ID: 1070795242

View in Genome Browser
Species Human (GRCh38)
Location 10:79212478-79212500
Sequence TTTTTTGCACAGATGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795234_1070795242 11 Left 1070795234 10:79212444-79212466 CCACTGGCCTACACCATCACACC 0: 1
1: 0
2: 9
3: 168
4: 1388
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795230_1070795242 30 Left 1070795230 10:79212425-79212447 CCTCCTAAGTACCTAGGTACCAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795237_1070795242 -10 Left 1070795237 10:79212465-79212487 CCAGATTAAAAAATTTTTTGCAC 0: 1
1: 0
2: 1
3: 27
4: 383
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795231_1070795242 27 Left 1070795231 10:79212428-79212450 CCTAAGTACCTAGGTACCACTGG 0: 1
1: 0
2: 0
3: 2
4: 131
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795235_1070795242 4 Left 1070795235 10:79212451-79212473 CCTACACCATCACACCAGATTAA 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795236_1070795242 -2 Left 1070795236 10:79212457-79212479 CCATCACACCAGATTAAAAAATT 0: 1
1: 0
2: 4
3: 38
4: 353
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data
1070795233_1070795242 19 Left 1070795233 10:79212436-79212458 CCTAGGTACCACTGGCCTACACC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795242 Original CRISPR TTTTTTGCACAGATGGGGCT GGG Intronic
No off target data available for this crispr