ID: 1070795235

View in Genome Browser
Species Human (GRCh38)
Location 10:79212451-79212473
Sequence TTAATCTGGTGTGATGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 270}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795235_1070795239 -2 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795239 10:79212472-79212494 AAAAAATTTTTTGCACAGATGGG No data
1070795235_1070795244 12 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795244 10:79212486-79212508 ACAGATGGGGCTGGGCATGGTGG No data
1070795235_1070795238 -3 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795238 10:79212471-79212493 TAAAAAATTTTTTGCACAGATGG No data
1070795235_1070795242 4 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795235_1070795240 -1 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795240 10:79212473-79212495 AAAAATTTTTTGCACAGATGGGG No data
1070795235_1070795243 9 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795243 10:79212483-79212505 TGCACAGATGGGGCTGGGCATGG No data
1070795235_1070795241 3 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795241 10:79212477-79212499 ATTTTTTGCACAGATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795235 Original CRISPR TTAATCTGGTGTGATGGTGT AGG (reversed) Intronic
900083870 1:877513-877535 TTAATCTGATGTGGTGCTGTTGG - Intergenic
901946298 1:12706803-12706825 TTAAGCTGGTTTTATGGTATAGG - Intergenic
903629395 1:24755456-24755478 TTAGTCTGGTGTGGTGGTGGTGG + Intronic
903807404 1:26015356-26015378 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
904245445 1:29184606-29184628 TTAGCCAGGTGTGATTGTGTGGG + Intergenic
905353620 1:37365087-37365109 TTAATCCGGTGTGTCTGTGTGGG + Intergenic
906677881 1:47706744-47706766 TTAACCAGGTGTGGTGGTGTGGG - Intergenic
908754502 1:67456582-67456604 TTACTCTGTTGTTATGGGGTGGG - Intergenic
908912962 1:69094065-69094087 TTAATCGGGTGTGGTGGTGGTGG + Intergenic
909017130 1:70392414-70392436 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
909546490 1:76854118-76854140 TAAGACTGGAGTGATGGTGTAGG - Intergenic
910112393 1:83696602-83696624 TTAATCTGTTCTTATGGTGGAGG - Intergenic
910119776 1:83774241-83774263 ATAATTTGGTGTGAGAGTGTGGG - Intergenic
910501224 1:87893511-87893533 TTAAAATGTTCTGATGGTGTTGG + Intergenic
913450712 1:118990627-118990649 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
915132707 1:153706828-153706850 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
915560738 1:156685998-156686020 TTAGCCGGGTGTGGTGGTGTGGG - Intergenic
916048367 1:161017793-161017815 GTAGACTGGTGTGAAGGTGTGGG - Intronic
917311725 1:173685791-173685813 TTAAGCTGGTTTTATGGTATGGG - Intergenic
917574579 1:176307653-176307675 TTCATCTAGTTTAATGGTGTTGG + Intergenic
917970951 1:180207348-180207370 TTAGCCGGGTGTGATGGTGAAGG + Intergenic
919302966 1:195793525-195793547 TGAATCTGCTGTGATTCTGTGGG - Intergenic
919855967 1:201706359-201706381 TTAATCATGTGGGATGGTTTGGG - Intronic
920664421 1:207950994-207951016 TTAAGTTGGAGGGATGGTGTGGG + Intergenic
920672100 1:208012055-208012077 TTAACCAGGAGTGGTGGTGTGGG - Intergenic
921130491 1:212215553-212215575 TTAACCAGGTATGGTGGTGTGGG - Intergenic
921516576 1:216099696-216099718 TTGATATGAGGTGATGGTGTGGG + Intronic
924243832 1:242062848-242062870 TTAATCTGATGTGGCGCTGTTGG - Intergenic
924817456 1:247455183-247455205 TCCATCTTGTGTGATGGAGTAGG - Intergenic
1062763372 10:44425-44447 TTAATCTGATGTGGTGCTCTTGG + Intergenic
1063376166 10:5555797-5555819 TTAGCCTGGTGTGGTGGTGCAGG - Intergenic
1063556100 10:7081252-7081274 TAAATCGGGTGTGTTGGTGAAGG - Intergenic
1063637556 10:7798382-7798404 TTAGCCAGGTGTGATGGTGGGGG - Intronic
1063829127 10:9932023-9932045 CTAATCTAGTGTGTTGGTATTGG + Intergenic
1063990149 10:11552768-11552790 CTGAGATGGTGTGATGGTGTTGG - Intronic
1065005421 10:21375385-21375407 TTAACCAGGAGTGGTGGTGTGGG + Intergenic
1065568883 10:27047472-27047494 TTAGCCTGGTGTGGTGGTGCGGG + Intronic
1069384221 10:67869937-67869959 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1070628257 10:78066559-78066581 TAAATGTGTTGTGATGGGGTGGG - Intergenic
1070795235 10:79212451-79212473 TTAATCTGGTGTGATGGTGTAGG - Intronic
1072016498 10:91352100-91352122 TTATTCTAGTGTGATGCTCTGGG - Intergenic
1072427976 10:95346123-95346145 TCAAGCTGGTGTGATAGAGTTGG - Intronic
1072954014 10:99873139-99873161 TTGTTCTGGTGTGATGATGCTGG + Intergenic
1073304881 10:102495128-102495150 TTACTCGGGTGTGGTGGTGCGGG + Intronic
1073653956 10:105392361-105392383 TTATTCTGGGATGAGGGTGTGGG - Intergenic
1074852702 10:117451531-117451553 TTAGTCGGGTGTGGTGGTGCAGG - Intergenic
1075285558 10:121182657-121182679 CTAATCTGGTGTGCTGGGTTTGG + Intergenic
1076392719 10:130115464-130115486 TTAGTCAGGTGTGGTGGTGCAGG + Intergenic
1078383087 11:10861693-10861715 TTAGCCTGGTGTGGTGGTGGTGG - Intergenic
1078778642 11:14416356-14416378 TTAGCCGGGTGTGGTGGTGTGGG + Intergenic
1080239734 11:30113083-30113105 TTATTCTTTTGTGATGGTGTGGG - Intergenic
1080274505 11:30488436-30488458 TTTATCTGATGTGTTGGTGGTGG - Intronic
1081326652 11:41753836-41753858 GTAATCTGGTGTGATCTTCTGGG + Intergenic
1081975380 11:47230971-47230993 TTAGCTGGGTGTGATGGTGTGGG + Intronic
1082698244 11:56397359-56397381 TGAATCTGGTGTGATTCTGGGGG - Intergenic
1082963667 11:58943443-58943465 TGAATCTGCTGTGATTTTGTAGG + Intronic
1088026009 11:105184252-105184274 TAATTCTGGTGTGGTGGTGGTGG - Intergenic
1090842034 11:130498740-130498762 TTAATGTGGTGGTAAGGTGTGGG + Intergenic
1091427363 12:402730-402752 TTAAGGTGTTGTAATGGTGTGGG + Intronic
1091755492 12:3048608-3048630 TTAGCCAGATGTGATGGTGTGGG - Intergenic
1093322550 12:17731550-17731572 TTAATCTGGACTGACAGTGTTGG - Intergenic
1093989966 12:25578918-25578940 TTAATTTGGTTAGATGGTTTGGG - Intronic
1095206917 12:39448696-39448718 TTAATCTGCTGTGATTCTGGGGG + Intergenic
1096097830 12:48948662-48948684 TTAGCCGGGTGTGATGGTGTGGG + Intronic
1096987308 12:55768572-55768594 TTAGCCTGGTGTGGTGGTGGTGG - Intronic
1097147176 12:56949789-56949811 TTAACTTGGTGTCTTGGTGTGGG + Intergenic
1097173573 12:57130113-57130135 TTAAGCTGGGGTCATGGGGTTGG + Intronic
1098623018 12:72627825-72627847 TTAGCCAGGTGTGGTGGTGTGGG - Intronic
1099323082 12:81176420-81176442 TTAGCCAGGTGTGGTGGTGTGGG + Intronic
1099907127 12:88784736-88784758 TTAATGTGGTGGTAAGGTGTGGG - Intergenic
1100102870 12:91130616-91130638 TTAATTTGGAGTGATGGTGGCGG - Intergenic
1101866198 12:108521751-108521773 TTCAGCTGGTGTGATGATTTGGG - Intronic
1101938258 12:109077805-109077827 TTACTCTTGTGTGTTTGTGTTGG + Intronic
1103405330 12:120671047-120671069 TCAATCTGGTGGGTGGGTGTGGG + Intergenic
1107185298 13:37511223-37511245 TGAATCTGTGGTGATGGTGATGG - Intergenic
1107586820 13:41858457-41858479 TTAGCCGGGTGTGGTGGTGTGGG + Intronic
1109796729 13:67324404-67324426 TTAATGTAGTGAGATGGTGAGGG + Intergenic
1111035002 13:82660879-82660901 TTAAAATTGTGTGTTGGTGTTGG - Intergenic
1112329294 13:98464640-98464662 TTAGCCTGGTGTGGTGGTGCAGG - Intronic
1113005898 13:105701763-105701785 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1113540280 13:111101800-111101822 TTAGTCTGGCATGATGGTGCGGG + Intergenic
1113724573 13:112588388-112588410 ATAATTTGGTGTGTGGGTGTGGG + Intergenic
1114223470 14:20717563-20717585 TTAAGCCGGTTTTATGGTGTGGG - Intergenic
1115598311 14:34930699-34930721 TTGATCTGGTCTGATACTGTTGG + Intergenic
1116171712 14:41410800-41410822 TTAATCTGCTGTGATTATGGGGG - Intergenic
1116483394 14:45418113-45418135 TGAATCTGCTGTGATGCTGGGGG + Intergenic
1117520104 14:56542736-56542758 TTAGCCTGGTGTGGTGGTGTGGG + Intronic
1117559010 14:56916996-56917018 TTAGCCTGGTGTGGTGGTGTGGG - Intergenic
1118021376 14:61718796-61718818 TTCATCTGGTTAGATGGTGGAGG - Intronic
1118067618 14:62208868-62208890 TTAATATGGTGGTAAGGTGTGGG + Intergenic
1119318607 14:73716026-73716048 TGGATATGGTGAGATGGTGTGGG + Exonic
1120433540 14:84450438-84450460 TTAACCGGGCGTGATGGTGCAGG - Intergenic
1122718721 14:103710194-103710216 TGAACCTGGTGTGGTGGTGCAGG - Intronic
1122872544 14:104646733-104646755 ATTAGCTGGTGTGTTGGTGTTGG - Intergenic
1123069768 14:105636916-105636938 GTGATGTGGTGTGATGGTGTGGG - Intergenic
1123486941 15:20749353-20749375 TTAGTCTGGTGTGGTGGCGAGGG - Intergenic
1123543428 15:21318411-21318433 TTAGTCTGGTGTGGTGGCGAGGG - Intergenic
1123917320 15:25045004-25045026 TTAGCCAGGTGTGGTGGTGTTGG - Intergenic
1123952860 15:25299929-25299951 TTGATGTGGTGATATGGTGTTGG - Intergenic
1124505134 15:30265700-30265722 TTAAACTGGTGTGATTTTTTGGG - Intergenic
1124738418 15:32272935-32272957 TTAAACTGGTGTGATTTTTTGGG + Intergenic
1127237571 15:57071487-57071509 TTAGCCGGGTGTGGTGGTGTTGG + Intronic
1128144303 15:65323964-65323986 TTAGCCTGGTGTGGTGGTGTGGG + Intergenic
1128824886 15:70704847-70704869 TGAATCTGCTGTGATTTTGTGGG - Intronic
1132212272 15:100033175-100033197 TTGATCAGGTGTGATGGCTTGGG - Intronic
1202951748 15_KI270727v1_random:45535-45557 TTAGTCTGGTGTGGTGGCGAGGG - Intergenic
1134185048 16:12078326-12078348 TTAGTCGGGTGTGGTGGTGCGGG + Intronic
1134756066 16:16668572-16668594 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1134990002 16:18690592-18690614 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
1135905720 16:26510078-26510100 TTAGTCAGGTGTGGTGGTGTTGG + Intergenic
1135947765 16:26880027-26880049 TACATTTGGTGTGATCGTGTTGG - Intergenic
1137607281 16:49795308-49795330 TGACTCTAGTGTGATGGGGTGGG - Intronic
1138078020 16:54061987-54062009 TTATTTTGGTGTGCTGTTGTGGG + Intronic
1139575408 16:67838778-67838800 TTAGTCGGGTGTAGTGGTGTGGG + Intronic
1140470240 16:75209677-75209699 TTAGTCAGGTGTGATGGCGCAGG + Intergenic
1140941064 16:79722523-79722545 TCATAGTGGTGTGATGGTGTTGG + Intergenic
1141232380 16:82181322-82181344 TTAGTCAGGTGTGATGGTGCAGG - Intergenic
1142324392 16:89405103-89405125 TTAACCTGGTGTCACGGTGGAGG + Intronic
1142826668 17:2516814-2516836 TTAGCCGGGTGTGGTGGTGTGGG + Intergenic
1142826680 17:2516880-2516902 TTAGCCGGGTGTGGTGGTGTGGG + Intergenic
1142971076 17:3611948-3611970 TTAGCCAGGTGTGGTGGTGTGGG - Intronic
1143574041 17:7779379-7779401 TAAATCTGGTGTGGTCCTGTGGG + Exonic
1144303594 17:13946985-13947007 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1148743525 17:49906279-49906301 AGAATCTGATGTGATGGTGAGGG + Intergenic
1148917515 17:50994600-50994622 TTAGCCAGGTGTGGTGGTGTGGG + Intronic
1150328833 17:64278270-64278292 TTAACTGGGTGTGGTGGTGTGGG - Intergenic
1150377088 17:64690297-64690319 TTAGCCGGGTGTGGTGGTGTGGG - Intergenic
1150697523 17:67418705-67418727 TTAGCCTGGCGTGATGGTGGGGG - Intronic
1151306178 17:73263938-73263960 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1152478409 17:80533571-80533593 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1152956282 18:44756-44778 TTAATCTGATGTGGTGCTCTTGG + Intergenic
1155966999 18:32045410-32045432 TTAACCTGGTGTGGTGGTGGGGG + Intronic
1157082573 18:44542223-44542245 TTGACCAGGTGTGAAGGTGTAGG - Intergenic
1157869848 18:51219934-51219956 TTTAAATGGTGTGATGGTGGTGG + Intergenic
1158058585 18:53312189-53312211 TTAGCCTGGTGTGGTGGTGGCGG + Intronic
1158937984 18:62382742-62382764 TTCAACTGGTGTGGTGGTGTAGG - Intronic
1159609355 18:70509029-70509051 TTAATCTTCTCTGAGGGTGTGGG - Intergenic
1160880434 19:1317212-1317234 TTAGCCAGGTGTGATGGTGTGGG + Intergenic
1161562689 19:4982144-4982166 TTAGCCTGGTGTGTTGGTGCAGG + Intronic
1163813469 19:19449060-19449082 TTAATCAGGGAAGATGGTGTAGG - Intronic
1167818351 19:51904184-51904206 TTAATCTGCTGTGATTCTGGGGG + Intronic
1168548229 19:57271592-57271614 TTAGTTGGGTGTGTTGGTGTGGG + Intergenic
925822359 2:7812788-7812810 TGAATCTGCTGTGATTCTGTGGG - Intergenic
925844532 2:8023590-8023612 TTACTCTGCTGTGCTGGTGGCGG - Intergenic
927673119 2:25085609-25085631 TTAGTCAGGTGTGGTGGTGCAGG - Intronic
929446896 2:42009053-42009075 AGAATGTGGTGTGATGGTGGTGG + Intergenic
931348403 2:61467767-61467789 TTAGCCGGGTGTGGTGGTGTAGG - Intronic
931384150 2:61782093-61782115 TTAATCTGCTGTGATTTTGAGGG - Intergenic
931547526 2:63406179-63406201 TTAATTTGGTGATAAGGTGTAGG - Intronic
933271774 2:80240464-80240486 GTAATCTGGTGAGAAGGAGTGGG - Intronic
933439863 2:82298377-82298399 TTAAACTTGAGTGATGATGTAGG - Intergenic
935158798 2:100510831-100510853 TTAGCCGGGTGTGGTGGTGTGGG + Intergenic
935246863 2:101226319-101226341 TGAATCTGCTGTGATTGTGGGGG + Intronic
938401713 2:130998334-130998356 TTAGTCTGGTGTGTTGGTTAGGG + Intronic
938609384 2:132931421-132931443 TGAATCTGCTGTGATAGTGGGGG + Intronic
940021126 2:149156768-149156790 TGAATCTGGTGTGGTGTGGTTGG + Intronic
940161816 2:150721606-150721628 TTAGCCAGGTGTGATGGTGCAGG + Intergenic
942672951 2:178396026-178396048 TTGATGTGGTGTGATTGTGCTGG + Intronic
944861958 2:203823573-203823595 TTCATCTGGTGCAATGATGTTGG - Intergenic
944987187 2:205190751-205190773 TTGATCTGTTGTGATGATGTGGG - Intronic
946960234 2:224977289-224977311 TGAATCTGGTGTGTGGGTATTGG + Intronic
947274023 2:228371112-228371134 TTAGCCTGGTGTGGTGGTGCAGG - Intergenic
947750046 2:232527150-232527172 TTAGCCGGGTGTGATGGTGTGGG + Intronic
948695035 2:239729081-239729103 TTGATCTGGTGAGAAGGTCTGGG - Intergenic
1170361521 20:15551719-15551741 TTAGCCGGATGTGATGGTGTGGG + Intronic
1170546807 20:17441480-17441502 TTAATCTGTTTTCATGCTGTTGG + Intronic
1172460249 20:35112623-35112645 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
1172859531 20:38036431-38036453 CTAAACTGGTATGATGGGGTGGG - Intronic
1173330414 20:42071541-42071563 TTTCCCTGGTGTAATGGTGTAGG + Intergenic
1174011918 20:47456503-47456525 TTCTTCTGGTGTGGTGGTCTTGG + Intergenic
1174463004 20:50696256-50696278 TTAGTCGGGTGTGATGGCGCGGG + Intergenic
1174820356 20:53721542-53721564 TTAGTCAGGTGTGGTGGTGCAGG - Intergenic
1176692465 21:9932566-9932588 TGAATCTGCTGTGATTGTGGGGG - Intergenic
1177066011 21:16437152-16437174 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
1177242901 21:18483918-18483940 TTAATCTGTTGTTTAGGTGTTGG - Intronic
1177298316 21:19205813-19205835 TGAATCTGCTGTGATTCTGTGGG - Intergenic
1177305287 21:19307270-19307292 TTTATCTGGTGGGGTGATGTGGG - Intergenic
1177580307 21:23013796-23013818 TTAATCTGATGTTATGCTGGAGG - Intergenic
1180732806 22:17994564-17994586 TTAGTCGGGTGTGGTGGTGTGGG + Intronic
1181517553 22:23423901-23423923 TTAGTCAGGTGTGGTGGTGTGGG + Intergenic
1182423832 22:30261568-30261590 TTAATTTGGTCTGAGGATGTGGG + Intergenic
1182627206 22:31656195-31656217 TTAGACGGGTGTGATGGTGGTGG + Intronic
1182912122 22:33993505-33993527 TTAATCTGGTTTGTTCCTGTGGG - Intergenic
1183643693 22:39109621-39109643 TGAATCTGCTGTGATTCTGTGGG + Intergenic
1183921832 22:41176071-41176093 TTAGCCAGGTGTGGTGGTGTGGG + Intronic
950050550 3:9985745-9985767 TTAGTCAGGTGTGGTGGTGCGGG + Intronic
951102185 3:18702384-18702406 TTAAACTGGTGTGCTGGTGGTGG - Intergenic
951600933 3:24374007-24374029 TGAATCTGGTGTGATTCTGGGGG + Intronic
954042210 3:47897271-47897293 TTAGTCAGGTGTGGTGGTGTGGG - Intronic
956217880 3:66869116-66869138 TTAGCCAGGTGTGATGGCGTGGG - Intergenic
956853741 3:73255862-73255884 TAAATCTGATGTGAAGCTGTGGG + Intergenic
957226099 3:77448926-77448948 TTCATTTGGTGTGATTGTGTTGG + Intronic
957771207 3:84695180-84695202 TTTATTTGTTATGATGGTGTTGG - Intergenic
958979815 3:100708362-100708384 TTAATCTGCTGTGATTCTGGGGG + Intergenic
960106276 3:113801006-113801028 TTAGCTGGGTGTGATGGTGTGGG + Intronic
960714218 3:120559783-120559805 TTCATCTGGTGTGAGGGGGAGGG - Intergenic
964541761 3:157787290-157787312 TTGGTCTGGTGTGTTGGTGTTGG + Intergenic
965481701 3:169226606-169226628 TTAATTCCGTGTTATGGTGTTGG - Intronic
965563141 3:170080845-170080867 TTACTCGGGTGTGGTGGTGGGGG - Intronic
965643407 3:170855353-170855375 TTAGCCAGGTGTGGTGGTGTGGG + Intronic
968358053 3:198123485-198123507 TTAATCTGATGTGGTGCTCTTGG - Intergenic
970371308 4:15409571-15409593 TGAATCTAGTGAGATGCTGTTGG + Intronic
973995720 4:56456553-56456575 TTAACCAGGTGTGATGGTGTGGG - Intronic
974062876 4:57051577-57051599 ATAATCTGTTGGGGTGGTGTTGG + Intronic
976241361 4:82960578-82960600 TTAGCCAGGTGTGGTGGTGTGGG - Intronic
976629634 4:87223095-87223117 TTAGCCAGGTGTGGTGGTGTGGG - Intronic
980365055 4:131792787-131792809 TGAATCTGCTGTGATTGTGGGGG - Intergenic
981032326 4:140137766-140137788 TTATTCTGAAGTAATGGTGTAGG - Intronic
982053062 4:151522639-151522661 TTAAGCTTGTTTGATGGTTTTGG - Intronic
982565792 4:156985087-156985109 TTAGCCGGGTGTGGTGGTGTAGG + Intergenic
982843210 4:160219186-160219208 GTAATCTGCAGTGTTGGTGTTGG - Intergenic
983045224 4:162979077-162979099 TTATTCTGATGTCATGGTTTGGG - Intergenic
983579590 4:169294034-169294056 GTAATGTGGTGGTATGGTGTTGG - Intergenic
984104532 4:175528481-175528503 TTAATATTTTGTGTTGGTGTTGG + Intergenic
984494638 4:180480758-180480780 GTAATCTGGTGAGATGGGGGAGG + Intergenic
984963363 4:185119696-185119718 TTAGCCAGGTGTGTTGGTGTGGG - Intergenic
985440400 4:189979600-189979622 TTAATCTGATGTGGTGCTCTTGG + Intergenic
986127703 5:4898828-4898850 TTAGCCAGGTGTGATGGTGGGGG + Intergenic
986276300 5:6277925-6277947 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
987064204 5:14271933-14271955 TTAATATGGTTTGATTTTGTGGG + Intronic
987354456 5:17050503-17050525 ACAAGCTGGTGTGATGGCGTGGG + Intergenic
988454458 5:31374855-31374877 TTAAACTGGGGTGATGGAGGTGG - Intergenic
989263422 5:39444675-39444697 TTAGCCAGGTGTGGTGGTGTGGG + Intronic
992300195 5:75370162-75370184 TTAATCTGGTGGGATGCTGGAGG - Intronic
992438210 5:76775398-76775420 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
995135607 5:108676622-108676644 TTAATTTGGTGGGATGATTTTGG + Intergenic
999113754 5:149143214-149143236 TTAGCCAGGTGTGGTGGTGTGGG + Intronic
999576900 5:152988884-152988906 TGAGTCTGGGGTGATGGGGTAGG - Intergenic
1001394969 5:171411780-171411802 TTAGTCTGGTTTGATTGTCTTGG + Intergenic
1003594651 6:7463463-7463485 TTAGCCAGGTGTGCTGGTGTGGG + Intergenic
1003890545 6:10560233-10560255 TTAACCGGGCGTGATGGTGGGGG - Intronic
1005291233 6:24380934-24380956 CTAACCAGGTGTGGTGGTGTGGG + Intergenic
1005638547 6:27773607-27773629 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
1006975523 6:38097220-38097242 TTAACCGGGTGTGCTGGTGCAGG - Intronic
1007096048 6:39213877-39213899 TTAGCCGGGTGTGGTGGTGTGGG + Intronic
1009415736 6:63414766-63414788 TTAGCCTTGTGTGGTGGTGTGGG + Intergenic
1012547573 6:100436882-100436904 TTAACCGGGTGTGGTGGTGCGGG - Intronic
1012681917 6:102193043-102193065 TTAACCGGGTGTGGTGGTGGGGG - Intergenic
1014978546 6:127919374-127919396 TTAATCTGGGGTGAGTGTGTGGG + Intergenic
1015105761 6:129534213-129534235 TTAATCTTGAGTGATTGTTTTGG + Intergenic
1016185912 6:141197197-141197219 TTAAATTGGTGTCCTGGTGTGGG + Intergenic
1016420567 6:143878329-143878351 TTAGCCAGGTGTGGTGGTGTGGG + Intronic
1016937600 6:149459032-149459054 TCAAACTGGGGTGAGGGTGTGGG - Intronic
1017164441 6:151394002-151394024 TTAGCCAGGCGTGATGGTGTGGG + Intergenic
1017184900 6:151591156-151591178 TTAATCTGGTGTGCTTCAGTTGG + Intronic
1019922219 7:4170298-4170320 TTAGCCTGGTGTGGTGGTGCAGG + Intronic
1020060442 7:5147687-5147709 TTAGCCAGGTGTGATGGTGTAGG + Intergenic
1022292083 7:29014476-29014498 TTAACCAGGTGTGGTGGTGCAGG - Intronic
1022385172 7:29892616-29892638 TTAATCTGCTGTGAGGCTTTAGG - Intronic
1023799541 7:43821950-43821972 TTAAGCTGGTTTTATGGTATGGG + Intergenic
1024826705 7:53398770-53398792 TTAATCTTATGTGAGGATGTTGG - Intergenic
1024826833 7:53400338-53400360 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1024881775 7:54095047-54095069 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1027133756 7:75610047-75610069 TTAGCCAGGTGTGGTGGTGTGGG - Intronic
1027821429 7:83050087-83050109 TTAATATTGTGTGATGGTTGAGG + Intronic
1028316162 7:89405473-89405495 TTCATCTGTTTTGATGGTGGTGG + Intergenic
1029609245 7:101617973-101617995 TTGATCTGGTGTGATGGGGGAGG - Intronic
1029637191 7:101792899-101792921 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1029982405 7:104891221-104891243 TGAATCTGCTGTGATTGTGGGGG - Intronic
1031184233 7:118455542-118455564 TTAGTCTGGTGTGGTGATGCAGG + Intergenic
1032513840 7:132492645-132492667 TGAATCTGGGGTGATGGGGGAGG + Intronic
1033411727 7:141124218-141124240 TTAGTCAGGCGTGGTGGTGTGGG + Intronic
1034055140 7:148026302-148026324 TTAAATTAGTGTGATGGTGCAGG + Intronic
1036955206 8:13180763-13180785 TTAATTTCATGTGATGGTTTTGG - Intronic
1037333802 8:17772295-17772317 TTAATATAGTATAATGGTGTAGG - Intronic
1037555541 8:20018630-20018652 TTAGCCAGGTGTGATGGTGCAGG + Intergenic
1040041919 8:42924824-42924846 TTATCCAGGTGTGGTGGTGTGGG + Intronic
1042133381 8:65611078-65611100 TTAGCCAGGTGTGATAGTGTAGG - Intronic
1044058101 8:87597905-87597927 TTAGCCAGGTGTGGTGGTGTGGG - Intronic
1045225308 8:100238308-100238330 TTGCTCTGGTGTGTTGCTGTAGG + Intronic
1045519824 8:102894116-102894138 TTAATCTGGTGTGGGGGTTGGGG - Intronic
1046130039 8:109955512-109955534 ATAATGTGGTGTTATGATGTGGG + Intergenic
1046392539 8:113594546-113594568 TTAGCCAGGTGTGGTGGTGTGGG - Intergenic
1046420976 8:113981912-113981934 TTAATGTGGTGTCATTGTCTGGG + Intergenic
1047410885 8:124623784-124623806 TTAGTCGGGTGTGGTGGTGTGGG - Intronic
1053629408 9:39918638-39918660 TGAATCTGCTGTGATTGTGGGGG - Intergenic
1053776356 9:41544912-41544934 TGAATCTGCTGTGATTGTGGGGG + Intergenic
1054214479 9:62332064-62332086 TGAATCTGCTGTGATTGTGGGGG + Intergenic
1054365377 9:64333575-64333597 TGAATCTGCTGTGATTGTGGGGG - Intergenic
1054673004 9:67823290-67823312 TGAATCTGCTGTGATTGTGGGGG - Intergenic
1054838432 9:69706427-69706449 TTAGCCGGGTGTGCTGGTGTAGG - Intergenic
1055558320 9:77498224-77498246 TTAGTCGGGGGTGATGGTGCAGG + Intronic
1056120651 9:83484562-83484584 TTAGCCAGGTGTGATGGCGTGGG - Intronic
1057959458 9:99440474-99440496 TTCCTGTGGTGTGATGTTGTTGG + Intergenic
1060004227 9:119985509-119985531 TTTATATGCTGTGTTGGTGTTGG - Intergenic
1062741921 9:138180020-138180042 TTAATCTGATGTGGTGCTCTTGG - Intergenic
1185529192 X:803653-803675 TTAGTTGGGCGTGATGGTGTGGG + Intergenic
1186149006 X:6654604-6654626 TGAATCTGCTGTGATTGTGAGGG - Intergenic
1186293032 X:8120841-8120863 TTAATTTGGGGTGAGGGTGGTGG - Intergenic
1188770696 X:34149695-34149717 TTAGCCAAGTGTGATGGTGTGGG - Intergenic
1190957513 X:55210110-55210132 TTAGCCAGGTGTGGTGGTGTGGG - Intronic
1192814740 X:74578639-74578661 TTACCCTGATGTGGTGGTGTGGG + Intergenic
1194216246 X:91133619-91133641 TTAGTTGGGTGTGATGGTGCGGG + Intergenic
1198046223 X:132905877-132905899 TTAGCCAGGTGTGGTGGTGTAGG + Intronic
1199781072 X:151060086-151060108 TTAGCCAGGTGTGGTGGTGTGGG + Intergenic
1200053321 X:153445986-153446008 GTAAGCTGGTGTGGTGGGGTTGG - Intronic
1200706356 Y:6446045-6446067 ATAATCTGGTGTGTTGTTGAGGG + Intergenic
1200769277 Y:7108584-7108606 TTAAGCTGGTTTTATGGTATGGG + Intergenic
1201027755 Y:9718663-9718685 ATAATCTGGTGTGTTGTTGAGGG - Intergenic
1201758383 Y:17514234-17514256 TTAATCTGATGTGGTGCTCTTGG + Intergenic
1201843172 Y:18391756-18391778 TTAATCTGATGTGGTGCTCTTGG - Intergenic