ID: 1070797266

View in Genome Browser
Species Human (GRCh38)
Location 10:79223918-79223940
Sequence CAGGCCAAGGAATTGGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070797252_1070797266 26 Left 1070797252 10:79223869-79223891 CCTCACTGTGCTCTTGGAGAAAA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 1070797266 10:79223918-79223940 CAGGCCAAGGAATTGGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070797266 Original CRISPR CAGGCCAAGGAATTGGGGGG AGG Intronic
No off target data available for this crispr