ID: 1070795236

View in Genome Browser
Species Human (GRCh38)
Location 10:79212457-79212479
Sequence AATTTTTTAATCTGGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 353}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795236_1070795243 3 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795243 10:79212483-79212505 TGCACAGATGGGGCTGGGCATGG No data
1070795236_1070795238 -9 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795238 10:79212471-79212493 TAAAAAATTTTTTGCACAGATGG No data
1070795236_1070795244 6 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795244 10:79212486-79212508 ACAGATGGGGCTGGGCATGGTGG No data
1070795236_1070795239 -8 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795239 10:79212472-79212494 AAAAAATTTTTTGCACAGATGGG No data
1070795236_1070795241 -3 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795241 10:79212477-79212499 ATTTTTTGCACAGATGGGGCTGG No data
1070795236_1070795240 -7 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795240 10:79212473-79212495 AAAAATTTTTTGCACAGATGGGG No data
1070795236_1070795242 -2 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795236 Original CRISPR AATTTTTTAATCTGGTGTGA TGG (reversed) Intronic
900825151 1:4920414-4920436 TATTTTTTGATCTGGTGAGACGG + Intergenic
901046899 1:6402227-6402249 AATTTTTTAATTTTTTGTGGAGG - Intergenic
901774682 1:11552202-11552224 AGCTTTTTAAACTGCTGTGATGG - Intergenic
902726974 1:18343611-18343633 TATTTTTATATATGGTGTGAGGG + Intronic
904204626 1:28845736-28845758 AATTTTTGTATATGGTGTAAGGG + Intronic
905718810 1:40177759-40177781 AATTTTTATATACGGTGTGAGGG + Intronic
908213386 1:61924703-61924725 AATTTATTAATATGCTCTGAAGG + Intronic
908960760 1:69694522-69694544 AATTTTTTGACCTGGTGATATGG + Intronic
909101344 1:71353079-71353101 AATTTTTGTATATGGTGTAAGGG - Intergenic
910648641 1:89540409-89540431 AATTTTGTTATCTGTTGTAATGG + Intronic
911340857 1:96634498-96634520 AATTTTTTAATGTGTTGTTGTGG + Intergenic
911572475 1:99534646-99534668 AATTTTTTATTCTCATGAGATGG + Intergenic
911624837 1:100111361-100111383 AATTTTTTAATGATGTGAGAAGG - Intronic
912391391 1:109305644-109305666 AATATATTAAGCTGGGGTGATGG - Intronic
912609037 1:111024248-111024270 AATTTTTGTATCTGGTGAAAGGG - Intergenic
912968253 1:114256298-114256320 AATTTTTCAAACTGGTTTGCAGG - Intergenic
913653204 1:120938001-120938023 AATTAATTAACCTGGTGTGGTGG - Intergenic
914167900 1:145191038-145191060 AATTAATTAACCTGGTGTGGTGG + Intergenic
914518893 1:148398089-148398111 AATTAATTAACCTGGTGTGGTGG - Intergenic
914643385 1:149632156-149632178 AATTAATTAACCTGGTGTGGTGG - Intergenic
915991039 1:160516833-160516855 AATTTTTGTATAAGGTGTGAGGG - Intronic
917206320 1:172574977-172574999 ATTTTTTTAACGTGGTGAGAGGG + Intronic
918794152 1:188871399-188871421 AATTTTTTATTGTACTGTGATGG - Intergenic
919447776 1:197730640-197730662 AATTTTTTAATCTGTTACGGTGG + Intronic
920710510 1:208290149-208290171 AATTTTTTTTTCTGCTGTAATGG - Intergenic
920903890 1:210140668-210140690 GATTTTTTAATACGGTGTGAGGG + Intronic
921507609 1:215991288-215991310 AATTTTTTAGTCTGGTATTCAGG - Intronic
921652779 1:217698433-217698455 AATTTTTTTTTTTGGTGGGAGGG - Intronic
923855835 1:237844446-237844468 AATTTTTGTATGTGGTGTAAGGG - Intergenic
1062926200 10:1317452-1317474 AATTTTTTAATTTTTGGTGAAGG + Intronic
1063083939 10:2797343-2797365 AATTTTTGCATGTGGTGTTAGGG - Intergenic
1063733915 10:8730973-8730995 ATATTTCTAATCTGGTGAGAAGG + Intergenic
1064094077 10:12409569-12409591 AATTTTTCAGCCAGGTGTGATGG - Intronic
1064098282 10:12440600-12440622 TTTTGTTTAATTTGGTGTGACGG + Intronic
1064471167 10:15637375-15637397 TATTTCTTTATCTGGTATGATGG - Intronic
1064496315 10:15914174-15914196 AATTTTTGTATATGGAGTGATGG + Intergenic
1066021053 10:31302657-31302679 ATTTTTTTAATGTGGTGGTAGGG + Intergenic
1066286621 10:33973153-33973175 AAATTTTGTATATGGTGTGAGGG + Intergenic
1068231525 10:54173814-54173836 AATTTTTAAATGTGCTGTGAAGG + Intronic
1069421039 10:68246911-68246933 AATTTTTAAATTTGGTGTAATGG - Intergenic
1070795236 10:79212457-79212479 AATTTTTTAATCTGGTGTGATGG - Intronic
1070940248 10:80338167-80338189 AATCTTTAAATTTGGTGTGGGGG - Intronic
1071936210 10:90533393-90533415 AAAGTTTTAATCTAGTGAGATGG - Intergenic
1071954628 10:90744262-90744284 AAGCTTTTAATCTAGTGTGCTGG - Intronic
1073365000 10:102932496-102932518 AGTTTTTATATATGGTGTGAGGG + Intronic
1075448033 10:122527254-122527276 AATTGTTAAATCTGGTTAGATGG - Intergenic
1076642037 10:131924349-131924371 AATTTTTATATGTGGTGTTAAGG + Intronic
1079480559 11:20875372-20875394 AAAATTTGAAGCTGGTGTGATGG - Intronic
1079488582 11:20962181-20962203 TATTTGTTAATTTGGGGTGATGG + Intronic
1080348317 11:31352052-31352074 ATTTTTGTAATCAGGTTTGAAGG - Intronic
1080421052 11:32110712-32110734 AATTTTTAAAACTGGTGGGAGGG + Intergenic
1081477489 11:43448809-43448831 AATTTTTTAATATGGAGAGTGGG - Intronic
1081495848 11:43609531-43609553 AATTTTTTAATTTGTAGAGATGG + Intronic
1082114435 11:48312930-48312952 AATTTTTGTATGTGGTGTAAGGG - Intergenic
1084252984 11:67916517-67916539 AATTTTTGTATATGGTGTAAGGG - Intergenic
1084819884 11:71679472-71679494 AATTTTTGTATATGGTGTAAGGG + Intergenic
1085576375 11:77607565-77607587 AAATTTTTAATTTGGTAAGATGG - Intronic
1085962892 11:81483759-81483781 AATTTTTAATTCTGGTGTGGGGG - Intergenic
1088435525 11:109808202-109808224 AATTTTTTATTATGGTGTGATGG - Intergenic
1088639374 11:111856672-111856694 AATATTTTAATCTGATGCTAAGG - Intronic
1093550536 12:20405054-20405076 AACATTTGAATTTGGTGTGAAGG + Intronic
1093783819 12:23169495-23169517 AATATTTCAATCTGATGTTATGG - Intergenic
1093883851 12:24437294-24437316 AATTTTTATATAAGGTGTGAGGG - Intergenic
1094170254 12:27483584-27483606 AATTTTTGAAACTTGTGTGTAGG + Intronic
1094484757 12:30915646-30915668 AATTTTCCAATCTGGTCTGCTGG - Intergenic
1094639129 12:32256218-32256240 AATTTTTTAATTTTTTGAGACGG + Intronic
1095647995 12:44572318-44572340 AATTTTTTTTTCTGTAGTGATGG + Intronic
1095906255 12:47381328-47381350 AATTTTTTCATCTCCTATGATGG - Intergenic
1096041160 12:48518776-48518798 AATTTTTTGAAATGGTGTGATGG - Intronic
1097229884 12:57503986-57504008 TTTTTTTTACTCTGGTGTGATGG + Intronic
1098127315 12:67312085-67312107 AATTTTTAATTCTGGTTGGAAGG + Intronic
1098722288 12:73915824-73915846 AATTGTTAAATTTTGTGTGAAGG - Intergenic
1098735422 12:74096311-74096333 ATTTTACTAATATGGTGTGAAGG + Intergenic
1098907415 12:76176431-76176453 CATTTTTTAGCCTGGTGTGATGG + Intergenic
1100123021 12:91391202-91391224 AATTTTTGTATATGGTGAGAGGG + Intergenic
1100159467 12:91841764-91841786 AAGTTTATAAGCTGGTGAGAGGG + Intergenic
1101125749 12:101632169-101632191 AATTTTTTAATGGGGTGTGAGGG + Intronic
1101638396 12:106566606-106566628 AGTTTTTAATGCTGGTGTGATGG - Intronic
1102055756 12:109895360-109895382 TTTTTATTAATCGGGTGTGATGG - Intergenic
1105663437 13:22525464-22525486 AAATTATTCATCTTGTGTGACGG - Intergenic
1106031197 13:26005684-26005706 AATTTTTGTATGTGGTGGGAAGG + Intronic
1107088754 13:36453017-36453039 ATTTTTTTAAGCTGATGTTATGG - Intergenic
1107368125 13:39708546-39708568 AATTTTTGAGTATGGTATGAAGG + Intronic
1107536796 13:41343258-41343280 AATTTTTTAATTTGTAGAGATGG + Intronic
1107766235 13:43737906-43737928 GATTTTTTGATCTGCTGTGGGGG - Intronic
1108390871 13:49946392-49946414 AATTTTTGCATATGGTGTGAAGG + Intergenic
1109549268 13:63871983-63872005 AATTTTTCAGTCAGGTGTGGTGG + Intergenic
1110602606 13:77392760-77392782 TATTTTTTAATCCAGTGTGATGG + Intergenic
1110662542 13:78074057-78074079 AAATTTTTAATCTGGATAGAAGG + Intergenic
1111166863 13:84470002-84470024 AATGTTTAAAAATGGTGTGAAGG - Intergenic
1113628870 13:111866691-111866713 TTTTTTTTAATCTGGTGATAAGG + Intergenic
1114604426 14:23985270-23985292 ATATTTTTAATCTGGTGAAATGG - Intronic
1114978479 14:28131364-28131386 AATTTTTTAAGGTGGGGGGATGG - Intergenic
1115158001 14:30361945-30361967 TATTTTTTAATCTGGTATCCAGG - Intergenic
1115830849 14:37338809-37338831 CATTTTTTAGCATGGTGTGAGGG - Intronic
1116933352 14:50712482-50712504 AAATTTTTAGTGTGGTGTGGTGG - Intergenic
1117585424 14:57197958-57197980 AATTTTTTATTTTTCTGTGATGG - Intergenic
1118013468 14:61634110-61634132 AAATTTTCAATCTGGTTTCAAGG + Intronic
1118659843 14:67996226-67996248 AATTTTTTAATTTTGTGTAGAGG - Intronic
1120097710 14:80407663-80407685 AATTTTTGTGTATGGTGTGAGGG - Intergenic
1120275838 14:82371158-82371180 AATTTTGTCTTCTGGTTTGAGGG + Intergenic
1122425703 14:101604175-101604197 AAATTTTAATTCTGGTGGGAGGG - Intergenic
1122530291 14:102420639-102420661 AATTTTTTAATTTGTAGAGATGG + Intronic
1124160541 15:27264601-27264623 TTTTTTTTAAGCTGGTTTGAGGG - Intronic
1124356988 15:29003028-29003050 AATTGTTTGATCTGGCTTGATGG + Intronic
1124389542 15:29241874-29241896 AATTTTTTAATTTTTTGTAAGGG - Intronic
1124712456 15:32027287-32027309 ACTTTTTGATTGTGGTGTGAGGG + Intergenic
1126381643 15:48054077-48054099 AATTTTTGTGTATGGTGTGAGGG - Intergenic
1126869046 15:52968022-52968044 TATTTTTTAATATGGTGAGTGGG + Intergenic
1127215177 15:56816359-56816381 AATTTTTTCACGTGGTGTGCTGG - Intronic
1127250147 15:57226009-57226031 AATTGATTAATCTGGGGGGAGGG - Intronic
1127477409 15:59347795-59347817 AATTTACTTTTCTGGTGTGAGGG - Intronic
1128065492 15:64762017-64762039 AATTTTTTAATTTTGTGTAGAGG + Intronic
1130165648 15:81455040-81455062 TGTTTTTTAATATGGTGAGAGGG + Intergenic
1130880072 15:88047271-88047293 AAATATTTTATCTGGTGAGATGG - Intronic
1131492981 15:92878996-92879018 AATTTTTTAAAATGAAGTGAAGG - Intergenic
1135056252 16:19234156-19234178 AATTTTTTAATTTTTTGTGGAGG - Intronic
1136218615 16:28812733-28812755 AATTTTTTGATCAGGTGTGGTGG - Intergenic
1137267334 16:46880125-46880147 AATTTTTTAATTTGTAGAGATGG + Intergenic
1137890422 16:52155677-52155699 AATTTTTGTATGTGATGTGAAGG + Intergenic
1138102763 16:54267671-54267693 AATTTTTGCATATGGTGTGAAGG + Intronic
1139841545 16:69885518-69885540 AATTTCTTCATATGATGTGATGG - Intronic
1140065480 16:71607709-71607731 AATTTTTTAGCCGGGTGTGGTGG - Intergenic
1140447458 16:75042401-75042423 AATTTTTGGATATGGTATGAGGG + Intronic
1140653157 16:77110478-77110500 ATTGTTTTAATCTGGTGTAATGG + Intergenic
1140845179 16:78879975-78879997 CATTTTGAAATCTGGTGTAATGG + Intronic
1140942175 16:79732442-79732464 AATTTTATAATTTGTTGTAATGG + Intergenic
1141872688 16:86799037-86799059 AATTTTTTAATCTATGGGGAGGG - Intergenic
1142771359 17:2099520-2099542 CATTTTTTAATATGCTGTGGGGG - Intronic
1144381743 17:14705588-14705610 AATTTTTTAATCTCATCTAATGG + Intergenic
1144511117 17:15877690-15877712 CATTTTATACTCTGGTGTGCAGG + Intergenic
1144553177 17:16259557-16259579 AATTTTTGTGTGTGGTGTGAGGG - Intronic
1145096065 17:20028084-20028106 AATTTTTGCATATGGTGTGATGG + Intronic
1146837398 17:36123205-36123227 AATTTTTTATACATGTGTGACGG + Intergenic
1146966367 17:37034563-37034585 AATTTTTTAAACTGATTTCAAGG + Intronic
1147272717 17:39287557-39287579 ATTTTTTTAATTAGGTGTGATGG - Intronic
1153178970 18:2411340-2411362 AAATTTTTGATACGGTGTGATGG - Intergenic
1153604987 18:6824249-6824271 AATTTTTTAGCCAGGTGTGGTGG + Intronic
1153917582 18:9759530-9759552 AATTTTTTTTTTTGGTGAGAGGG - Intronic
1155595129 18:27476976-27476998 AATATTTTCATCTAGTATGATGG - Intergenic
1156018392 18:32572229-32572251 AAAATTTTAATCAGGAGTGAGGG + Intergenic
1159186377 18:64980673-64980695 ACTTTTATACTCTAGTGTGATGG - Intergenic
1160210921 18:76878714-76878736 CATTTATTAATCTGTTGAGAGGG - Intronic
1162309131 19:9894703-9894725 AATTTTTTATTCTTTTGAGACGG - Intronic
1163512762 19:17745803-17745825 AATTTATTTATTTGGTGAGACGG - Intergenic
1163564537 19:18042697-18042719 AATTTTTTAATTTGTAGAGATGG - Intergenic
1163842946 19:19622499-19622521 AATTTTTTATTTTTTTGTGATGG - Intergenic
1164493895 19:28739918-28739940 AATTGCTGAATATGGTGTGATGG - Intergenic
1164909868 19:32000121-32000143 AATTTTTTAATATTTTGTTAAGG - Intergenic
1165946277 19:39444703-39444725 TTTTTTTTAATGTGGTGTGGTGG - Intronic
1166662478 19:44656343-44656365 AAGGTTTTCAACTGGTGTGATGG + Intronic
926044726 2:9702050-9702072 TATTTTTGGATATGGTGTGAGGG + Intergenic
928010956 2:27607293-27607315 AATTTTTATATATAGTGTGAGGG + Intronic
928871346 2:35984622-35984644 AATTTTTGTATGTGGTATGAGGG - Intergenic
929610293 2:43266063-43266085 AATTTCATTTTCTGGTGTGATGG + Intronic
929713719 2:44290088-44290110 AATTTTTATATAGGGTGTGAAGG + Intronic
931893039 2:66696208-66696230 TTTTTTTTAATCTGGGGTGAAGG + Intergenic
932265101 2:70361102-70361124 AACTTTTTCATCTGCAGTGAAGG + Intergenic
932267461 2:70380589-70380611 AATTTTTGCATATGGTGTGAGGG + Intergenic
933411598 2:81932408-81932430 TTTTTTTTAATTTAGTGTGATGG + Intergenic
934733698 2:96676071-96676093 AATTTTTGCATATGGTATGAGGG + Intergenic
934847397 2:97670954-97670976 AATTTTTTAATTTTTTGAGATGG + Intergenic
935600122 2:104914175-104914197 AATTTGTTAATCTGTTATCACGG + Intergenic
936416576 2:112319934-112319956 AATTTTTTATTTTTGTGAGACGG + Intronic
936975699 2:118219667-118219689 TATTTTTTTTTCTGGTGTGCAGG + Intergenic
937383129 2:121399886-121399908 AATTTTTTAAGATACTGTGAAGG - Intronic
937772664 2:125739273-125739295 AATTAATTAACTTGGTGTGATGG + Intergenic
939639564 2:144622951-144622973 AATTTTTGTATGTGGTGTAAGGG + Intergenic
940159452 2:150695754-150695776 AATTGTTTAACTTGGGGTGAAGG + Intergenic
940187842 2:151006239-151006261 AATTTTTTAACCTGATCAGATGG + Intronic
940834297 2:158503353-158503375 TATTTTTTAATCTTAGGTGAGGG - Intronic
941572769 2:167192549-167192571 AGTTTTTTAATCTGGACTCAAGG + Intronic
943205560 2:184889244-184889266 AATTTTTTAACCTTGTTTTAAGG + Intronic
944001813 2:194848699-194848721 AATTTTTTGGTCGGGTGTGGTGG - Intergenic
944268704 2:197757490-197757512 AATTTTTGTATATGGTGTGAGGG - Intronic
944484743 2:200193286-200193308 AATGTGATATTCTGGTGTGATGG - Intergenic
944563000 2:200960263-200960285 ATTTTTTTGACCTGGTGTGGTGG - Intronic
945475325 2:210275394-210275416 AATTTTTTTATAAGGTGTAAAGG + Intergenic
947322098 2:228931633-228931655 AATTTTTGTATAAGGTGTGAGGG + Intronic
948317630 2:237041060-237041082 AATTCTTTAACCAGCTGTGAGGG - Intergenic
1169424782 20:5487283-5487305 AATTTTTTCATCTGCTGTAGAGG - Intergenic
1169515704 20:6313746-6313768 AATTTTCTAATCTGTTATCAAGG + Intergenic
1170316496 20:15046876-15046898 AATTTATTAATCTGGGCTGTTGG + Intronic
1170584807 20:17726473-17726495 GAATTTTTCATCAGGTGTGATGG - Intronic
1170953883 20:20961046-20961068 AATTTTTATATATGGTGAGAGGG - Intergenic
1171005477 20:21461250-21461272 AATTTTTTTTTCTTTTGTGATGG - Intergenic
1173707225 20:45119934-45119956 AATTTTTTAATTTTTTGTAAAGG - Intergenic
1174618698 20:51857145-51857167 AATTTTTGCATATGGTGTGAGGG - Intergenic
1175984438 20:62757241-62757263 CATTTTTGTATATGGTGTGAGGG + Intronic
1176004873 20:62855760-62855782 TATTTTTTTATTTGGTGAGATGG - Intronic
1176160787 20:63646994-63647016 TTTTTTTTAAGCTGGTGTGTAGG - Intronic
1176953255 21:15070420-15070442 AATTTTTGTATATGATGTGAAGG - Intergenic
1178131432 21:29576663-29576685 ATTTTTTTTTTCTGGTGTAAAGG + Intronic
1178998702 21:37432821-37432843 TATGTTTTAGTCTGGTGTGGTGG + Intronic
1179144722 21:38757780-38757802 TATGTTTTAGTCTGGTGTGGTGG - Intergenic
1180015220 21:45077737-45077759 AAATCTGTAATTTGGTGTGATGG + Intronic
1181591460 22:23887976-23887998 AATTTTTGGGTATGGTGTGAGGG + Intronic
1183914802 22:41109103-41109125 AATTTTTTATTTTGTTGAGATGG - Intronic
949629297 3:5905439-5905461 AATTTTTTATCCATGTGTGATGG + Intergenic
950137930 3:10595426-10595448 TATTTTATAAACTGGTGGGATGG - Intronic
950327412 3:12124563-12124585 AATTTATTTATCTGTTATGATGG - Intronic
951226955 3:20131570-20131592 AATTTTTTAATTTTTTGAGATGG + Intronic
951254026 3:20428303-20428325 AATTTTTGTATATGGTGTAAGGG + Intergenic
951890120 3:27560585-27560607 AATGTTTTACTCTGTTGTGCGGG - Intergenic
951905429 3:27701851-27701873 AAATTTTGAAGCTGGTGTGGTGG - Intergenic
951963689 3:28357342-28357364 AAATTTTTGATTTGGTGTGATGG + Intronic
953201873 3:40785100-40785122 AATTTTTTTTTTTGGTGTTAAGG + Intergenic
953835835 3:46342875-46342897 AATGTTTTCATCTGGTGAGATGG - Intergenic
954913146 3:54125482-54125504 CATTTTGTAATCTGATGCGAGGG + Intronic
955147585 3:56335454-56335476 ATTTTTTAAAACTGGGGTGAGGG + Intronic
955710153 3:61770098-61770120 AATTGTTAAATGTGGTGAGATGG + Intronic
957536110 3:81505899-81505921 AATTTTTGTATATGGTGTAAGGG - Intronic
957659572 3:83129828-83129850 ATTTATTTAATTTTGTGTGAAGG + Intergenic
959612680 3:108312869-108312891 ATCTGTTTAATCTGGTGAGATGG + Intronic
960432318 3:117584149-117584171 AATTTTTTAATTTTTTGTAAAGG + Intergenic
961286092 3:125804978-125805000 AATTTTTGAGTATGGTGTAAGGG + Intergenic
961600182 3:128054399-128054421 AATTTCTTAGTGTGGTGGGATGG + Intronic
961900654 3:130207898-130207920 AATTTTTGTATATGGTGTAAGGG - Intergenic
962434582 3:135354126-135354148 AATTGTTTTGTTTGGTGTGAGGG - Intergenic
962822363 3:139062516-139062538 AATTTTCTAATATTTTGTGAAGG + Intronic
963495080 3:146047979-146048001 AATTTTTCTGTATGGTGTGAGGG - Intergenic
964067362 3:152596031-152596053 AATCTTTTAGTCTGGTGTCAGGG + Intergenic
965126784 3:164640496-164640518 ACTTTTTTAGTCTTTTGTGAAGG - Intergenic
965261357 3:166489702-166489724 AAATTTTCACTCTGGTGTGTGGG - Intergenic
965912781 3:173801567-173801589 AATTTAATTATCTGTTGTGAAGG - Intronic
966613692 3:181892486-181892508 AATTTTTAAATTTTGTGTGTGGG + Intergenic
967283227 3:187842797-187842819 GATTTTTTACTCTGGTCTGTTGG + Intergenic
967465509 3:189801342-189801364 AATTTTTAATTCTGGTATTAGGG - Intronic
967468125 3:189831362-189831384 AGTTTTCTAATTTGCTGTGAGGG + Intronic
968721692 4:2211420-2211442 AATTTTTTAAACTTGTGATAAGG + Intronic
969254156 4:5991164-5991186 AAATATATAATATGGTGTGAGGG - Intergenic
969809495 4:9637065-9637087 AATTTTTTTATTTGTTGAGACGG - Intergenic
970227790 4:13878011-13878033 AACTTTTTAAACCAGTGTGAGGG + Intergenic
970300341 4:14674733-14674755 AATTTCTACATCTGGTGGGAGGG - Intergenic
970599621 4:17631220-17631242 ATTTTTTTAATCTGTAGAGATGG + Exonic
970652599 4:18195177-18195199 ACTTTTTTAGTTTGGTGTGTGGG + Intergenic
970786354 4:19801501-19801523 GATGGTTTAATCTGGTGTGTGGG - Intergenic
971017202 4:22500655-22500677 GTTTTTTTACTCTGTTGTGATGG + Intronic
971793805 4:31200827-31200849 AAATTTTTGATATGGTTTGACGG - Intergenic
973248165 4:48032552-48032574 AATGGTTAAATCTGGTGTGTAGG - Intronic
973715480 4:53671419-53671441 AATTTTTAAAACTGGTGTATAGG + Intronic
973798223 4:54450432-54450454 AATATTTTATTCTCTTGTGAAGG + Intergenic
973856219 4:55012829-55012851 AAATGTTTAATCAGGTGTGCAGG + Intergenic
974821863 4:67077110-67077132 AATATTTTTATCTGGTTTAAGGG - Intergenic
975397487 4:73893780-73893802 AATTATTTATTCTAATGTGATGG - Intergenic
976237530 4:82914978-82915000 AATTTTTGTATGTGGTGTAAGGG + Intronic
977781038 4:100981158-100981180 TATTTTTTAAACTGGTAAGAAGG - Intergenic
977998371 4:103524333-103524355 AATTTTTGTATATGGTATGAGGG + Intergenic
978202950 4:106044607-106044629 AATTTTTGTATATGGAGTGAGGG - Exonic
979953444 4:126924482-126924504 ATTATTTTAATCTGTTTTGATGG - Intergenic
980480010 4:133376223-133376245 AATTTCTTAACCTAGTGTTAAGG + Intergenic
980789546 4:137602295-137602317 AAGTTTTCAATATGGTGTGGTGG - Intergenic
981277441 4:142917736-142917758 AATATTTTAATCTTGTGTAGAGG - Intergenic
981973181 4:150690568-150690590 AGTTTTATAATATGGTGGGAAGG - Intronic
982239558 4:153285104-153285126 AATTTTTGTATGTGGTTTGAAGG + Intronic
984472871 4:180199278-180199300 ATTTTTTGAGTATGGTGTGAGGG - Intergenic
985404035 4:189618357-189618379 AATTTTTAAATCTAGTATAATGG + Intergenic
987138877 5:14925662-14925684 AATTTTAAAACCAGGTGTGAGGG + Intergenic
987549753 5:19363631-19363653 AATTATTAAATCTGTTGTGAAGG - Intergenic
987792529 5:22586653-22586675 AATTGTGAAAACTGGTGTGAAGG - Intronic
988246367 5:28687769-28687791 TATTTTTTACTCTGGAGTCAAGG - Intergenic
989428172 5:41320499-41320521 AATTTTTTAATTTTTTGAGACGG + Intronic
989830746 5:45915371-45915393 AATTTTTAAATCTGGTTTTCTGG + Intergenic
989993697 5:50801043-50801065 AAATTTTTCACCAGGTGTGATGG - Intronic
990257531 5:53986658-53986680 AATTTTTTAACTTGGGGTAATGG + Intronic
990770180 5:59235174-59235196 ATTTTTTTCATGTGGTCTGAAGG - Intronic
992739420 5:79758223-79758245 TTTTTTTTAATCTGTTGAGATGG - Intronic
994602077 5:101919002-101919024 AATTTTTGTATTTTGTGTGAGGG + Intergenic
995348888 5:111152404-111152426 AATGTTTTAAGGTGGTTTGATGG + Intergenic
996471559 5:123867207-123867229 TTTTTTTTAACCTGGTGTGCTGG - Intergenic
1000322524 5:160146137-160146159 AATTTTTCAATCTGCTATGTGGG + Intergenic
1000432024 5:161163535-161163557 AATTTTTTCATCTTGTAAGAAGG - Intergenic
1001467117 5:171977170-171977192 AATTTTTAAATTTTCTGTGAAGG - Intronic
1001973133 5:175973227-175973249 AATTATTTAAGCTGGTGTGGTGG + Intronic
1002117279 5:176972729-176972751 AATTTTTTAATTTTTTGAGATGG - Intronic
1002244303 5:177870556-177870578 AATTATTTAAGCTGGTGTGGTGG - Intergenic
1003944413 6:11060593-11060615 AATTTTTGTATATGGTGTAAGGG + Intergenic
1004342920 6:14823334-14823356 AATTTTTTAAAAAGGTGAGATGG - Intergenic
1004445772 6:15696096-15696118 AATTTTTTAGCTTGGTGTGGTGG + Intergenic
1004514726 6:16312839-16312861 AATTTTTTAGGCTGGTTGGAGGG - Intronic
1004870898 6:19902894-19902916 AACTATTTAGTGTGGTGTGAAGG + Intergenic
1007639269 6:43324407-43324429 AATTTTTATGTATGGTGTGAGGG - Intronic
1008300916 6:49838190-49838212 AATATTTTAATCTGTTGGGTGGG + Intronic
1008970530 6:57362198-57362220 TATTTTTTTACCTGGTGTGAAGG - Intronic
1009159498 6:60264020-60264042 TATTTTTTTACGTGGTGTGAAGG - Intergenic
1009679125 6:66869470-66869492 AATTTTTGTATATGGTGTAAGGG + Intergenic
1009685112 6:66947174-66947196 TATTTTTTATTTTGGTGTAATGG + Intergenic
1009790608 6:68397018-68397040 AATTTTTGCATATGGTATGAAGG - Intergenic
1010098619 6:72076732-72076754 AATATTTTACATTGGTGTGAGGG + Intronic
1010197947 6:73258610-73258632 AATCTTTTAATCTTGTGGAATGG - Intronic
1010207407 6:73335304-73335326 ATTTTTTTAGTCAGGCGTGATGG + Intergenic
1010349405 6:74854208-74854230 AATTTTATAATCTGTGGGGAGGG - Intergenic
1010443885 6:75929815-75929837 AATTTTTGTATGTGGTGTTAGGG + Intronic
1010916054 6:81620522-81620544 AATTTTTGTATATGGTGTGAGGG + Intronic
1014229493 6:118887448-118887470 AATTTTTGTATATGGTGTGAAGG - Intronic
1014350620 6:120340014-120340036 AATTCTTGTATATGGTGTGAAGG - Intergenic
1014351707 6:120354107-120354129 AACTATTTTAACTGGTGTGAAGG - Intergenic
1015646893 6:135401663-135401685 AATTTTTGTATATGGTATGATGG - Intronic
1016169459 6:140992340-140992362 AATTTGTTAATATTGTGTTAGGG - Intergenic
1016536854 6:145116637-145116659 AATTCATTTATCTTGTGTGAAGG - Intergenic
1016636068 6:146292125-146292147 AATTTTTGTATATAGTGTGAGGG - Intronic
1019419029 7:942115-942137 AATTTTTGGATATGGTGAGAGGG - Intronic
1019796778 7:3055629-3055651 ATTTTTTTAATCTCTTGTGGGGG - Intergenic
1020958448 7:14772424-14772446 GATATGTTAATCTGGTGTGGAGG + Intronic
1021509631 7:21421603-21421625 TATTTTTTAACCTGGTGAGATGG + Intergenic
1022752065 7:33239616-33239638 AATATTTTAATCTTTTGTTATGG + Intronic
1023912482 7:44565815-44565837 AAATTTTTATTCTGTTGTCAAGG + Exonic
1024669394 7:51578360-51578382 AGTTTTTGTATATGGTGTGAGGG + Intergenic
1024871336 7:53964767-53964789 AATTTCTTTATCTGCTTTGAAGG + Intergenic
1026397915 7:69977114-69977136 AATTTTTGTATATGGTGTAAAGG + Intronic
1026705465 7:72687898-72687920 AATTTTTTAGCCAGGTGTGGTGG + Intronic
1026855761 7:73753441-73753463 AATTTTTTTATATGGTGTTAAGG + Intergenic
1027004277 7:74679081-74679103 AATTTTTTAATTTTTTGAGATGG + Intronic
1027169707 7:75862885-75862907 AATTTCTGTATATGGTGTGAGGG + Intronic
1027191600 7:75999869-75999891 TTTTTTTTAAAGTGGTGTGAGGG + Intronic
1027845493 7:83368617-83368639 TATTTTTTAATCTCTTGTAAAGG - Intronic
1027923407 7:84427264-84427286 AATTTTTTATTTTGAAGTGATGG - Intronic
1028368582 7:90064106-90064128 AATTTTTGAATAAGGTGTAAGGG + Intergenic
1030021787 7:105282293-105282315 GATTTTTGTATATGGTGTGAAGG - Intronic
1030041491 7:105454648-105454670 AATTTTTTAAACTGGTATAATGG + Intronic
1030238084 7:107289184-107289206 AATTTTTGTATATGATGTGAAGG + Intronic
1030272879 7:107688419-107688441 AATTTTTTTATATGGTTTGTAGG + Intronic
1030423572 7:109341327-109341349 AATTTTTTAATATTTTGTGGGGG + Intergenic
1030541910 7:110841327-110841349 AATGTTTTAATATGATGAGATGG + Intronic
1030766800 7:113420417-113420439 AATTTTTTAGCCTAGTGTGGTGG - Intergenic
1031413252 7:121465814-121465836 ATTCTTTTAATCTAGTGTTAGGG + Intergenic
1031455750 7:121977761-121977783 AATTTTGCAATCTGGGTTGATGG - Intronic
1031729879 7:125287110-125287132 AAATTTTTAGTCTGGAGTGGAGG + Intergenic
1033471424 7:141653123-141653145 CATGTTTTATTTTGGTGTGACGG + Exonic
1034288236 7:149905392-149905414 AATTTGTGAGTATGGTGTGAAGG - Intergenic
1034526385 7:151666074-151666096 ACTTGTTTCATCCGGTGTGAGGG - Intronic
1034662889 7:152787563-152787585 AATTTGTGAGTATGGTGTGAAGG + Intronic
1036101172 8:5786736-5786758 AATTTTTTTATCTGGGAGGAAGG + Intergenic
1036247640 8:7132728-7132750 AATTTTTGTATATGGTGTAAGGG + Intergenic
1036450193 8:8859343-8859365 AACTTTTTTTTTTGGTGTGAGGG - Intronic
1037539782 8:19859820-19859842 TAATTTTTAAAATGGTGTGATGG - Intergenic
1039325757 8:36483761-36483783 GTTTCTGTAATCTGGTGTGAGGG + Intergenic
1039681558 8:39743270-39743292 AGTTTTTTAATCTGATGAAAGGG - Intergenic
1039958792 8:42228436-42228458 AATTGTTTAATCTGGGTGGAAGG + Intergenic
1040432620 8:47359067-47359089 AATTTTTTTAACTGGTGGGAGGG - Intronic
1040440063 8:47431743-47431765 AATATTTTAAACTGGTGAAAAGG + Intronic
1041394553 8:57377321-57377343 TATTTTTTGATATGGAGTGAAGG + Intergenic
1041749072 8:61239443-61239465 ATTTTTTTAACCAGGTGTGGTGG + Intronic
1042923354 8:73941367-73941389 AATTTTGTATTTTTGTGTGATGG - Intronic
1043316664 8:78931333-78931355 ATTTTTTTAATCTGGGGAGGAGG + Intergenic
1043612042 8:82076845-82076867 AATTTTTGTATATGGTGTGAGGG + Intergenic
1043970012 8:86518315-86518337 AAATTCTTAATGTGGTCTGAGGG + Intronic
1044709528 8:95042958-95042980 CATTTTTGTATATGGTGTGAGGG - Intronic
1045045417 8:98270867-98270889 AATTTGTTTATATGGTGAGAGGG + Intronic
1045519827 8:102894122-102894144 GGTTTGTTAATCTGGTGTGGGGG - Intronic
1045860123 8:106807053-106807075 AATTTCTTAATCCAGTGGGAGGG - Intergenic
1046042830 8:108928050-108928072 AAATATTTAAACTTGTGTGAAGG - Intergenic
1047015484 8:120719060-120719082 AACTCATTAACCTGGTGTGATGG + Intronic
1047838569 8:128721150-128721172 AATTTCTGATTCTGCTGTGAAGG - Intergenic
1049984366 9:934658-934680 AATTTTTGTATATGGTGTAAGGG + Intronic
1050923335 9:11233684-11233706 TTTTTTTTAATCAGGGGTGAGGG + Intergenic
1050926131 9:11265755-11265777 AATTTTTGAATATGGTATAATGG + Intergenic
1053201676 9:36156203-36156225 AATTTTTTAATTTTTTGAGATGG - Intronic
1053327929 9:37173645-37173667 AAGTTTTTAATCTGATTAGAAGG - Intronic
1053629692 9:39922447-39922469 ATTTTTTTAATGTGGTGGGTTGG - Intergenic
1053776073 9:41541100-41541122 ATTTTTTTAATATGGTGGGTTGG + Intergenic
1054214195 9:62328255-62328277 ATTTTTTTAATGTGGTGGGTTGG + Intergenic
1054673289 9:67827104-67827126 ATTTTTTTAATGTGGTGGGTTGG - Intergenic
1058062613 9:100514383-100514405 AGCTTTATAATCAGGTGTGAAGG + Intronic
1059933369 9:119283476-119283498 AATTTTTTAAAGTGGTGGGAGGG + Intronic
1060285799 9:122251072-122251094 ATTTTTTTAATTATGTGTGATGG - Intronic
1061668929 9:132177465-132177487 AATTTTTGTATCTGGTGTAAGGG + Intronic
1061676643 9:132220805-132220827 AATTTTTATATGTGATGTGAAGG + Intronic
1062335617 9:136065029-136065051 AATTTTTGTATATGGTGTGAGGG - Intronic
1185669738 X:1798352-1798374 AATTCTTTATTCTGTTGTCATGG + Intergenic
1186118684 X:6333958-6333980 TCTTTTTTGATATGGTGTGATGG + Intergenic
1186314224 X:8351248-8351270 AATTTAATAATCTTGTATGATGG + Intergenic
1187299406 X:18033179-18033201 AATTTTTTTAGCTGGTGTGAGGG - Intergenic
1187382103 X:18812156-18812178 AATTTTTGTGTATGGTGTGAAGG + Intronic
1188910177 X:35837757-35837779 AATTTTTATATATGGTTTGAGGG + Intergenic
1190492453 X:50995800-50995822 AATTTTTGTTTCTGATGTGAGGG - Intergenic
1190704464 X:53015020-53015042 AATTTTTGTATATGGTGTGAAGG - Intergenic
1190717102 X:53114190-53114212 ATTTTTTTAACCTGGTGCGGTGG - Intergenic
1190965328 X:55294750-55294772 AATTTTTGAATAAGGTGTAAGGG + Intergenic
1191636944 X:63389029-63389051 AATTTTTGTATATGGTATGAGGG + Intergenic
1193444551 X:81584169-81584191 ACTTTTTATAGCTGGTGTGATGG - Intergenic
1193561347 X:83021683-83021705 AATTTTTTGTTCTTGTGGGAGGG - Intergenic
1193745621 X:85276041-85276063 ATTTTTTTAATGTGGTAGGATGG + Intergenic
1195612439 X:106883572-106883594 AATTTTTGTATATGGTGGGAGGG - Intronic
1195890326 X:109686367-109686389 CATTTTTTAAAATGGTGTGTTGG - Intronic
1196360768 X:114854549-114854571 AATTTTTGTATATGGTGAGAGGG - Intronic
1197969373 X:132099016-132099038 TATTTTACAATCTAGTGTGATGG - Intronic
1198059422 X:133030113-133030135 ACGTTTTGAATCTGGTGTGGGGG - Intronic
1198316699 X:135474604-135474626 AATTTTTATTTTTGGTGTGAGGG + Intergenic
1198488334 X:137111061-137111083 TTTTTTTTAACCTGGAGTGATGG + Intergenic
1199062288 X:143373069-143373091 GAGTTGTTAATCTGGTGTTATGG + Intergenic
1199544982 X:148998903-148998925 AATATTTTAATGAGGGGTGATGG - Exonic
1199585318 X:149409292-149409314 AATTTTTTTATATGGTGTGAGGG + Intergenic
1199610581 X:149609280-149609302 ATTTTTATAATATTGTGTGAAGG - Intronic
1199773764 X:150992944-150992966 GATTTTTGAATGTGCTGTGAGGG - Intergenic
1201500792 Y:14640559-14640581 CATATTTTATTTTGGTGTGATGG + Intronic