ID: 1070795638

View in Genome Browser
Species Human (GRCh38)
Location 10:79214833-79214855
Sequence CTGCTGTTCATGAGGAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070795633_1070795638 11 Left 1070795633 10:79214799-79214821 CCAAGGTCCTTCTTAATAAAGAA 0: 1
1: 0
2: 4
3: 18
4: 245
Right 1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG No data
1070795634_1070795638 4 Left 1070795634 10:79214806-79214828 CCTTCTTAATAAAGAAAGCTAAT 0: 1
1: 0
2: 5
3: 38
4: 490
Right 1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG No data
1070795632_1070795638 18 Left 1070795632 10:79214792-79214814 CCATTTTCCAAGGTCCTTCTTAA 0: 1
1: 1
2: 5
3: 30
4: 275
Right 1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070795638 Original CRISPR CTGCTGTTCATGAGGAAGGC GGG Intronic
No off target data available for this crispr