ID: 1070797804

View in Genome Browser
Species Human (GRCh38)
Location 10:79227137-79227159
Sequence TGCCCCTGCTTTCTATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070797799_1070797804 -7 Left 1070797799 10:79227121-79227143 CCCCAAAGCCACCAGCTGCCCCT 0: 1
1: 1
2: 3
3: 54
4: 428
Right 1070797804 10:79227137-79227159 TGCCCCTGCTTTCTATGAACAGG No data
1070797800_1070797804 -8 Left 1070797800 10:79227122-79227144 CCCAAAGCCACCAGCTGCCCCTG 0: 1
1: 0
2: 2
3: 49
4: 364
Right 1070797804 10:79227137-79227159 TGCCCCTGCTTTCTATGAACAGG No data
1070797798_1070797804 24 Left 1070797798 10:79227090-79227112 CCAAAATTGTGATTCAAACAAGA 0: 1
1: 0
2: 1
3: 22
4: 285
Right 1070797804 10:79227137-79227159 TGCCCCTGCTTTCTATGAACAGG No data
1070797801_1070797804 -9 Left 1070797801 10:79227123-79227145 CCAAAGCCACCAGCTGCCCCTGC 0: 1
1: 0
2: 5
3: 43
4: 518
Right 1070797804 10:79227137-79227159 TGCCCCTGCTTTCTATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070797804 Original CRISPR TGCCCCTGCTTTCTATGAAC AGG Intronic
No off target data available for this crispr