ID: 1070795237

View in Genome Browser
Species Human (GRCh38)
Location 10:79212465-79212487
Sequence GTGCAAAAAATTTTTTAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795237_1070795244 -2 Left 1070795237 10:79212465-79212487 CCAGATTAAAAAATTTTTTGCAC 0: 1
1: 0
2: 1
3: 27
4: 383
Right 1070795244 10:79212486-79212508 ACAGATGGGGCTGGGCATGGTGG No data
1070795237_1070795243 -5 Left 1070795237 10:79212465-79212487 CCAGATTAAAAAATTTTTTGCAC 0: 1
1: 0
2: 1
3: 27
4: 383
Right 1070795243 10:79212483-79212505 TGCACAGATGGGGCTGGGCATGG No data
1070795237_1070795242 -10 Left 1070795237 10:79212465-79212487 CCAGATTAAAAAATTTTTTGCAC 0: 1
1: 0
2: 1
3: 27
4: 383
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795237_1070795246 29 Left 1070795237 10:79212465-79212487 CCAGATTAAAAAATTTTTTGCAC 0: 1
1: 0
2: 1
3: 27
4: 383
Right 1070795246 10:79212517-79212539 TATAATCCCAAGCACACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795237 Original CRISPR GTGCAAAAAATTTTTTAATC TGG (reversed) Intronic
900727479 1:4226517-4226539 GTTTAAAACATTTTTTAATAGGG - Intergenic
902212288 1:14912761-14912783 GTAAAAAAATTTTTTTAAACCGG - Intronic
902253179 1:15169605-15169627 TGGGAAAAAATCTTTTAATCAGG - Intronic
903408974 1:23124060-23124082 GGGCAAAAATTTTTTTTTTCAGG - Intronic
903485505 1:23687080-23687102 CTGCAAAAAATTTATTAGCCTGG - Intergenic
906391332 1:45419503-45419525 GCTCAAAAAATGTGTTAATCTGG + Intronic
908085558 1:60629044-60629066 GTGGAAAATATTTTTAAATTAGG - Intergenic
908517888 1:64912186-64912208 GTTCAAAAAATTGTCTACTCTGG - Intronic
908705419 1:66948727-66948749 CTGCAAAAAATTTTTTAAAAAGG + Intronic
909216499 1:72897620-72897642 GTGGCAAAAACTTTTTAAGCAGG + Intergenic
909370257 1:74875422-74875444 GTGTAAAAATTTATTTAAGCTGG + Intergenic
909412396 1:75370324-75370346 GTGGAAAAAATTATTTTAACTGG - Intronic
909531424 1:76685905-76685927 GTGCTAAAAGTTTTACAATCAGG + Intergenic
911147338 1:94565428-94565450 GGAAAAAAAATTTTTTAATAAGG - Intergenic
911389711 1:97225535-97225557 GAGTAAAAAATTTTGAAATCAGG + Intronic
911434188 1:97834037-97834059 GTGCAACAAATTTTAGTATCAGG + Intronic
911838226 1:102648278-102648300 GTGCCTTAAATTTTTTAGTCTGG + Intergenic
912220668 1:107670981-107671003 ATGCATAAAATATTTAAATCTGG + Intronic
912436098 1:109661990-109662012 CTACAAAAATTTTTTTAATGTGG - Intronic
912484838 1:110018161-110018183 GGGAAAAAAGTTTTTTACTCTGG - Intronic
915191619 1:154155386-154155408 TTGCAAAAAGTTTTTTTGTCGGG - Intronic
916514434 1:165502420-165502442 GTTCTAATAATTTTATAATCTGG + Intergenic
916589275 1:166174876-166174898 GTGAAAAAGACTTTGTAATCTGG + Intergenic
917167633 1:172130484-172130506 CTTCATAAAATTTTTTAAACAGG - Intronic
917216676 1:172686117-172686139 ATGCTAAATAATTTTTAATCTGG + Intergenic
917786405 1:178462998-178463020 CTGCAATCAGTTTTTTAATCTGG + Intronic
918611926 1:186502307-186502329 GTGCATATAATTTTTTTTTCTGG + Intergenic
918867312 1:189919429-189919451 GTCCAAAGAAGTTTTCAATCTGG - Intergenic
919112111 1:193233602-193233624 GTGGAAAGAATTTTTTACACTGG - Intronic
920239666 1:204536607-204536629 CTGCAAACAATTTAATAATCTGG - Intronic
921230938 1:213069925-213069947 GTGAAAAAAATCTTTTTACCTGG + Intronic
921262639 1:213397410-213397432 GTGCAAAAAAAATTTTAACTAGG - Intergenic
922141192 1:222888896-222888918 CTTCAAAAAATTTTTTAAATGGG + Intronic
923903222 1:238352827-238352849 ATGCACCACATTTTTTAATCCGG + Intergenic
924098966 1:240584192-240584214 CTACAAAAAATTTTTTAAAATGG + Intronic
1063412564 10:5847813-5847835 CTACAAAAAATTTTTAAATTAGG - Intergenic
1064089556 10:12371962-12371984 ATGTAAAAGATTTTTTAAGCCGG - Intronic
1064503772 10:16007088-16007110 ATGGAAAATATTTTTTAATGAGG - Intergenic
1065440995 10:25753245-25753267 GTGCAAGAATTGTTTGAATCTGG + Intergenic
1065561934 10:26972262-26972284 GTCCAAAAAATTATTCACTCTGG + Intergenic
1065749306 10:28871081-28871103 GTTCAAAACATTTTTTAGGCTGG - Intronic
1066162693 10:32751115-32751137 CTGCACAATATTTTTTTATCTGG + Intronic
1066276475 10:33873482-33873504 GTATAAAAACTTTTATAATCTGG + Intergenic
1066604490 10:37147290-37147312 GTTTAAAAAATATTTTAATTAGG + Intronic
1067437830 10:46290919-46290941 ATGCACAAAAGTTTTTAATCTGG + Intronic
1068861093 10:61848934-61848956 CTGCATAAAATTTTATAATGTGG - Intergenic
1068974031 10:62989013-62989035 GTGCAAAACAGTTTTAAAACTGG - Intergenic
1069270732 10:66524185-66524207 GGACAAAATATTTTTTAAACAGG - Intronic
1070008447 10:72449099-72449121 ATTTAAAAAATTTTTTAATCTGG + Intronic
1070345891 10:75541518-75541540 GTGAAATTTATTTTTTAATCTGG + Intronic
1070795237 10:79212465-79212487 GTGCAAAAAATTTTTTAATCTGG - Intronic
1071434891 10:85639579-85639601 GTGAAAAAGATTTTTTAAAAAGG - Intronic
1071807229 10:89137153-89137175 GAAAAAATAATTTTTTAATCAGG + Intergenic
1072135629 10:92542922-92542944 CTGCAAAGAATCTTTTATTCAGG + Intronic
1073873568 10:107895164-107895186 ATGCAAATAATTTTTCAATATGG - Intergenic
1074644175 10:115425784-115425806 GTGTAGAAAATTTTTTTAACTGG + Intronic
1075269942 10:121040237-121040259 TTTAAAAAAATTTTTTAAACTGG + Intergenic
1078964558 11:16322853-16322875 GTGTAAAAAATTTTTAAAGCTGG + Intronic
1081064655 11:38525459-38525481 TTGCAAAAAAGTTGTTCATCAGG + Intergenic
1082923885 11:58525319-58525341 GTGCTAAAACTTTTTTAAAAAGG - Intergenic
1083337241 11:61930375-61930397 GTTCAAAATATTTTTTAAAAAGG + Intergenic
1083442231 11:62684665-62684687 GTACAAAAAATTTAAAAATCAGG - Intergenic
1083538652 11:63495293-63495315 GAGCAAATAATTTATGAATCAGG - Intergenic
1083825088 11:65197583-65197605 GTGGACAAAATTTTTCAAACTGG - Intronic
1083980095 11:66160451-66160473 ATGCATTAATTTTTTTAATCAGG - Intronic
1085188333 11:74595525-74595547 TTGCAAATAATTTTTCAATCAGG - Intronic
1085825118 11:79839087-79839109 GTGAAGAAAATTTTGAAATCAGG - Intergenic
1085959392 11:81442769-81442791 GTGTAAGTAATATTTTAATCTGG - Intergenic
1086230210 11:84559746-84559768 ATGCAAAAAATGTATTGATCAGG - Intronic
1087112598 11:94487291-94487313 TTTAAAAAAATTTTTTAAACTGG + Intronic
1087250165 11:95889919-95889941 GTGAAAAAAATTTTGCATTCTGG - Intronic
1087511959 11:99106869-99106891 GTGTATAAAATTGTTTAATAAGG + Intronic
1088065521 11:105713665-105713687 GTACAAGAAAGTTTTTAATTTGG + Intronic
1088787082 11:113191827-113191849 GTGCAAAGAATTGTTAAATTTGG - Intronic
1089832633 11:121342205-121342227 ATGCAAAATATTTATTAATGAGG - Intergenic
1090761873 11:129844519-129844541 CTACAAAAAATTTTTTAAATTGG + Intronic
1092760409 12:11805306-11805328 GTGCACAAAATTTTGGAAGCTGG - Intronic
1092815461 12:12308996-12309018 CTCCAAAACATGTTTTAATCAGG - Intergenic
1093243391 12:16705725-16705747 ATTCAAAAAATTTTTTAAAGTGG - Intergenic
1093273624 12:17096921-17096943 GTGAAATAAATTTCTTTATCAGG + Intergenic
1093452475 12:19332112-19332134 GTCCAGATAATTTTTTAATTTGG - Intronic
1094009937 12:25797075-25797097 CTGAAAAAAATTTTTTTTTCTGG + Intergenic
1094232364 12:28121246-28121268 TTGTAAAAAATATTTTAATCAGG - Intergenic
1095524373 12:43107837-43107859 GAGAAAAAAATTTTTAAAACTGG - Intergenic
1097622607 12:61959196-61959218 ATCCAACAAATTTTTTAATTGGG - Intronic
1099773502 12:87095158-87095180 TTGCATTAAATTTTTGAATCTGG - Intergenic
1101998670 12:109543113-109543135 CTGCCAACAATTTTTAAATCTGG - Intergenic
1102660485 12:114522998-114523020 GTACATAACAATTTTTAATCAGG - Intergenic
1103116702 12:118340276-118340298 GAGCAAAAAAATTTTTAATCAGG + Intronic
1104400352 12:128470984-128471006 TTGCAAGAAATCTTTGAATCAGG + Intronic
1105328083 13:19388535-19388557 CTACAAAAAGTTTTTTAGTCTGG + Intergenic
1106067129 13:26364629-26364651 GGGAAAAAAGTGTTTTAATCTGG + Intronic
1106162161 13:27211319-27211341 GTTTAAAAAATGTTTTAGTCTGG - Intergenic
1107263871 13:38527420-38527442 AGGCAAAAAATGTTTTAATGGGG + Intergenic
1107529608 13:41270334-41270356 GTGAATCAAATATTTTAATCAGG - Intergenic
1107744545 13:43490606-43490628 GTGTGAAACATTTTTTAATAAGG - Intronic
1108249870 13:48553396-48553418 ATTTAAAAAATTTTTTAATATGG + Intergenic
1108852092 13:54742852-54742874 GTGCAAAATATTTTTTAAAAAGG + Intergenic
1109260516 13:60139889-60139911 TTGCAAAAGAGTTTTTCATCTGG - Intronic
1109327335 13:60884161-60884183 GTGCAAAAAATATTTTTAAAAGG + Intergenic
1109376523 13:61501633-61501655 GTGGAAAATATTTTTTCATGAGG + Intergenic
1109759021 13:66802101-66802123 GTACATAGAATTTATTAATCAGG + Intronic
1109787675 13:67201956-67201978 GTGCAAAAAATAATTGAATGTGG - Intronic
1109823665 13:67690082-67690104 GAGAAAAATATTGTTTAATCAGG + Intergenic
1109889359 13:68588332-68588354 GTGCAATACATTTTGTAATCAGG - Intergenic
1110533525 13:76624846-76624868 GTGCATATAATTCTATAATCTGG + Intergenic
1111003299 13:82214156-82214178 GTTCAGAAGATTTTTTAGTCTGG + Intergenic
1111098680 13:83549646-83549668 GATAAAAAAATTTTTTAATGTGG + Intergenic
1111167868 13:84486176-84486198 CTACAAAATATTTTCTAATCTGG + Intergenic
1111305505 13:86408188-86408210 GTGCAGAAATTTTGTGAATCTGG + Intergenic
1111876310 13:93901469-93901491 CTGAAAAATATTTTTTAAACGGG - Intronic
1112661939 13:101520302-101520324 ATGCAAAAAATAATTTCATCTGG - Intronic
1112791925 13:103012521-103012543 GTGCCAAAAATAATTTATTCTGG + Intergenic
1113229834 13:108200732-108200754 GTGAATACAATTTATTAATCTGG + Intergenic
1113384459 13:109835687-109835709 TTAAAGAAAATTTTTTAATCAGG + Intergenic
1113492157 13:110700593-110700615 CTTCAAATAATTTTTTAATATGG + Intronic
1115047127 14:29008709-29008731 ATGCAAGACATTTTTTAGTCTGG + Intergenic
1115209892 14:30956486-30956508 CTACAAAAAATTTTTTAAATTGG + Intronic
1115283138 14:31687225-31687247 CTGCAAAAAATTTTCCAATGTGG - Intronic
1115405911 14:33016251-33016273 GGGCAAAAATTTTTTTTATTTGG - Intronic
1115804681 14:37037578-37037600 GTGAAAAAAATTTTTTAAATAGG - Intronic
1115810235 14:37099101-37099123 GTTAAAAAAATTTTTAAGTCCGG - Intronic
1116164574 14:41318099-41318121 GTTTAAAAAACATTTTAATCCGG - Intergenic
1116245591 14:42407542-42407564 GTACAAAAAATATATTAATGTGG + Intergenic
1116563715 14:46417830-46417852 GTGCAGAAGATTTTTTAGTTTGG - Intergenic
1117774327 14:59166864-59166886 TTGAATAAAATTTTTTAGTCTGG - Intergenic
1118027790 14:61787939-61787961 GAAAAAAAAATTTTTTAATGTGG + Intronic
1118093233 14:62506388-62506410 GTGCAAAAACTCTTTTAATTAGG - Intergenic
1119665164 14:76480217-76480239 GTGCTAAACGTTTTTTAGTCGGG - Intronic
1126219733 15:46198342-46198364 GTGAACAAAAGTTTTTAATTTGG + Intergenic
1127883744 15:63180747-63180769 TTGCAAAAAATTATTTAAGTTGG + Intergenic
1128246724 15:66138056-66138078 GTTAAAAAAATTTTTTAAGATGG - Intronic
1128952700 15:71903647-71903669 GTGCAAAGAATTGTTATATCAGG + Intronic
1134621936 16:15696015-15696037 TTACAAAAAATTTTTTAAAATGG - Intronic
1134899052 16:17918146-17918168 ATGCAAAAAATTTTTTGAACAGG + Intergenic
1135057718 16:19244496-19244518 CTACAAAAAATTTTTTAAAATGG - Intronic
1135700298 16:24626566-24626588 GTAAAAAAATTTTTTAAATCTGG - Intergenic
1135949000 16:26895094-26895116 GTGTAAATAATTATATAATCTGG + Intergenic
1138382901 16:56616063-56616085 CTGCTTGAAATTTTTTAATCAGG - Intergenic
1138501060 16:57445133-57445155 GTTCAAAAAATTCTTTAACTCGG + Intronic
1138884069 16:61053920-61053942 GTGCAAACAATTTGTTAAGATGG + Intergenic
1140097632 16:71888809-71888831 GATCAAAAAATTTTCAAATCAGG - Intronic
1140790561 16:78387238-78387260 CTACAAAAAATCTTATAATCAGG - Intronic
1140837462 16:78808385-78808407 GTGCAAATAATTTTCAAATATGG + Intronic
1143630721 17:8138690-8138712 CTGCAAAAACTTTTTTACTGCGG - Intergenic
1143911400 17:10252799-10252821 GAGAAAAAAAATTTTAAATCAGG - Intergenic
1144018295 17:11218246-11218268 GTGAAAATAATTTTTCACTCTGG + Intergenic
1144184486 17:12783972-12783994 GTCCAAAATATTTTTTAAATAGG - Intergenic
1144224199 17:13128896-13128918 GTGCAATAAACTTGTTTATCTGG - Intergenic
1144962521 17:19053291-19053313 CTGCAAAAAATTTAATAAACAGG + Intergenic
1144972640 17:19121230-19121252 CTGCAAAAAATTTAATAAACAGG - Intergenic
1146210879 17:30942304-30942326 TTGGCAAAAATTTTGTAATCTGG + Intronic
1146257394 17:31399406-31399428 GAATAAAAAATTTTTAAATCTGG - Intronic
1147014008 17:37475762-37475784 GGTCACATAATTTTTTAATCAGG - Intronic
1148256905 17:46142455-46142477 GAAAAAAAAATTTTTTAATAAGG + Intronic
1150386251 17:64763780-64763802 CTGCAAATAATTCTTGAATCTGG + Intergenic
1151156610 17:72128170-72128192 CTCCAAAATATTTTATAATCTGG - Intergenic
1151534259 17:74729809-74729831 AAGCAAAAAATATTTTAATATGG + Intronic
1153041233 18:814261-814283 TTTTAAAAAATTTTTTAATGAGG + Intergenic
1153132804 18:1876756-1876778 GAGCAAAAATATTTTTAATCAGG + Intergenic
1153633168 18:7091208-7091230 GTGCAATAATAATTTTAATCAGG - Intronic
1153679715 18:7488999-7489021 GTGCCAATTATCTTTTAATCTGG - Intergenic
1153801069 18:8669434-8669456 GAGAAAAAAATTATTAAATCTGG + Intergenic
1154477855 18:14782444-14782466 GTTTAAAAAATATTTTAATTAGG + Intronic
1155638277 18:27980995-27981017 GTCCAATAAATTGTTTAATATGG - Intronic
1155683997 18:28524411-28524433 GTGAAATAATTTTTCTAATCAGG + Intergenic
1155869463 18:31007993-31008015 GTAAAAAAAAAGTTTTAATCTGG - Intronic
1156111546 18:33733162-33733184 GTGCCAAGAATTTTCAAATCTGG + Intronic
1157093589 18:44664845-44664867 GTACAAAAAATTTTAAAATTTGG - Intergenic
1157347773 18:46855212-46855234 GTGGAAAATAGTATTTAATCTGG + Intronic
1157635677 18:49151513-49151535 ATGAAAAGAATTTTTTAAGCTGG - Intronic
1157644579 18:49254631-49254653 ATGCAAACAATTTTTTAGTTGGG - Intronic
1158011890 18:52738097-52738119 GCGCAAAAAAATTTATTATCTGG + Intronic
1158495764 18:57953917-57953939 GAGCAAAATATTTTTTAAAAGGG - Intergenic
1158852318 18:61507269-61507291 GTGCAAAATATCTTTTTTTCTGG - Intronic
1159469985 18:68839921-68839943 GTGAAAACAATTTTATAATAAGG + Intronic
1159495579 18:69198586-69198608 GTGAAATAAATTATTTAATATGG - Intergenic
1160165922 18:76512270-76512292 CTGCATAAAATCATTTAATCTGG - Intergenic
1162729495 19:12709781-12709803 CTACAAAAAATTTTTTAAAAAGG - Intronic
1162914842 19:13869163-13869185 ATTAAAAAAATTTTTTAATAAGG - Intronic
1163239818 19:16053905-16053927 GTTCAAATAATTTTTTCAACAGG - Intergenic
1163814247 19:19454290-19454312 CTGATAAAAATTTTTTAAGCCGG - Intronic
1164228953 19:23270933-23270955 CTGGAAATAATTTTTTACTCTGG + Intergenic
1164712862 19:30370745-30370767 GTGTAAAAAAATGATTAATCAGG + Intronic
1165171361 19:33894261-33894283 CTGCAGTAATTTTTTTAATCAGG + Intergenic
1166922315 19:46237710-46237732 GTGAAAAACATTTTTTTTTCGGG - Intergenic
1168673553 19:58259749-58259771 CTGCTAAAAATTTTTAAATGGGG - Intronic
924983141 2:241830-241852 TTAAAAAAAAATTTTTAATCTGG - Intronic
925255147 2:2477241-2477263 ATACAAAAAGTTTTGTAATCTGG - Intergenic
926336736 2:11868868-11868890 GTGGAGAAAAATTTTTATTCCGG - Intergenic
926497293 2:13605901-13605923 GGACAGATAATTTTTTAATCAGG - Intergenic
927330409 2:21856019-21856041 TTTAAAAAAATTTTTTAATGTGG + Intergenic
928495115 2:31823522-31823544 GTGCAAAAATGTTTTTCTTCTGG - Intergenic
930936878 2:56964008-56964030 GTGCCAACTATTTTTTAATTTGG - Intergenic
932899309 2:75679998-75680020 GAAAAAAAAATTTTTTAAACTGG - Intronic
933307802 2:80623679-80623701 TTGCAAAAACTTCTTGAATCAGG + Intronic
934133628 2:88972771-88972793 ATGAAAATAATTTTTTAATATGG + Intergenic
935499486 2:103820849-103820871 GTGGAAGAAATATTTTAAGCAGG + Intergenic
936408713 2:112234498-112234520 ATGAAAAAAATTTTTTAAATGGG + Intronic
936560795 2:113538067-113538089 GGCCTAAAAATTTTTTAACCTGG - Intergenic
936584462 2:113741888-113741910 ATTAAAAAAATTTTATAATCAGG + Intronic
936841749 2:116778183-116778205 GTACAGACAGTTTTTTAATCTGG - Intergenic
938629132 2:133146468-133146490 ATGCAAGGAATCTTTTAATCTGG + Intronic
938649749 2:133370495-133370517 GTGGAAAAAGGGTTTTAATCTGG + Intronic
939644293 2:144677655-144677677 CTACAAATAATTTTTTACTCAGG - Intergenic
940537905 2:154969695-154969717 CTGCTAAAAAGTTTTTAATGTGG + Intergenic
940673929 2:156705531-156705553 GGGAAAAAAATATTTCAATCTGG - Intergenic
942814675 2:180037920-180037942 GTGACAAAAATTTTCTAATGGGG - Intergenic
943523138 2:188979644-188979666 TTGCAAAATATTTTTCTATCTGG - Intronic
943692606 2:190883216-190883238 GTGAAGAAAGTTTTTTAATTTGG + Intronic
943975264 2:194468654-194468676 GTGAAAAAAATTTCTAAGTCAGG + Intergenic
944083841 2:195821248-195821270 ATGCAAACAATTTATAAATCAGG - Intronic
944760840 2:202811869-202811891 GTTAAAAAAATTTTCTACTCAGG + Intronic
945039846 2:205734451-205734473 GTGCAACAAATTAATTAAACAGG + Intronic
946146635 2:217735947-217735969 GTGCAATAAATGGATTAATCTGG + Intronic
947784195 2:232800526-232800548 TTGCAATAAATTTTGAAATCAGG + Intronic
1169139552 20:3219442-3219464 TTGCAAAAAATTTTAAAATGAGG + Intronic
1169481657 20:5988108-5988130 ATTAAAAAAATTTTTTTATCTGG - Intronic
1169666394 20:8041301-8041323 GTGCAAGAAACAGTTTAATCTGG + Intergenic
1170318862 20:15071959-15071981 GTTTAAAAAATTTTTTAAGGGGG + Intronic
1170959486 20:21012543-21012565 GTGCAAAAATCTCTTTCATCTGG - Intergenic
1171353302 20:24522253-24522275 CTACAAAAAATTTTTAAAGCTGG - Intronic
1173711534 20:45161088-45161110 GTGCAATATATTTTGAAATCTGG - Intergenic
1174316014 20:49702437-49702459 GCACAAAAAAGTTTTTAATGAGG - Intronic
1174495483 20:50938678-50938700 GCCCAAAAAATTTTTTAAATAGG - Intronic
1177313890 21:19431444-19431466 GTGCAAAAATTTTTTTTAAGAGG - Intergenic
1177851093 21:26349611-26349633 GTGGAAAATATTTTTAAATTAGG + Intergenic
1178324570 21:31633532-31633554 TTGTAAAATATTTTGTAATCAGG + Intergenic
1178897419 21:36570682-36570704 CTACAAATAATTATTTAATCTGG + Intronic
1182404661 22:30115745-30115767 ATGAAGAAAATTTTTTAAACAGG + Intronic
1182943899 22:34304414-34304436 GTGCAAACAAGTTATTAATCAGG - Intergenic
1184186839 22:42870620-42870642 GTGAAAATAATTTTTAAATATGG + Exonic
949179227 3:1107132-1107154 GTCCAAAATATTATTTAATATGG + Intronic
949568861 3:5272159-5272181 GAGAAAAAAATTTTTTAATTGGG - Intergenic
950128443 3:10525714-10525736 CTACAAGAAATATTTTAATCTGG + Intronic
950140211 3:10610187-10610209 GTGTAAAATTTTTTTTTATCTGG + Intronic
951416165 3:22424431-22424453 GTGCAAAAAATTATTTGCACAGG - Intergenic
953089282 3:39707423-39707445 TTTCAAAAAATATTGTAATCTGG - Intergenic
953381626 3:42476791-42476813 CTGCAATTAGTTTTTTAATCTGG + Intergenic
955649965 3:61183485-61183507 GTGCAGCAAATCTTTTGATCAGG - Intronic
957231370 3:77520442-77520464 GTGCAATAATTTTTTTTAACTGG + Intronic
957442369 3:80266101-80266123 TTGTATAAAAGTTTTTAATCTGG - Intergenic
957979746 3:87493790-87493812 GTGCTAAAAATTTTTCCATCTGG - Intergenic
958599970 3:96284745-96284767 CTGCAAGAAAATTTTTATTCAGG + Intergenic
958725444 3:97900050-97900072 ATGAAAAAAATTTTTCAAGCTGG + Intronic
959294288 3:104515360-104515382 GTGGAGAAGATTTTTGAATCTGG + Intergenic
959304739 3:104647543-104647565 GTGCAATAATGTTTTTAATTTGG + Intergenic
960269735 3:115660709-115660731 GTGCAAAAGATTTGTTAAAATGG + Intronic
960736131 3:120782634-120782656 GTGCTATAAATTGTTTAATGAGG + Exonic
961011434 3:123438914-123438936 CTACAAAAAATTTTTTAAAAAGG - Intronic
962550594 3:136486854-136486876 GTGTAAAAAATGTTTTGAACAGG - Intronic
963245577 3:143057125-143057147 GTGAAAAAAATGTTTTAGCCAGG - Exonic
963715141 3:148794367-148794389 ATGCAATAATTTTTTTAATGTGG + Intronic
964198899 3:154095380-154095402 GTGCAAAGAACTTTTTTTTCTGG - Intergenic
964653517 3:159040303-159040325 TTTCAAAAAATTTTGAAATCAGG - Intronic
964850360 3:161089362-161089384 GGGCAAAAAATTTTTTCATGTGG + Intronic
965367996 3:167822578-167822600 AAGGAAAAAATTTTTTATTCTGG + Intronic
965742347 3:171889331-171889353 TTGAAAAATATTTTTTAAACAGG - Intronic
965841786 3:172913818-172913840 GTACAAATGATTTTTTAATTAGG - Intronic
969381886 4:6806271-6806293 GTAAAAAAAAATTTTTAATATGG + Intronic
970040175 4:11787457-11787479 CTACAAAAACTTTTTTCATCTGG - Intergenic
970941101 4:21634969-21634991 GTGAATACAATTTTGTAATCTGG - Intronic
970941396 4:21638206-21638228 GTGCAATAAATTTTCCAATCAGG + Intronic
971825612 4:31618240-31618262 GTACAAAAAAGATTTTAATCTGG + Intergenic
971896513 4:32604107-32604129 TTGCAAAAAAATTTTTCATTTGG + Intergenic
973645554 4:52948034-52948056 GTACAAAAAATTCTTTACACAGG + Intronic
974108518 4:57499428-57499450 GTGAAAATTATTTTTTAATTAGG - Intergenic
974205263 4:58694742-58694764 TTGTAATAAATTTTGTAATCGGG - Intergenic
974939922 4:68454544-68454566 GGGCAGAAAATTCTTTAATCAGG + Intronic
975420237 4:74156077-74156099 GTGAATAATATTTTTTAATATGG + Intronic
976559689 4:86487426-86487448 GTGTCAAAAATTGTTAAATCTGG + Intronic
976583026 4:86762388-86762410 GTGCAAATAACTATTTAATAAGG + Intronic
976870267 4:89783959-89783981 GTGCAAAAATTTTCTTCAACAGG - Intronic
977047598 4:92087483-92087505 GAGCAACAAATATTTTATTCAGG - Intergenic
977318024 4:95475608-95475630 ATGCAAAATATCTTTTATTCTGG - Intronic
977639180 4:99335747-99335769 GTGCAAAATTGTTTTTAATCTGG - Intergenic
977913577 4:102565164-102565186 GCACAAAAAATTTCTTAAACAGG - Intronic
978590022 4:110314946-110314968 GCACACAAAATTTTTTAATCTGG - Intergenic
979368759 4:119857503-119857525 ATTCAAAAAATTTTTAAATGTGG - Intergenic
979418377 4:120472147-120472169 GTGCAACATTTTTTCTAATCTGG - Intergenic
979493792 4:121361757-121361779 GTGAAAAAAATATTTTAGTCTGG - Intronic
979989285 4:127355449-127355471 GTGGAAAAAATTTATAAAACTGG - Intergenic
981469867 4:145120493-145120515 GAGGAAAAAATTTTTAAAGCTGG - Intronic
983440047 4:167770523-167770545 GTGCAAAATATCTCTCAATCAGG + Intergenic
983954018 4:173676053-173676075 CTGTAAAAAATTTTTTAAAAAGG + Intergenic
984487305 4:180387321-180387343 CTGCAAAACATTTTCTATTCAGG + Intergenic
985425557 4:189827053-189827075 TTTCAAAAAAATTTTTACTCTGG + Intergenic
986213106 5:5692535-5692557 TTGCAAGAAATTTTGTTATCAGG - Intergenic
986847965 5:11777944-11777966 GTCCAAAAAATCTTTTATTCTGG - Intronic
988273668 5:29052421-29052443 GTGCGAAATATTTTTTAAGAAGG - Intergenic
988594001 5:32574434-32574456 GTCCAAAAAGTTTTTTAAAAAGG + Intronic
988632535 5:32946256-32946278 GTGCAAACATTTTTTTTGTCAGG - Intergenic
989230500 5:39081029-39081051 TTGAAAAAAATTATTTAATATGG - Intergenic
990282121 5:54262344-54262366 GGGTAAAATATTTTATAATCTGG - Intronic
990991854 5:61693040-61693062 TTGCAATATATTTTTCAATCAGG + Intronic
991688383 5:69203350-69203372 TTAAAAAAAATTTTTTAATATGG + Intronic
991957371 5:72008561-72008583 GTCTGAAAAATTATTTAATCAGG - Intergenic
992311209 5:75500865-75500887 ATGTAAAAAATTTTTGAATGTGG - Intronic
992716493 5:79515570-79515592 GTTAAAACAATTTTTTAATTAGG + Intergenic
992980659 5:82168108-82168130 ATACAAAAAATTCTTTAATATGG - Intronic
993475187 5:88355945-88355967 CTGTAAGAAATTTTTTACTCTGG - Intergenic
993650551 5:90515689-90515711 GGGCAAAAAATTTTAAAAACTGG + Exonic
994056919 5:95427339-95427361 GTGTAAAACATCTTTTGATCAGG + Intronic
994339435 5:98609194-98609216 GTGCAAAAGGTTTTTTATTGTGG - Intergenic
994381694 5:99079255-99079277 CTGCTAAAAATTTATTAATGCGG + Intergenic
994617989 5:102130493-102130515 GTTAAAATAATTTTTTAATCAGG + Intergenic
994657861 5:102616092-102616114 GTGCAAAATATTGTTTGATTTGG - Intergenic
994904005 5:105813024-105813046 CTGCAAAACAGTTTTTAATGAGG + Intergenic
995678696 5:114692950-114692972 ATGAAAAATATTTTTTAATTGGG - Intergenic
997717185 5:136051091-136051113 GTGCAAATCATGTTTTAATAGGG - Intronic
998065478 5:139154621-139154643 TTGCAAAATATTTTTTACACCGG - Intronic
998109950 5:139493687-139493709 AAGAAAAAAATTTTTTAGTCTGG + Intergenic
998979471 5:147685648-147685670 GTGGAATAAATTTTTTAAGTAGG - Intronic
999006417 5:147985105-147985127 GTCCCAACAATTTTTTAAACAGG + Intergenic
999778230 5:154828012-154828034 CTACAAAAAATTTTTTAACTAGG - Intronic
1000472442 5:161661792-161661814 GGGAAAAAAATGTTTTAATGAGG + Intronic
1000486469 5:161850384-161850406 GTGCATTAAAATTTTTAAGCTGG - Intronic
1000554977 5:162715355-162715377 GTGAAAAAAATTAATTAATCTGG - Intergenic
1000565180 5:162837756-162837778 ATGCAAATAATTTTTTAGTACGG - Intergenic
1001422365 5:171597482-171597504 TTTCAAAAAAATTTTTCATCAGG - Intergenic
1004779071 6:18885321-18885343 CTGCAAATAATTTTTTACTAAGG - Intergenic
1004872475 6:19920958-19920980 GTGAAGAAAATTCTTTAATATGG - Intergenic
1006301566 6:33196189-33196211 GTGCAAACAATTATTTATTTGGG + Intronic
1007253652 6:40513532-40513554 GTTCAAAAAATTGTTAAATGAGG - Intronic
1008841138 6:55905951-55905973 GAGTGAAAAATTTATTAATCAGG + Intergenic
1008918164 6:56812343-56812365 GTGAAAGAAATGTCTTAATCAGG + Intronic
1009553038 6:65124324-65124346 ATGCAACAAATTTATTCATCTGG - Intronic
1010192758 6:73210326-73210348 GTGAAGAAAATTTTTGATTCCGG - Intronic
1010694630 6:78955430-78955452 TTAAAAAAAATTTTTTAATGGGG - Intronic
1010796914 6:80127324-80127346 TTACAAAAAATTGTTTAATATGG + Intronic
1011569890 6:88724304-88724326 GTACAAAAGATTTTTTAAAATGG - Intronic
1013021541 6:106225779-106225801 GTGCAAACAATTTTATCACCAGG + Intronic
1014030619 6:116698524-116698546 GTACAAAAAACATTGTAATCTGG + Intronic
1014425834 6:121304809-121304831 GTGCACAGAATTTTAAAATCCGG + Exonic
1015217935 6:130771324-130771346 TTGCAAAACATTTTTAAATTTGG + Intergenic
1015230048 6:130904278-130904300 GTGAATAAAATTTTTGAAACTGG + Intronic
1015607382 6:134972603-134972625 TTGCACAAAAGTTTTTAATTTGG - Intronic
1015703510 6:136062190-136062212 GTGGAAAAAATTTTTAAAAAAGG - Intronic
1016088759 6:139948972-139948994 TTGCAAAAAATTTCTTTATAGGG - Intergenic
1016447319 6:144147394-144147416 TTACAAAAATTTTTTTAATTTGG + Intergenic
1016644298 6:146387573-146387595 GTGCATAAAGTTTGTTAAGCAGG + Intronic
1016702469 6:147069254-147069276 GGGAAGACAATTTTTTAATCTGG - Intergenic
1018550327 6:164990399-164990421 ATGCTAAAAATATTTTAATATGG - Intergenic
1021482046 7:21128919-21128941 GTGCAAAACCTTTTGTAAACAGG + Intergenic
1022947030 7:35296305-35296327 TTGCAAAGAATTTTCTAATTTGG + Intergenic
1023492891 7:40763115-40763137 ATGCATAAAATTTTTTATGCTGG - Intronic
1024440824 7:49415740-49415762 TTGCAATAAATTTTGTATTCTGG - Intergenic
1025106924 7:56178899-56178921 GGGAAAAAAATTTTTGAATTAGG - Intergenic
1026944815 7:74308856-74308878 GTTAAAAAAATTTTTTAAAAAGG - Intronic
1028833103 7:95346724-95346746 GTGTTAGAAATTTTTAAATCAGG - Intergenic
1030543357 7:110861565-110861587 TTTTAAACAATTTTTTAATCCGG + Intronic
1030776654 7:113541950-113541972 GTTAAAAAAATTCTTGAATCAGG - Intergenic
1031462186 7:122064894-122064916 GTGCAGAAAAGCTTTTCATCAGG + Intergenic
1035134079 7:156683766-156683788 GTGAAAACAATTTTTTCATATGG + Exonic
1035961381 8:4142191-4142213 ATATAAAAAATGTTTTAATCTGG - Intronic
1036200444 8:6766596-6766618 GTTGACAAAATTTTTTAATTCGG - Intergenic
1037923195 8:22822872-22822894 CTTCAATTAATTTTTTAATCTGG + Intronic
1038370779 8:26988027-26988049 GTGAAAAAAAATTCTTAATTTGG + Intergenic
1038827841 8:31024915-31024937 TTGCAAAAAATTTTTCTATTCGG - Intronic
1039727722 8:40237905-40237927 GTGCAAATAATTTTTCATTTTGG - Intergenic
1040476713 8:47784532-47784554 GAGGAAAAAAAGTTTTAATCTGG - Intronic
1041291033 8:56308655-56308677 GTGCAAAAAATTTATCAGTGAGG + Intronic
1041400273 8:57435533-57435555 GTGCAAATTATTTTTAAATATGG - Intergenic
1041494933 8:58475565-58475587 GTGCAGAAGGTTTTTTAATTTGG + Intergenic
1041987867 8:63947619-63947641 GTGCAATTTATTTTTTAGTCTGG + Intergenic
1042244812 8:66699665-66699687 CTACAAAAAATTTTTTAAGCCGG - Intronic
1042271404 8:66960353-66960375 GTTCAATAAATTATTTAATATGG - Intronic
1043608890 8:82036958-82036980 GTGCAAGAAATATTTTAAGAAGG + Intergenic
1043733248 8:83712083-83712105 GTGCTAAACAGTTTTTATTCAGG - Intergenic
1044535183 8:93349677-93349699 GAGAAAAAAATATTTAAATCTGG + Intergenic
1045106665 8:98899279-98899301 TTGCAAAAAATTTTGCAAACTGG - Intronic
1045529714 8:102972902-102972924 TTTTAAAAAATTCTTTAATCAGG - Intronic
1046137829 8:110053128-110053150 GTGCAAAAAGTTAATTAATATGG - Intergenic
1046639349 8:116709284-116709306 GCCCAAAAAATTTTTTAAAAAGG + Intronic
1047249647 8:123172092-123172114 TTACAAAAAATATTTTAATTTGG + Intergenic
1049891883 9:77257-77279 GGCCTAAAAATTTTTTAACCTGG + Intergenic
1051797562 9:20890568-20890590 GTGCTAAAATTTTGTTAATAAGG + Intronic
1051864807 9:21667701-21667723 GTTCAAAAAGGTTTTTAATTTGG + Intergenic
1051940412 9:22499085-22499107 GTGCAGAAAAAGTTTTAATATGG + Intergenic
1053733309 9:41078350-41078372 GGCCTAAAAATTTTTTAACCTGG + Intergenic
1054649516 9:67614866-67614888 TTGGAAAAAATTAATTAATCTGG - Intergenic
1057113616 9:92499357-92499379 GAGCAAAAAATTTTTTACAGAGG + Intronic
1057464921 9:95304322-95304344 CTGCAAAAAAGTTTTCAAACAGG + Intronic
1057487458 9:95497076-95497098 GTAGAATAAATTTCTTAATCAGG + Intronic
1058336814 9:103839449-103839471 GTGCAAGAACTTTGTTAAGCAGG - Intergenic
1185610280 X:1390299-1390321 TTTAAAAAAATTTTTTAAGCCGG + Intronic
1186346530 X:8699649-8699671 GTGCAAAAAACTTTTAATTTTGG - Intronic
1186892054 X:13968637-13968659 GGGCAGAGGATTTTTTAATCTGG - Intergenic
1187044200 X:15629966-15629988 TTGCAAAACATTTTTAAATTTGG - Intronic
1187113428 X:16324825-16324847 GTTCAAAAAATTAATGAATCCGG + Intergenic
1187306742 X:18102055-18102077 TTGCAGAGAATTATTTAATCTGG - Intergenic
1188594379 X:31879477-31879499 TTGTAAAAAATTATTTAATAAGG + Intronic
1189495966 X:41509041-41509063 TTTACAAAAATTTTTTAATCAGG + Intergenic
1189919291 X:45887766-45887788 GTGCAAGTAATTTGTTTATCTGG + Intergenic
1191671225 X:63750681-63750703 GTGAAAAAAATTGTTTTTTCAGG + Intronic
1192272262 X:69592537-69592559 GTTCAGAAAATTTTTGTATCAGG - Intergenic
1192717653 X:73660806-73660828 GTCCAAATAATTTGTTAATGTGG - Intronic
1193110387 X:77723612-77723634 GTACAAAAAAATTTATCATCAGG + Intronic
1193541405 X:82776603-82776625 GTATAAAAAATTTTGTAACCTGG + Intergenic
1193763392 X:85494594-85494616 GAGGTAAAAATTTTTTAATCTGG - Intergenic
1194178455 X:90683356-90683378 GTGAAAAAGCTATTTTAATCGGG + Intergenic
1195109173 X:101628533-101628555 GAGGAAAAAAGTTTTAAATCAGG - Intergenic
1196349053 X:114703747-114703769 CTTCAAAAAATTATTGAATCCGG + Intronic
1196350468 X:114723470-114723492 CTTCAAAAAATTATTGAATCCGG - Intronic
1196915166 X:120527027-120527049 GTATAAAACATTTTTTAACCTGG - Intronic
1197231497 X:124008648-124008670 TTGCAATTAATTTATTAATCAGG + Intronic
1197400132 X:125979640-125979662 GAGCAAAAAATTGTTTCATGGGG - Intergenic
1197445015 X:126542903-126542925 TTTTAAAAAATTTTTAAATCTGG - Intergenic
1198047650 X:132918500-132918522 GGGCCAGAAATTTTTTAAACTGG + Intronic
1200525118 Y:4265521-4265543 GTGAAAAAGCTATTTTAATCGGG + Intergenic
1200751383 Y:6947098-6947120 GTCCAAAAGATTTTTTAAAAGGG - Intronic
1201343760 Y:12960407-12960429 GGTCAAAAAATTTTTTTTTCCGG - Intergenic