323418 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1183921834 22:41176078-41176100 GGTGTGGTGGTGTGGGCCTGTGG + Intronic
1184312867 22:43659518-43659540 GGTGTGGTGGTGCATGCCCGTGG + Intronic
1184335780 22:43852305-43852327 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1184561455 22:45265752-45265774 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1184587312 22:45456764-45456786 GGTATGATGGTGTACACCTGTGG - Intergenic
1184826815 22:46958025-46958047 GGAGTGATGGGGTAGGCCTGGGG + Intronic
1185303062 22:50093646-50093668 GGTATGATGGTGTACACCTGTGG - Intronic
949352605 3:3139864-3139886 GGTGTGGTGGTGCATGCCTGTGG - Intronic
949556815 3:5161057-5161079 GGTGTGATGGGGCATGCCTGCGG - Intronic
949736337 3:7176269-7176291 GGTGTGGTGGTGCATGCCTGTGG + Intronic
949997092 3:9626639-9626661 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
950087806 3:10272897-10272919 GGTGTGATGGTACATGCCTGGGG + Intronic
950260350 3:11538732-11538754 GATGTGGTGGTGCAGGCCTGTGG + Intronic
950297051 3:11841220-11841242 GGTGTGATGGTGCATGCCTGTGG - Intronic
950399861 3:12761464-12761486 GGTGTGGTGGTGCATGCCAGTGG + Intronic
950669499 3:14517639-14517661 GGTGTGGTGGTGCACGCCTGTGG - Intronic
950760859 3:15224410-15224432 GGCGTGATGGTGCATGCCTGCGG - Intronic
950853457 3:16084324-16084346 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
950988807 3:17408461-17408483 GGTGTGATGGTGTGTGCCTGTGG - Intronic
951214990 3:20015300-20015322 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
951237979 3:20257154-20257176 GGTGTGGTGGTGGATGCCTGTGG + Intergenic
951442159 3:22735930-22735952 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
951586352 3:24219135-24219157 AGTGTGGTGGTGTGTGCCAGTGG + Intronic
952800342 3:37284803-37284825 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
952966200 3:38622700-38622722 GGTGTCATGGAGCAGGCCAGGGG - Intronic
953231008 3:41065072-41065094 GGTGTGATGCTGCAGGCATGGGG + Intergenic
953325202 3:42007156-42007178 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
953330443 3:42048699-42048721 GGTGTGCTGGTGTGCGCCTGTGG - Intronic
953876387 3:46669168-46669190 GGTGTGTTGGTGTGTGCCTGTGG - Exonic
954023585 3:47763857-47763879 GGTGTGGTGGTGCATGCCTGTGG - Intronic
954736289 3:52709559-52709581 GGTGTGGTGGTGCATGCCTGTGG + Exonic
954885100 3:53866242-53866264 AGTGTGATGGTGTAAGCCTGTGG + Intergenic
955106629 3:55905218-55905240 GGCGTGATGGTGCATGCCTGTGG - Intronic
955118718 3:56033256-56033278 GGTGTGGTGGTGCATGCCTGTGG + Intronic
955153746 3:56395105-56395127 GGAGTGATTGCCTAGGCCAGGGG + Intronic
955287816 3:57660566-57660588 GGTGTGTTGGTGCATGCCTGTGG + Intronic
955304814 3:57819889-57819911 GGTGTGATGGTGTGTGCCTGTGG - Intronic
955328118 3:58025267-58025289 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
955414851 3:58682690-58682712 GGTGTGGTGGTGCATGCCCGTGG - Intergenic
955720931 3:61880478-61880500 GGTGTGTTGGTGTAGGCCTGTGG + Intronic
956459115 3:69454022-69454044 TGTGGGATGGTATAGGCCTGAGG - Intronic
957052575 3:75421703-75421725 GGTGGGACTGTGTTGGCCAGAGG + Intergenic
957073681 3:75584597-75584619 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
957700622 3:83706290-83706312 GGTGTGGTGGAGTATGCCTGTGG + Intergenic
957789457 3:84919900-84919922 GGTGTGATGGTGGGCGCCTGTGG + Intergenic
957996244 3:87693129-87693151 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
958924933 3:100147410-100147432 GGTGTGGTGGTGCATGCCTGTGG - Intronic
959058392 3:101591909-101591931 GGTGTGCTGGTGTGCGCCTGTGG - Intronic
959905330 3:111704950-111704972 GGTGTGGTGGTGCATGCCTGTGG - Intronic
960105066 3:113786916-113786938 GGTGTGGTGGTGCATGCCTGTGG - Intronic
960297708 3:115963891-115963913 GGTGTGGTGGTGTGAGCCCGTGG - Intronic
960862475 3:122166185-122166207 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
960881996 3:122354744-122354766 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
960959917 3:123063144-123063166 GGTGTGGTGGTGTGAGCCTGAGG + Intergenic
961186024 3:124915823-124915845 GGTGTGGTGGTGCAGGTCTGTGG - Intronic
961415107 3:126751360-126751382 GGCGTGATGGTGTACACCTGTGG + Intronic
961703913 3:128769030-128769052 GGTGTGGTGGTGTACACCTGTGG - Intronic
961713470 3:128844176-128844198 GTGGTGATGGAGTACGCCAGAGG - Intergenic
961720835 3:128895014-128895036 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
961747973 3:129077879-129077901 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
961874000 3:130007402-130007424 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
961886189 3:130097927-130097949 GGTGGGACTGTGTTGGCCAGAGG + Intronic
962543686 3:136409944-136409966 GGTGTGGTGGTGCAAGCCTGTGG + Intronic
962584366 3:136826775-136826797 GGTGTGGTGGTGCATGCCTGTGG - Intronic
962970636 3:140398576-140398598 AGTGTGATGTTCTAGGACAGTGG - Intronic
963399017 3:144773513-144773535 GGTTTAATGTTGTAGGCAAGCGG + Intergenic
964086042 3:152819699-152819721 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
964152958 3:153549997-153550019 GATGTGATGGTGTGTGCCTGTGG - Intergenic
964383712 3:156124996-156125018 GGTGTGGTGGTGCATGCCTGAGG + Intronic
964443778 3:156739518-156739540 AGTGGGATGGTGTAGGAAAGAGG + Intergenic
964480172 3:157131688-157131710 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
964524627 3:157605482-157605504 GGTGTGATGGTGCATGACTGTGG - Intronic
964756306 3:160093172-160093194 GGTGACAAGGTGAAGGCCAGAGG - Intergenic
966287284 3:178312590-178312612 GGTGTGATGGTGCATCCCTGTGG + Intergenic
967672081 3:192248636-192248658 GGTGTGATGGTACACGCCTGTGG + Intronic
967903645 3:194483448-194483470 GGTGTGATGGTGCACACCTGTGG + Intronic
968083223 3:195861521-195861543 GGTGTGGTGGTGTGCGCCTGTGG + Intergenic
968119123 3:196111963-196111985 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
968124276 3:196146870-196146892 GGTGTGGTGGTGCATGCCCGCGG + Intergenic
968202709 3:196769185-196769207 GGCGTGATGGTGCACGCCTGTGG + Intronic
968347494 3:198022714-198022736 GGTGTGATGGTGCACACCTGTGG + Intronic
968505343 4:968700-968722 GGGGTGATGGGGGAGGCCAAGGG - Intronic
968525104 4:1052787-1052809 GGTGTGCTGAGGTGGGCCAGTGG + Intergenic
968779514 4:2569635-2569657 GGTGTGGTGGTGCATGCCTGTGG - Intronic
968790280 4:2655789-2655811 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
969017275 4:4111909-4111931 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
969043416 4:4319027-4319049 GGTGTGGTGGTGCATGCCTGTGG - Intronic
969279099 4:6157565-6157587 GTTGTGATGGTCTGTGCCAGTGG - Intronic
969360612 4:6660979-6661001 GGCGTGATGGTGCATGCCTGTGG - Intergenic
969491010 4:7499325-7499347 AGTGTGATGCTGGAGGCCATGGG + Intronic
969758610 4:9166715-9166737 GGTGGGACTGTGTTGGCCAGAGG - Intergenic
969818578 4:9704178-9704200 GGTGGGACTGTGTTGGCCAGAGG - Intergenic
970290844 4:14570624-14570646 TGTGTGATGGAATAAGCCAGGGG - Intergenic
970653723 4:18207148-18207170 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
970845285 4:20530421-20530443 GGTGTGGTGGTGCATGCCTGAGG - Intronic
971272917 4:25167806-25167828 GGTGTGGTGGTGGATGCCTGTGG + Intronic
971390194 4:26178466-26178488 GGTGTGATGGTGCACGCCTGTGG + Intronic
972068556 4:34984114-34984136 AGTGTGATGATATAGCCCAGAGG - Intergenic
972197413 4:36671083-36671105 GGTATGATGGTGTGTGCCTGTGG + Intergenic
972393892 4:38640826-38640848 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
972480794 4:39494012-39494034 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
972487931 4:39559980-39560002 GGTGTGGTGGTGTGTGCCTGCGG + Intronic
972524187 4:39891969-39891991 GGCGTGATGGTGCATGCCTGGGG + Intronic
972645416 4:40963384-40963406 GGTGTGATGGTGCATACCTGTGG - Intronic
972714935 4:41636044-41636066 GGTGTAGTGGTGTACGCCTGTGG - Intronic
973319818 4:48798724-48798746 GGTGTGGTGGTGTATACCTGTGG + Intergenic
973324951 4:48850711-48850733 GGCGTGGTGGTGTATGCCTGTGG - Intronic
973567570 4:52203630-52203652 AGTGTGGTGGTAGAGGCCAGAGG - Intergenic
973923054 4:55708541-55708563 GGTGTGTTGGAGTTTGCCAGAGG - Intergenic
974381077 4:61140580-61140602 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
974422130 4:61690302-61690324 GGTGTGGTGGTGCATGCCTGTGG + Intronic
974447233 4:62000919-62000941 GGTGTGATGGTGCATGCCTCTGG - Intronic
974779873 4:66540967-66540989 GGTGTGATGGTGTGCACCTGTGG + Intergenic
974863182 4:67548266-67548288 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
975121737 4:70736004-70736026 GGTGTGGTGGTGCATGCCTGTGG + Intronic
975125745 4:70780431-70780453 GCTGTGATGGTGCATGCCTGTGG - Intronic
975424154 4:74207035-74207057 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
975508334 4:75164630-75164652 GGTGTGATGGTGCATGCCTGTGG - Intergenic
975552363 4:75626749-75626771 GGTGTGGTGGTGTATGCCTGTGG + Intronic
975671545 4:76785886-76785908 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
975680868 4:76874536-76874558 GGTGTGGTGGTGTACACCTGTGG + Intergenic
975713976 4:77188072-77188094 GGTGTGGTGGTGCATGCCTGTGG + Intronic
976290307 4:83411018-83411040 GGTGTGGTGGTGCATGCCTGTGG + Intronic
976296131 4:83474000-83474022 GGCGTGGTGGTGCAGGCCTGTGG + Intronic
976753534 4:88475200-88475222 GGTGTGATAGTGTAAACCAGAGG + Intronic
977215748 4:94281900-94281922 GGTGTGGTGGTGCACGCCTGTGG + Intronic
977283971 4:95078895-95078917 GGTGTGGTGGTGTACACCTGTGG - Intronic
977378421 4:96238109-96238131 GGTGTGATTGTATGGGGCAGTGG + Intergenic
977397249 4:96486150-96486172 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
977532818 4:98220328-98220350 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
977939787 4:102845928-102845950 GGTGTGATGGTGCATGCCTGTGG - Intronic
978093315 4:104744503-104744525 TGAGTTATGGTCTAGGCCAGCGG + Intergenic
978402663 4:108347362-108347384 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
978542800 4:109836946-109836968 GCTGTGGTGGTGTATGCCTGTGG + Intronic
978733378 4:112057480-112057502 GGTGTGATGGGGTAGGAAAGGGG - Intergenic
978738003 4:112106399-112106421 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
978755288 4:112295189-112295211 GGTGTGATGGTGTACACCTGTGG + Intronic
978935731 4:114372783-114372805 GGTGTGGTGGTGTACGCCTGTGG + Intergenic
980663374 4:135896901-135896923 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
980989609 4:139728073-139728095 GGCGTGATGGTGTTTGCCTGTGG + Intronic
981697646 4:147574984-147575006 GGTGTGTTGGTGCACGCCTGTGG - Intergenic
982051546 4:151507261-151507283 GGTGTGGTGGTGCAAGCCTGTGG - Intronic
982126200 4:152185991-152186013 GGTGTGCTGGGGTGGGGCAGAGG - Intergenic
982290342 4:153774603-153774625 GTTGTGATGGTGTCTGCCATAGG - Intergenic
982746967 4:159114090-159114112 GGTATGATGGTGCATGCCTGCGG - Intronic
983223402 4:165064389-165064411 GGTGTGGTGGTGCAGGCCTGTGG - Intergenic
983296002 4:165870023-165870045 GGTGTGATGGAGGAGGCAAATGG + Intergenic
983299179 4:165903196-165903218 GGTGTGGTGGTGCATGCCCGTGG + Intronic
983561880 4:169109867-169109889 GGTGTGGTGGTGCATGCCTGTGG + Intronic
983607138 4:169600327-169600349 GGTGTGGTGGTGTGTGCCTGCGG - Intronic
983638995 4:169926690-169926712 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
983806908 4:172005262-172005284 GGTGTGATGGTGCATACCTGTGG - Intronic
984313966 4:178102385-178102407 GGTGTGATGGTGTGCACCTGTGG + Intergenic
984636022 4:182110462-182110484 GGTGAGCTGGTGCATGCCAGTGG - Intergenic
984783985 4:183551845-183551867 GGTGTGATGGTGAACACCTGTGG + Intergenic
985985151 5:3509463-3509485 GGTGAGATGGAGGAGGACAGTGG - Intergenic
986141503 5:5034696-5034718 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
986323178 5:6650269-6650291 GGTGTGGTGGTGTGTGCCTGAGG + Intronic
987349838 5:17011988-17012010 GGTGTGGTGGTGTAAGCTTGTGG + Intergenic
987364274 5:17134826-17134848 GGTGTGGTGGTGTATGCCTGTGG + Intronic
987679932 5:21122008-21122030 GGAGTGATGGTCTGGGCCGGAGG + Intergenic
988123567 5:26999103-26999125 GGTGTGATGGTGTGCACCTGTGG + Intronic
988466384 5:31496286-31496308 GGTGTGGTGGTGCATGCCTGTGG + Intronic
989253724 5:39343926-39343948 GGTGTGTTGGAGTTTGCCAGAGG - Intronic
990966511 5:61454393-61454415 GGTGTGATGGCATGTGCCAGTGG - Intronic
990982386 5:61614002-61614024 GCTATGATGGGGGAGGCCAGGGG + Intergenic
991059551 5:62358808-62358830 GGTGTGGTGGTGCATGCCTGTGG - Intronic
991342572 5:65627488-65627510 GGCGTGATGGTGTGCACCAGTGG + Intronic
991432352 5:66561557-66561579 GGTGTGATGGTGTCGGGAGGTGG + Intergenic
991460793 5:66856022-66856044 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
991569887 5:68042905-68042927 GGTGTGATTGTGCATGCCTGTGG + Intergenic
992006816 5:72486484-72486506 TGTGTGGTGGTGTAGGGCAGGGG - Intronic
992276592 5:75127043-75127065 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
992445807 5:76832459-76832481 GGTGTGATGGTGTGTGCCTGTGG + Intronic
992594821 5:78335396-78335418 GGTGTGGTGGTGGGCGCCAGTGG + Intergenic
992681484 5:79157757-79157779 GGTGTGGTGGTGCATGCCTGGGG - Intronic
992772844 5:80064589-80064611 GGTGTGATGGTGCATGCCTGTGG + Intronic
992823379 5:80521262-80521284 TGTGTGATGGTGTATGCCTGTGG - Intronic
993325830 5:86535025-86535047 GGTGTGGTGTTGTATGCCTGTGG - Intergenic
993819383 5:92595617-92595639 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
993989013 5:94633125-94633147 GGTGTGATGGCATATGCCTGTGG - Intronic
994090796 5:95808196-95808218 TGTGTGAAGGTGTGGCCCAGTGG - Intronic
994475390 5:100261951-100261973 AGTGTGATGGTGTTGGGAAGTGG + Intergenic
995152313 5:108863257-108863279 GGTGTGGTGGTGCATGCCTGTGG - Intronic
995303712 5:110617861-110617883 AGTGTGGTGGTGTATGCCTGTGG + Intronic
995749066 5:115434964-115434986 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
996646740 5:125826650-125826672 AGTGGGAGGGTGGAGGCCAGAGG - Intergenic
996661744 5:126012295-126012317 GGTGTCATGGTGTACACCTGTGG + Intergenic
997643432 5:135464809-135464831 GGTGTGATGATGTGTGCCTGCGG - Intergenic
997777473 5:136624116-136624138 GGTGTGGTGGTGGTGGGCAGTGG - Intergenic
997789909 5:136749594-136749616 GGTGTGGTGGTGCAGGTCTGTGG - Intergenic
997946324 5:138205052-138205074 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
998082936 5:139292089-139292111 GGCGTGGTGGTGTACGCCTGTGG - Intronic
998089861 5:139359112-139359134 GGTGTGGTGGTGCACGCCTGTGG - Intronic
998233259 5:140375332-140375354 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
998255745 5:140586089-140586111 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
998426406 5:142032618-142032640 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
998633089 5:143922571-143922593 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
998794978 5:145809179-145809201 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
999372027 5:151061619-151061641 GGTGTGATGGTGTATGTCTGTGG - Intronic
999589855 5:153132870-153132892 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
999599939 5:153251574-153251596 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1000090357 5:157924794-157924816 GGTGTCATAGAGTAGGCCTGAGG + Intergenic
1000104709 5:158048315-158048337 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1000653195 5:163843264-163843286 CGTGTGTTGGTGTATGCCTGTGG + Intergenic
1000914060 5:167058609-167058631 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1001052196 5:168422475-168422497 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1001203504 5:169740973-169740995 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1001415063 5:171539896-171539918 GGTGTGGTGGTGCAGTCCTGTGG - Intergenic
1001703734 5:173726436-173726458 AGTGTGATGGTGCATGCCTGTGG + Intergenic
1001911785 5:175525746-175525768 GGTGTGTTGGTGTATGCCTGTGG - Intronic
1001975278 5:175993736-175993758 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1002009808 5:176269883-176269905 GGCGTGGTGGTGTATGCCAGTGG - Intronic
1002145398 5:177176569-177176591 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1002170772 5:177372957-177372979 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1002242153 5:177850034-177850056 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1002446611 5:179294114-179294136 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1002478593 5:179484595-179484617 GGTGTGTTGGTGTAGGATAGTGG - Intergenic
1002672394 5:180878643-180878665 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1002900446 6:1406142-1406164 GGTGTGGTGGTGGACGCCTGAGG + Intergenic
1002909795 6:1480956-1480978 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1003067454 6:2915723-2915745 GGTGTGGTGGTGCAGGTCTGTGG - Intergenic
1003198038 6:3932345-3932367 GGTGTGATGGCGCATGCCTGTGG - Intergenic
1003429226 6:6023662-6023684 GGTGTGGTGGTGCATGCCCGTGG - Intergenic
1003576281 6:7299030-7299052 GGTGAGATGGCGTATGCCTGTGG + Intronic
1003608943 6:7590836-7590858 GGTGTGGTGGTGTGAGCCTGTGG + Intronic
1003897517 6:10621843-10621865 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1003957262 6:11175269-11175291 GGCGTGGTGGTGTAGGCCTGTGG + Intergenic
1004138018 6:12987576-12987598 GGCTTGATTGTGTAAGCCAGTGG + Intronic
1004182386 6:13392221-13392243 GGTGTGATGGTGTGCACCTGTGG + Intronic
1004250826 6:14021894-14021916 GGTGTGATGGTGTGTGCCTGTGG - Intergenic
1004370418 6:15047579-15047601 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1004447170 6:15711022-15711044 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1004686876 6:17954811-17954833 GGTGTGATGCTGTGTGCCTGTGG - Intronic
1004913760 6:20312281-20312303 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1004952866 6:20694010-20694032 GGTGTGTTAGTGTGTGCCAGTGG - Intronic
1005324735 6:24688398-24688420 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1005344299 6:24874168-24874190 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1005521124 6:26601618-26601640 GGCGTGATGGTGCATGCCTGCGG - Intergenic
1005527350 6:26663998-26664020 GGTGTGATGGCGCATGCCTGTGG - Intergenic
1005785158 6:29237447-29237469 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1006490258 6:34381154-34381176 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1006493604 6:34404991-34405013 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1006734205 6:36260961-36260983 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1006805788 6:36788168-36788190 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1006975521 6:38097213-38097235 GGTGTGCTGGTGCAGGACTGTGG - Intronic
1006998244 6:38283507-38283529 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1007480523 6:42146711-42146733 GGTGTGATAGTGCATGCCTGTGG + Intergenic
1007503911 6:42319681-42319703 GGTGTGATGGTGTGTGCCTGTGG + Intronic
1008076538 6:47151833-47151855 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1008443899 6:51565407-51565429 GTCATTATGGTGTAGGCCAGTGG - Intergenic
1008611556 6:53188898-53188920 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1008626735 6:53324534-53324556 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1008949476 6:57139901-57139923 GGTGTATTGGTGTATGCCTGTGG + Intronic
1010111370 6:72237534-72237556 GGCGTGGTGGTGTATGCCTGTGG + Intronic
1011204959 6:84881925-84881947 AGTGAGATGGTGTAGGCTACTGG - Intergenic
1011567857 6:88697729-88697751 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1011622485 6:89256048-89256070 GGTGTGGTGGTGTGTGCCTGGGG - Intergenic
1011691071 6:89869598-89869620 GGCGTGGTGGTGCAGGCCTGTGG + Intronic
1012049306 6:94320005-94320027 GGTATGATGGTGTAAGGGAGTGG + Intergenic
1012556951 6:100525037-100525059 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1013105353 6:107022565-107022587 GGTGTGATGGTGGGCGCCTGTGG + Intergenic
1013128942 6:107213147-107213169 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1013150775 6:107444165-107444187 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1013312227 6:108906619-108906641 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1013588348 6:111599037-111599059 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1014113149 6:117643758-117643780 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1014451609 6:121588015-121588037 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1014846851 6:126288240-126288262 GGGTTGGTGGTGTAGGTCAGAGG - Intergenic
1015300695 6:131650357-131650379 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1015777034 6:136824338-136824360 GGTGTGATGGTACATGCCTGTGG - Intronic
1016277419 6:142371300-142371322 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1016356026 6:143219328-143219350 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1016422307 6:143898306-143898328 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1016423176 6:143906581-143906603 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1016715207 6:147218618-147218640 GGTGTGATGGTGTGCACCTGTGG - Intronic
1017748370 6:157467316-157467338 GGGGTGGTGGGGTAGGACAGGGG - Intronic
1017829415 6:158112271-158112293 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1017879778 6:158553046-158553068 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1018204585 6:161425484-161425506 GGAGAGATGGTGTAGGTCCGTGG + Intronic
1018504329 6:164448226-164448248 GGTGTGTTGGTGTGTGCCTGTGG - Intergenic
1018582059 6:165316107-165316129 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1019283616 7:212586-212608 GGTGAGAGGGTGTAGGTGAGGGG + Intronic
1019366060 7:633622-633644 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1019371599 7:664772-664794 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1019425864 7:976321-976343 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1019480218 7:1263221-1263243 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1019481291 7:1268018-1268040 GGCGTGATGGTGTGTGCCTGTGG - Intergenic
1019679058 7:2334561-2334583 GGCGTGGTGGTGTGGGCCTGTGG + Intronic
1019823849 7:3267182-3267204 GGTGTGATGGTGCACACCTGTGG + Intergenic
1019987777 7:4670337-4670359 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1019998749 7:4742554-4742576 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1020053441 7:5099192-5099214 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1020101928 7:5398755-5398777 GGTGTGATGGTGTGTGCCTGTGG - Intronic
1020128216 7:5545032-5545054 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1020136533 7:5591296-5591318 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1020209295 7:6146522-6146544 GGTGTGGTGTTGTGGGCCTGTGG + Intronic
1020402123 7:7791027-7791049 GGTGTGGTGGTGTGGGCCTCTGG - Intronic
1021255223 7:18384169-18384191 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1021341960 7:19475941-19475963 TGTGTGATTGTGTAGGACAATGG - Intergenic
1021560999 7:21968583-21968605 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1021732542 7:23609720-23609742 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1021834575 7:24656660-24656682 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1022085021 7:27058214-27058236 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1022157197 7:27672387-27672409 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1022716844 7:32906420-32906442 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1022833758 7:34094362-34094384 AGTGTGATGGGGTGGGCCTGGGG + Intronic
1023254285 7:38297839-38297861 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1023406459 7:39838491-39838513 GGTGTGATGGTGCACACCTGTGG - Intergenic
1023422609 7:39998477-39998499 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1023812762 7:43925095-43925117 AATGTGATGCTGTAGGCCACGGG + Intronic
1023941777 7:44772988-44773010 GGCGTGGTGGTGTAAGCCTGTGG - Intergenic
1023963073 7:44944153-44944175 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1023989671 7:45121108-45121130 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1024312131 7:47979315-47979337 GGGGTGCTGGTGTAGGCCGCGGG - Intronic
1024945616 7:54804884-54804906 GGTGTGAGTATGTAGGGCAGGGG + Intergenic
1025153516 7:56581481-56581503 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1025247773 7:57330248-57330270 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1025698026 7:63790108-63790130 GGCGTGGGGGTGTGGGCCAGGGG + Intergenic
1025858068 7:65301753-65301775 GGTGTGATGGTGTGTACCTGTGG - Intergenic
1025975496 7:66366271-66366293 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1025982824 7:66421252-66421274 AGTGTGATGGTGCATGCCTGTGG + Intergenic
1025991406 7:66499946-66499968 GGTGTGATGGTGCACACCTGTGG + Intergenic
1026006271 7:66602584-66602606 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1026032429 7:66805882-66805904 GGTGTGATGGTGCATGCCTGTGG - Intronic
1026074265 7:67151944-67151966 GGTGTGATGGTGCATGCCTGTGG - Intronic
1026452764 7:70543808-70543830 GGAGTGCTGTAGTAGGCCAGTGG + Intronic
1026595622 7:71732132-71732154 GGTGTGGTGGCGTATGCCTGTGG + Intergenic
1026702603 7:72660232-72660254 GGTGTGATGGTGCATGCCTGTGG + Intronic
1026854680 7:73745315-73745337 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1026961466 7:74410738-74410760 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1026981493 7:74529391-74529413 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1027025423 7:74848393-74848415 GGTGTGGGGGTGTATGCCTGTGG + Intronic
1027056162 7:75050951-75050973 GGTGTGGTGGTGTACGCCTGTGG + Intronic
1027062340 7:75095726-75095748 GGTGTGGGGGTGTATGCCTGTGG - Intronic
1027159498 7:75791926-75791948 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1027246293 7:76369790-76369812 GGTGTGATGGTGCACGACTGTGG + Intergenic
1027264228 7:76485207-76485229 GGTGTGGTGGTGTATACCTGTGG - Intronic
1027315597 7:76983321-76983343 GGTGTGGTGGTGTATACCTGTGG - Intergenic
1027349001 7:77291566-77291588 GGTGTGATGGTGCACACCTGTGG + Intronic
1027393604 7:77729812-77729834 GGTGTGATGGTGTACACCTGTGG + Intronic
1027443453 7:78245607-78245629 GGTGAGGTGGTGGAGGCCAGGGG - Intronic
1027718819 7:81711781-81711803 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1028160977 7:87484144-87484166 CCTGTGGTGGTGAAGGCCAGGGG + Intergenic
1028413752 7:90558338-90558360 GGAGTGATGGGGTAGGGAAGGGG + Intronic
1028542523 7:91959022-91959044 GGCGTGGTGGTGCAGGCCTGTGG - Intronic
1028874284 7:95802977-95802999 GGTTTGGTGGAGTATGCCAGGGG - Intronic
1028921610 7:96315982-96316004 GGTGTGGTGGTGTGTGCCTGAGG + Intronic
1029075769 7:97932734-97932756 GGTGTGGTGGTGTATGTCTGTGG + Intergenic
1029130432 7:98326135-98326157 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1029248264 7:99218137-99218159 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1029250840 7:99235054-99235076 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1029289697 7:99492810-99492832 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1029360371 7:100084015-100084037 GGTGTGATGGTGCGTGCCTGTGG - Intergenic
1029370797 7:100149267-100149289 GGTGGGATGTGGAAGGCCAGGGG + Intronic
1029675014 7:102062635-102062657 GGTGTGGTGGTGTATGCCTGTGG - Intronic
1029966266 7:104743975-104743997 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1029983579 7:104901705-104901727 GGTGTGATGGTGCACACCAGTGG - Intronic
1030021917 7:105283854-105283876 GGAGTGGTGGTGTACGCCTGTGG + Intronic
1030102806 7:105961340-105961362 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1030249964 7:107431793-107431815 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1030498713 7:110332451-110332473 GGTGTGATGGTGCACACCTGTGG - Intergenic
1030504468 7:110402876-110402898 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1030845403 7:114402764-114402786 GGTGTGGTGGTGTGAGCCTGTGG - Intronic
1031015839 7:116575577-116575599 GGTGTGATGGCACAGGCCTGTGG + Intergenic
1031185909 7:118480151-118480173 GGTGTGATGGTGTATGCCTGTGG - Intergenic
1031496053 7:122449453-122449475 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1031631391 7:124047726-124047748 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1031993967 7:128216425-128216447 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1032040446 7:128555737-128555759 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1032109359 7:129062348-129062370 GGTGTGGTGGTGCAGGCCTGTGG - Intergenic
1032148596 7:129407210-129407232 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1032492546 7:132334395-132334417 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1032846309 7:135754638-135754660 GGTGTGGTGGCATAGGCCTGTGG + Intergenic
1032851271 7:135797690-135797712 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1033285993 7:140040905-140040927 GGTGTGGTGGCGTATGCCTGTGG - Intronic
1033345256 7:140521411-140521433 GGTGTGATGGTGTGTGCCTGTGG - Intronic
1033636631 7:143218033-143218055 GGCCAGATGGTGTTGGCCAGGGG + Intergenic
1033809651 7:144996806-144996828 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1034167152 7:149034240-149034262 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1034177798 7:149113873-149113895 GGTGCGGTGGTGTATGCCTGTGG + Intronic
1034250527 7:149687056-149687078 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1034521232 7:151621710-151621732 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1034554038 7:151838565-151838587 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1034620990 7:152457009-152457031 GGTGTGGTGGTGCATGCCCGTGG + Intergenic
1035182291 7:157098070-157098092 GGTGTGGTGGTGTGAGCCAGTGG - Intergenic
1035401446 7:158568984-158569006 GGTGTGAGGGATTAGGCCTGTGG + Intronic
1035957245 8:4094589-4094611 GCTGTGCTTGTGTAGGTCAGAGG + Intronic
1035967038 8:4203959-4203981 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1036241756 8:7087600-7087622 GGTGTGGTGGTGTATGTCTGTGG - Intergenic
1036260077 8:7232507-7232529 GGTGTGGTGGTGTATGTCTGTGG + Intergenic
1036306538 8:7607017-7607039 GGTGTGGTGGTGTATGTCTGTGG - Intergenic
1036357383 8:8055005-8055027 GGTGTGGTGGTGTATGTCTGTGG - Intergenic
1036444703 8:8811413-8811435 GGTATGATGGTGTGTGCCTGTGG - Intronic
1036500919 8:9313246-9313268 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1036547832 8:9789365-9789387 GGTGTGATGGTGCACACCTGTGG + Intergenic
1036847906 8:12182247-12182269 GGTGGGACTGTGTTGGCCAGAGG + Intronic
1036869274 8:12424562-12424584 GGTGGGACTGTGTTGGCCAGAGG + Intergenic
1036901121 8:12669924-12669946 GGTGTGGTGGTGTATGTCTGTGG + Intergenic
1036923655 8:12882280-12882302 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1037599950 8:20385573-20385595 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1037720862 8:21442640-21442662 GGTGTGGTGGTGCATGCCAGTGG + Intergenic
1037808766 8:22073489-22073511 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1037850431 8:22323051-22323073 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1038202100 8:25422406-25422428 GGTGTGATAGTGCATGCCTGTGG + Intronic
1038550628 8:28465473-28465495 GGTATGGTGGTGTACGCCTGTGG + Intronic
1038766521 8:30433530-30433552 GGTGTGGTGGTGAATGCCTGTGG + Intronic
1038796229 8:30712532-30712554 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1039172182 8:34760229-34760251 GGGGAGGTGGTGTAGGCCTGTGG + Intergenic
1039540842 8:38367570-38367592 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1039939361 8:42076127-42076149 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1039950341 8:42166625-42166647 GGTGTGATGTTGTGTGCCTGTGG + Intronic
1039951126 8:42173511-42173533 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1040008384 8:42640291-42640313 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1040745048 8:50632448-50632470 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1041187553 8:55316654-55316676 GATGTGGTGGGGCAGGCCAGAGG - Intronic
1041271833 8:56116697-56116719 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1041464737 8:58146682-58146704 GGAGTGACGGTGCAGGTCAGTGG - Exonic
1041895748 8:62923156-62923178 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1042255803 8:66802548-66802570 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1042359881 8:67870307-67870329 GGAGTGGTGGTGAAGGACAGAGG + Intergenic
1042537892 8:69877444-69877466 GGTGTGGTGGTGTACGCCTAAGG + Intergenic
1043391067 8:79792316-79792338 GGTGTGATGGTGCATGACTGTGG - Intergenic
1044137180 8:88601241-88601263 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1044316598 8:90756441-90756463 GATGTGGTGGTGTGTGCCAGTGG + Intronic
1044679904 8:94766928-94766950 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1044722407 8:95163713-95163735 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1044771081 8:95634901-95634923 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1044822696 8:96166187-96166209 TGTTTCATGGTGTAGGCCAGAGG - Intergenic
1044974570 8:97650867-97650889 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1044988671 8:97776303-97776325 GGGGCGATGGGGGAGGCCAGGGG + Intronic
1045043906 8:98256161-98256183 GGTGTGGTGGTGCACGCCTGTGG - Intronic
1045193758 8:99909249-99909271 GGTGTGATGGTGCACACCTGTGG - Intergenic
1045225313 8:100238315-100238337 GGTGTGTTGCTGTAGGGGAGGGG + Intronic
1045469801 8:102502094-102502116 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1045912871 8:107430659-107430681 GATGTGATGGTGGAAGCAAGAGG + Intronic
1046091317 8:109505763-109505785 GGTGTGGTGGTGTACACCTGTGG + Intronic
1046739568 8:117813864-117813886 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1046918938 8:119707017-119707039 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1046933727 8:119866884-119866906 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1047193702 8:122701710-122701732 AGTGTGATGGTGTGGACCTGTGG - Intergenic
1047380414 8:124356845-124356867 GGTGTGATGGTGCAAGCCTATGG - Intronic
1048372509 8:133791849-133791871 GGTATGATGGTGTGGGGCATGGG + Intergenic
1049112135 8:140653170-140653192 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1049289203 8:141792499-141792521 TGTGGGATGGTGGAGGCCAGTGG + Intergenic
1049414533 8:142489179-142489201 GATGTGAAGGGGGAGGCCAGGGG + Intronic
1049511068 8:143026883-143026905 GGTGTGATGGGGGTGGGCAGGGG - Intergenic
1049879105 8:145050043-145050065 GGTATGATGGTGCATGCCTGTGG + Intergenic
1050006680 9:1139532-1139554 GGTGTCATGGTGCATGCCTGTGG - Intergenic
1051274172 9:15383186-15383208 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1052708230 9:32019127-32019149 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1052854200 9:33396959-33396981 GGTGTTGTGGTGTACGCCTGTGG + Intronic
1053119718 9:35537689-35537711 GCTGTTATGGTCTTGGCCAGTGG + Intronic
1053136401 9:35653186-35653208 GGTGTGATGGTGCACGCCTGTGG + Intergenic
1053170752 9:35880446-35880468 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1053257653 9:36631712-36631734 GGTGTGGTGGTGTATACCAGTGG - Intronic
1053275982 9:36783595-36783617 GGTGTGATGGTGGGTGCCTGTGG + Intergenic
1053682212 9:40493126-40493148 GGTGTTGTGGTGTACGCCTGTGG + Intergenic
1053932198 9:43121448-43121470 GGTGTTGTGGTGTACGCCTGTGG + Intergenic
1054281502 9:63131803-63131825 GGTGTTGTGGTGTACGCCTGTGG - Intergenic
1054295310 9:63328626-63328648 GGTGTTGTGGTGTACGCCTGTGG + Intergenic
1054393328 9:64633130-64633152 GGTGTTGTGGTGTACGCCTGTGG + Intergenic
1054427977 9:65138344-65138366 GGTGTTGTGGTGTACGCCTGTGG + Intergenic
1054502401 9:65883200-65883222 GGTGTTGTGGTGTACGCCTGTGG - Intronic
1055018882 9:71647954-71647976 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1055158613 9:73096356-73096378 GGTGTGATGGTGTACACCTGTGG - Intergenic
1055354918 9:75428008-75428030 GCTGTGATGGTACAAGCCAGCGG + Intergenic
1055618037 9:78093654-78093676 GGTGTGGTGGTGTGCGCCTGTGG + Intergenic
1055879068 9:80977089-80977111 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1055919335 9:81441763-81441785 GGTGTGATGGTGCATGCTTGTGG - Intergenic
1056079003 9:83071543-83071565 GGTGTGGTGGTGTGCGCCTGTGG - Intergenic
1056194919 9:84219782-84219804 TGTGTCATGGTGCAGACCAGGGG + Intergenic
1056442083 9:86631570-86631592 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1056514022 9:87333277-87333299 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1056580335 9:87885076-87885098 GGTGACAGGGTGGAGGCCAGAGG - Exonic
1057228096 9:93303056-93303078 GGTGTGGTGGTGCAGACCTGTGG - Intronic
1057243099 9:93429934-93429956 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1057462762 9:95279363-95279385 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1057484167 9:95469100-95469122 TGTGTGTCGGTGTAGGCCTGAGG + Exonic
1057681373 9:97188916-97188938 GATCTTATGCTGTAGGCCAGGGG - Intergenic
1058696191 9:107560973-107560995 GGTGTGATGATGCATGCCTGTGG - Intergenic
1058888956 9:109344521-109344543 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1059058041 9:111005020-111005042 GGTGTGATGGCGTGTGCCTGTGG + Intronic
1059103043 9:111487927-111487949 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1059231172 9:112722786-112722808 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1059716331 9:116916698-116916720 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1060427678 9:123520018-123520040 GGTGTGATGGTGCACGCCTGTGG + Intronic
1060444645 9:123677090-123677112 GGTGTGCTGGGAGAGGCCAGGGG - Intronic
1060509959 9:124224530-124224552 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1060522407 9:124301177-124301199 TGTCTGATGGGGGAGGCCAGAGG + Intronic
1060567342 9:124604668-124604690 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1060627728 9:125128611-125128633 GGTGTGGTGGTGTGTGCCTGTGG + Intronic
1060669126 9:125452750-125452772 GGTGTGGTGGTGTGTGCCTGAGG + Intronic
1060977587 9:127774119-127774141 GAGGTGATGGTGAAGGCCACTGG - Exonic
1060984496 9:127812107-127812129 GGTGTGGTGGTGTACACCCGTGG + Intronic
1061058480 9:128237912-128237934 GGTGTAGTGGTGTACGCCTGTGG - Intronic
1061103901 9:128514197-128514219 GGTGTGGTGGCGTGCGCCAGTGG + Intronic
1061157277 9:128871570-128871592 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1061355657 9:130102921-130102943 GGTGTGATGGTGTACGTCTGTGG - Intronic
1061413806 9:130434907-130434929 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1061995795 9:134182172-134182194 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1062515842 9:136935152-136935174 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1062613997 9:137387854-137387876 GGTGTGGAGGTGGGGGCCAGAGG - Intronic
1185813048 X:3128429-3128451 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1185834576 X:3333161-3333183 GGTGTGATGGTGCATGCCTGTGG + Intronic
1185889755 X:3813814-3813836 GGTGTAGTGGTGTACGCCTGTGG - Intergenic
1185907561 X:3950192-3950214 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1185989589 X:4878242-4878264 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1186075621 X:5875107-5875129 GGTATGATGGTGTGCGCCTGTGG - Intronic
1186103245 X:6178956-6178978 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1186175851 X:6925173-6925195 GGTGTGGTGGTGCACGCCTGTGG + Intergenic
1186416344 X:9386195-9386217 GTTTTGATGGTATAGGACAGGGG - Intergenic
1186432042 X:9513340-9513362 GGCCTGATGGTGTACTCCAGTGG + Intronic
1186698430 X:12063227-12063249 GGTGTGGTGGTGTATGCCTGTGG + Intergenic
1186793074 X:13017786-13017808 GGTGTGGTGGTGTACACCTGTGG + Intergenic
1187263177 X:17706050-17706072 GGTGTGGTGGTGCATGCCTGCGG + Intronic
1187471177 X:19570814-19570836 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1187962510 X:24580033-24580055 GGTGTGGTGGTGCACGCCTGTGG + Intronic
1187971334 X:24662027-24662049 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1188843395 X:35043750-35043772 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1189363710 X:40372014-40372036 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1189424494 X:40885727-40885749 GGTGTGATGGTGCACACCTGTGG - Intergenic
1189467802 X:41290698-41290720 GGTGTGATGGTGCATGCCTGTGG + Intergenic
1189666078 X:43356206-43356228 GGTTTCATGGGGTAGGGCAGAGG + Intergenic
1189922903 X:45920894-45920916 GGTGTGGTGGTGTACACCTGTGG - Intergenic
1190084861 X:47386597-47386619 GGTGTGATGGTGCACGCCTCTGG - Intronic
1190181760 X:48198190-48198212 GGTGTGATCCTGTAGTCCCGAGG - Intronic
1190231231 X:48583520-48583542 GGTGTGATGGTGCACGCCTGTGG + Intergenic
1190258327 X:48781692-48781714 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1190717791 X:53118619-53118641 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1191789802 X:64957720-64957742 GGTGTGGTGGTGCATGCCTGTGG + Intronic
1192085151 X:68088650-68088672 GGGGTGGTGGTATAGGGCAGGGG + Intronic
1192113990 X:68393428-68393450 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1192344994 X:70295313-70295335 GGTGTGATGGTGGGCGCCTGTGG - Intronic
1192554889 X:72081518-72081540 GTTGTGAAGGTGGAGGTCAGGGG - Intergenic
1192575121 X:72237622-72237644 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1192592809 X:72374956-72374978 GGTGTGGTGGTGCATGCCTGTGG - Intronic
1192985584 X:76395684-76395706 GGTGTGTTGGAGTTTGCCAGAGG + Intergenic
1193118371 X:77797517-77797539 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1193158373 X:78199203-78199225 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1194773202 X:97930167-97930189 GGTGTGGTGGTGCATGCCTGTGG + Intergenic
1195061056 X:101195096-101195118 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1195580567 X:106496528-106496550 AATGTGATGGTGTTGGCAAGTGG + Intergenic
1195594038 X:106667454-106667476 GGTGTGGTGGTGTGCGCCTGTGG - Intronic
1195987368 X:110645254-110645276 GGTGTGTTGGAGTTTGCCAGAGG + Intergenic
1196436206 X:115676836-115676858 GGTGTGGTGGTGCAAGCCGGTGG + Intergenic
1196862829 X:120043666-120043688 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1196880273 X:120192678-120192700 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1196908494 X:120462380-120462402 GGTGTGATGGTGCATGCCTGTGG + Intronic
1197209608 X:123818013-123818035 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1197300218 X:124770543-124770565 GGTGTGATGGTGCACACCTGTGG - Intronic
1197756197 X:129996757-129996779 GGTGTGATGGTGCACACCTGTGG - Intronic
1197945388 X:131833140-131833162 GGTGTGGTGGTGTGTGCCTGTGG - Intergenic
1198068859 X:133128051-133128073 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1198186712 X:134260290-134260312 GGTGTGATGGTGCATGCCTGTGG - Intergenic
1198404948 X:136303178-136303200 GGTGTGGTGGTGGATGCCTGTGG + Intronic
1198521436 X:137457037-137457059 GGTGTGGTGGTGCATGCCTGTGG - Intergenic
1198564456 X:137889963-137889985 GGTGTGATGGTGCATACCTGAGG + Intergenic
1199651816 X:149952461-149952483 GGTGTGCTGGTGCATGCCTGTGG - Intergenic
1199963694 X:152800543-152800565 GATGTGGTGGTGCAGGCCTGTGG + Intergenic
1200087714 X:153617179-153617201 GGTGTGGTGGTGCACGCCTGTGG - Intergenic
1200090016 X:153630899-153630921 GGTGTGGTGGTGTGTGCCTGTGG + Intergenic
1200139500 X:153892089-153892111 GGTGTGGTGGTGTGTGCCTGTGG - Intronic
1200142580 X:153909388-153909410 CGTGTGCTGTTCTAGGCCAGAGG - Intronic
1200166541 X:154039475-154039497 GGTGTGGTGGTGTGCGCCTGTGG + Intronic
1200238354 X:154480032-154480054 GGTGTGATGGTGCACACCTGTGG + Intergenic
1200250629 X:154552033-154552055 TGTGAGATGGTGCAGCCCAGTGG + Exonic