ID: 1070797814

View in Genome Browser
Species Human (GRCh38)
Location 10:79227238-79227260
Sequence AAATCATTGTCAAACACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070797814_1070797818 14 Left 1070797814 10:79227238-79227260 CCTTAAGTGTTTGACAATGATTT 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1070797818 10:79227275-79227297 GTTAAACACCCTCCCATCTTTGG No data
1070797814_1070797819 15 Left 1070797814 10:79227238-79227260 CCTTAAGTGTTTGACAATGATTT 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1070797819 10:79227276-79227298 TTAAACACCCTCCCATCTTTGGG No data
1070797814_1070797816 -8 Left 1070797814 10:79227238-79227260 CCTTAAGTGTTTGACAATGATTT 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1070797816 10:79227253-79227275 AATGATTTGTCCTTGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070797814 Original CRISPR AAATCATTGTCAAACACTTA AGG (reversed) Intronic
903334329 1:22614722-22614744 AAATCTTTCTCTAACACTCAAGG - Intergenic
903507061 1:23844474-23844496 AAATCTTTATCCAACATTTAAGG - Intergenic
904810318 1:33159556-33159578 AAATCTTCATCAAACATTTACGG - Intronic
906912186 1:49965920-49965942 AAATCATTGTAATAGACTAATGG - Intronic
907538064 1:55183293-55183315 AATTCATTCTCAAACAGTTCAGG + Intronic
908063236 1:60374188-60374210 AAAACAGTGGCAAACTCTTAAGG - Intergenic
909638655 1:77847183-77847205 GAATCATTCCCAAACACTGACGG - Intronic
910175645 1:84427476-84427498 AAATCTTTGTCTAACACCTCTGG - Intergenic
917401570 1:174655076-174655098 AAATCACTCTCAAACAGTTTAGG - Intronic
917940370 1:179914105-179914127 AAAACATTTTTAAACAATTATGG - Intronic
919304708 1:195817223-195817245 AAATTATTCTAAAACACATATGG - Intergenic
919620199 1:199856373-199856395 AAATAATTGGGAAACAATTACGG + Intergenic
921186386 1:212673317-212673339 CAATAATTGGTAAACACTTAGGG - Intergenic
921503757 1:215940585-215940607 TATACATTGTCAAAAACTTAAGG - Intronic
923234933 1:232023312-232023334 AAATAATTGTCAAACAATAAAGG - Intronic
923403900 1:233642044-233642066 AGATGATTGACAAACACATAAGG - Intronic
923779971 1:237013433-237013455 AAATCATTGTGAAGAACTCAGGG + Intergenic
924027599 1:239851660-239851682 GAATCATTGTAATATACTTATGG + Intronic
1064642983 10:17433303-17433325 AAATAATTGTTAAACACCTGTGG + Intronic
1067777164 10:49172042-49172064 GCATCATTGACAAACACTTAGGG - Intronic
1068753939 10:60629235-60629257 ATATCCATGTCAAACATTTAAGG + Intronic
1068836679 10:61562782-61562804 AATTCATTGCCAAACACTGAAGG + Intergenic
1068951200 10:62779293-62779315 AAATCATTCTCAAAACCTCATGG - Intergenic
1069232249 10:66025410-66025432 AAAACAATGTCAAACACCCATGG + Intronic
1069358806 10:67618381-67618403 AAATGATTATCAAACAATTCTGG - Intronic
1069523683 10:69148033-69148055 AAAACTTTGTCAAACTCTTTAGG + Intronic
1069579010 10:69552426-69552448 AAATCATTGTCAGAGACACAAGG + Intergenic
1070797814 10:79227238-79227260 AAATCATTGTCAAACACTTAAGG - Intronic
1071389397 10:85155884-85155906 AAAGCATTGTCAAATAATAAAGG + Intergenic
1071775508 10:88782792-88782814 AAAACATTCTCAGACACTCAAGG - Intergenic
1072266989 10:93740252-93740274 AAATCTTACACAAACACTTATGG - Intergenic
1078670705 11:13362563-13362585 AAATCAATGATAAACACTTTAGG + Intronic
1079722763 11:23839612-23839634 AAATTATTGTTAAACATTCAGGG + Intergenic
1080158876 11:29146832-29146854 AAATCATTGGAAAAAACATAGGG + Intergenic
1080954353 11:37075652-37075674 AAATAAATTTCTAACACTTATGG - Intergenic
1081392666 11:42547309-42547331 AAATAGTTGTCAAACCCTGAAGG - Intergenic
1085491741 11:76925758-76925780 AAAACATTTTCAAACAGTCAAGG - Intronic
1087308395 11:96510606-96510628 AAATCTTTGTTAGAGACTTACGG + Intergenic
1087673594 11:101133387-101133409 AAATCATTATGAGTCACTTAAGG + Intergenic
1088432914 11:109778248-109778270 AAATCATTGTCTTACATTTCTGG + Intergenic
1088759610 11:112916939-112916961 AAAACATTTCTAAACACTTAGGG + Intergenic
1090455013 11:126841626-126841648 AAACATTTGTCAAATACTTATGG - Intronic
1094783807 12:33822309-33822331 AATTCAAGGACAAACACTTAAGG + Intergenic
1098675019 12:73279225-73279247 AATTCATTGTCTTACACTTCTGG + Intergenic
1098725347 12:73957783-73957805 AAAACATTTTCAAATACTGAGGG - Intergenic
1099659570 12:85538748-85538770 AAATCATGTTCAAATAATTATGG - Intergenic
1102936454 12:116901247-116901269 AAATCATGTTTAATCACTTAAGG - Intergenic
1103741405 12:123094085-123094107 AAAGCATCGTCAAACACTCCAGG + Intronic
1105476940 13:20736356-20736378 AAAGCATTTTCAAACACGAAAGG + Intronic
1106625682 13:31418746-31418768 AAATCATTATGAAACTGTTAGGG + Intergenic
1106634572 13:31513877-31513899 ATATAATTGTCAACCACTTGGGG - Intergenic
1107089840 13:36466631-36466653 AAATCATTGGGAAACACCTCAGG - Intergenic
1107168888 13:37316683-37316705 ATACCATAGTCAAACACTTAAGG - Intergenic
1107318796 13:39163701-39163723 AAATAATTTTTAAACCCTTAAGG - Intergenic
1107657098 13:42602923-42602945 AAATCATTGCCAAAAACACAAGG + Intronic
1107798274 13:44077389-44077411 AAATTATTTTCAACCAGTTAAGG + Intergenic
1109458229 13:62622253-62622275 AAAACATAGTAAAACACTTTAGG + Intergenic
1109802114 13:67394121-67394143 AAATCATGATCAAACACTTCAGG - Intergenic
1110122214 13:71896107-71896129 AAATCATTGATACACACTTTTGG + Intergenic
1110570193 13:76994421-76994443 AAATCATTGTTAACCAGGTATGG - Intronic
1110616884 13:77551478-77551500 AAATCATTGTCTCACAGTTGTGG + Intronic
1111159735 13:84378624-84378646 AAATAATTATCTAACGCTTAAGG + Intergenic
1111788553 13:92822817-92822839 AAAGCAATGTAAAACTCTTACGG + Intronic
1111877502 13:93915474-93915496 AAATCATTATCTAAAACTGAAGG + Intronic
1111886838 13:94032083-94032105 GAAGCATTCTCTAACACTTAGGG - Intronic
1113003757 13:105675798-105675820 GAAACATTGCCAAACTCTTATGG + Intergenic
1113026716 13:105948594-105948616 ACATCATTGACAAACACACAGGG + Intergenic
1114215420 14:20654310-20654332 GAAACATTGTCAAACACATGGGG - Intergenic
1114808969 14:25873397-25873419 GAGTCTTTTTCAAACACTTATGG + Intergenic
1115327262 14:32153974-32153996 ATATTAGTGTCAAACACCTATGG + Intronic
1116937294 14:50754330-50754352 AAAGCTTTATCAAGCACTTAGGG + Intronic
1119665412 14:76481827-76481849 AAATAATTGTCTAACAGTAATGG - Intronic
1119692101 14:76681697-76681719 AGATCATTCTCAAAAACATATGG - Intergenic
1120328595 14:83058789-83058811 AAATAATTGGCACACACTAAAGG + Intergenic
1120767217 14:88339521-88339543 AAATAGTTGTAAAACAATTAGGG - Intergenic
1121947691 14:98138651-98138673 AGATCATTTTCAAACACATAAGG - Intergenic
1123496546 15:20832931-20832953 AAATCATTGTAAAACATTGCAGG - Intergenic
1123553783 15:21406521-21406543 AAATCATTGTAAAACATTGCAGG - Intergenic
1123590025 15:21843886-21843908 AAATCATTGTAAAACATTGCAGG - Intergenic
1124451144 15:29792202-29792224 AAAACATTGGGAAACACTAAAGG - Intronic
1127667190 15:61159436-61159458 AAACCCTTGTCAAAAACTGATGG + Intronic
1129349764 15:74948705-74948727 AAATTATTGTCTAACAGTTCTGG + Intergenic
1202962128 15_KI270727v1_random:133717-133739 AAATCATTGTAAAACATTGCAGG - Intergenic
1133861845 16:9603079-9603101 AAATGATTCTAAAACACATATGG + Intergenic
1135579923 16:23616747-23616769 AAAACATTCTTAAACACTGAGGG - Intronic
1135866124 16:26103750-26103772 AAATGAATGTGAAACACTCAAGG - Intronic
1140898267 16:79344817-79344839 AAATCATTGTCAAGAACATAAGG + Intergenic
1141180144 16:81746943-81746965 AATTCATAGGCAAAAACTTAAGG + Intronic
1141383256 16:83595410-83595432 AAAACTTTGTCATCCACTTAGGG + Intronic
1143098543 17:4491680-4491702 AAAGCAAAGTCAAACACTTCAGG - Intergenic
1143311622 17:5996078-5996100 AAATAATTGTCCAGCACTTTGGG - Intronic
1143595899 17:7913640-7913662 AAATCATAATTATACACTTATGG - Intergenic
1143925807 17:10368858-10368880 AAATCATCTTCCAACACTTTTGG - Intronic
1146114034 17:30118135-30118157 GAATCATTCCCAAACACTGATGG - Exonic
1147395247 17:40137797-40137819 CAAGAATTTTCAAACACTTAGGG - Intergenic
1149944886 17:60913703-60913725 AAATCATTATCAAAGGCTCAAGG - Intronic
1150533940 17:66015072-66015094 AAATAATTGTGAAATATTTATGG - Intronic
1154454461 18:14508614-14508636 AAATCATTGTAAAACATTGCAGG - Intronic
1155973737 18:32106338-32106360 AAATCATTTTGTATCACTTAAGG - Intronic
1156334484 18:36156510-36156532 TAATCATTGCCAAACATTTCAGG - Exonic
1156447543 18:37248659-37248681 AACTCATTCTCAACTACTTAGGG - Intronic
1156731509 18:40198917-40198939 AAATCATTGTAATCTACTTAGGG - Intergenic
1157246602 18:46060256-46060278 AAATCACTTTCAAAAATTTAAGG - Intronic
1159148783 18:64492510-64492532 AAATCTTTTTCAAAGACTTAAGG + Intergenic
1160031184 18:75261305-75261327 ACATCATTGTAACACATTTATGG + Intronic
1161570107 19:5025765-5025787 AAGTGATTGTCAAACACGCAGGG - Intronic
1162364309 19:10238576-10238598 CAATATTTGTAAAACACTTAGGG - Intergenic
1167775933 19:51555535-51555557 AAATAATTGCCAAATTCTTATGG - Intergenic
1202636105 1_KI270706v1_random:46123-46145 AAATCATTGTAAAACATTGTAGG - Intergenic
926851215 2:17199546-17199568 AAATCACTGTAAAACACTCTAGG + Intergenic
927394496 2:22634009-22634031 AAACCATTTTAAAACACTTAGGG + Intergenic
928227613 2:29466437-29466459 CAATAATTTTCAAACACATATGG + Intronic
931819792 2:65940157-65940179 AAATCATTGGCAGACATTTGGGG + Intergenic
931934911 2:67186297-67186319 ATTTCATTGTGAAATACTTAAGG - Intergenic
932924080 2:75950745-75950767 ACATCATTGTGAAGCACATATGG - Intergenic
933379426 2:81524131-81524153 AAATCAATGTCAGCCACTCATGG - Intergenic
934689100 2:96344409-96344431 GAATCATTCTGAAACACTGAGGG - Intronic
936465850 2:112749466-112749488 ACATTATTTTCAAACACTTTTGG + Intronic
938554309 2:132410280-132410302 AAATCCTGGTCATACACATATGG + Intergenic
939386528 2:141507160-141507182 AATTCATTGTTAAACATTTTAGG - Intronic
941802948 2:169681249-169681271 AAATGATTATTAAAGACTTACGG + Intronic
943355030 2:186843848-186843870 AAATCCCTGTGAAACACTAATGG + Intronic
943479475 2:188400050-188400072 AATTCATTGTATAACAGTTATGG + Intronic
944037638 2:195314875-195314897 AACTCATCATCAAACATTTAGGG - Intergenic
944337017 2:198546136-198546158 AAATCATTATCAAACTATTAAGG + Intronic
945198302 2:207257607-207257629 AATGCCTTGTAAAACACTTATGG + Intergenic
945651381 2:212564779-212564801 AAATCCTTGTCAAACATTAAAGG + Intergenic
948796264 2:240403712-240403734 AAATCATTGTGAAAAACACATGG + Intergenic
948871752 2:240803868-240803890 AAATCATTACCAAACAGTTGAGG + Intronic
949038441 2:241832443-241832465 TAAACTCTGTCAAACACTTAAGG + Intergenic
1170564725 20:17592116-17592138 AAATCATTATCAAGAACCTAGGG + Intronic
1171115042 20:22518305-22518327 AAACCATTCTCAGACACATAAGG + Intergenic
1174242649 20:49150244-49150266 AAAGGATTGTCAAAGAATTAGGG - Intronic
1174903523 20:54525504-54525526 TAATAATTGTGAGACACTTAAGG + Intronic
1176819709 21:13644691-13644713 AAATCATTGTAAAACATTGCAGG + Intergenic
1176880968 21:14192532-14192554 AATGTATTGTCAAACTCTTAAGG + Intronic
1177417928 21:20818358-20818380 ATATGTTTGTTAAACACTTATGG + Intergenic
1177486674 21:21766992-21767014 AAGTCAGTGCCAGACACTTAAGG - Intergenic
1179045426 21:37840246-37840268 AAATCATTGTTAAACCTTTCAGG - Intronic
1179198417 21:39188686-39188708 AAATCAGTTTCATAGACTTAGGG - Intronic
1179373675 21:40829812-40829834 AAAACATTGCCAAGCACTTGTGG - Intronic
1182562914 22:31175495-31175517 ATGTCATTGTCAAGGACTTAGGG + Intronic
1184672272 22:46020703-46020725 CAAACATTTTCAAAAACTTATGG - Intergenic
949149469 3:747872-747894 AAAAGATTATCTAACACTTATGG - Intergenic
951075576 3:18387442-18387464 AAATCATTAGAAAACTCTTAAGG + Intronic
952598295 3:35045616-35045638 AAATTATTATCAAAAATTTAGGG - Intergenic
953105918 3:39878669-39878691 AATTCATTGTCATAGACATAAGG - Intronic
953651138 3:44805965-44805987 AATTCATGCTGAAACACTTAAGG + Exonic
957115225 3:76015147-76015169 AAATAACTGTAAAACAGTTAAGG - Intronic
957551436 3:81710827-81710849 AAAGCATTCTTAAACACTTTTGG - Intronic
960288746 3:115859150-115859172 GCAACATTGTCAAACACTAAGGG - Intronic
962613617 3:137102695-137102717 AAAACATTTTCAGACATTTAAGG - Intergenic
963678537 3:148345532-148345554 AAATTATTTTCAAACAGTTCTGG - Intergenic
964921879 3:161907086-161907108 AGATCATTCTCAAACACGCACGG + Intergenic
965264688 3:166527182-166527204 AAATGATTGGAAAACACTTCTGG - Intergenic
965690959 3:171356614-171356636 CAATCTTTGCCAAACATTTAAGG + Intronic
966120961 3:176519541-176519563 AAATCCTAGTCAAACACTTTTGG - Intergenic
967413364 3:189189857-189189879 GATTCACTGTCAAACACTAATGG + Intronic
970297548 4:14646901-14646923 ACATCATTTTCAAGCACTTTGGG - Intergenic
970310036 4:14772562-14772584 AAAGCATGGTAGAACACTTAGGG + Intergenic
970553870 4:17212183-17212205 ACATCATTGGCACACTCTTATGG - Intergenic
970753832 4:19399138-19399160 AATTTATTGTCATACAGTTATGG - Intergenic
971774501 4:30944973-30944995 AAAACATTGTAAAACACTATCGG - Intronic
971785418 4:31096147-31096169 AAATCATTGGCAATAACTTGGGG - Intronic
972327901 4:38035221-38035243 CAAACATTGACAAACTCTTAGGG - Intronic
972340064 4:38144637-38144659 AAATCACTGTAAAACATTTGAGG + Intergenic
973365915 4:49209509-49209531 AAATCATTGTAAAACATTGCAGG - Intergenic
973394683 4:49582942-49582964 AAATCATTGTAAAACATTGCAGG + Intergenic
973861925 4:55074065-55074087 AAATCCTTAACAAACACTTGTGG + Intergenic
974452724 4:62087874-62087896 AAAGCATTTTCAAACACTTTGGG - Intergenic
974536004 4:63176485-63176507 AATTCTTTGTAAAACACTAAGGG - Intergenic
975922025 4:79402745-79402767 AAATTATCTTCAAACTCTTAAGG - Intergenic
976010882 4:80487220-80487242 AAAGCAATTTCAAAGACTTAAGG - Intronic
977241780 4:94579906-94579928 AAATCAGTGTCAAAAGCTGATGG + Intronic
977300471 4:95261403-95261425 AAGTCATTGTCAAAAATTTGGGG - Intronic
978816299 4:112910274-112910296 AAAACATTGTAAAATGCTTACGG + Intronic
980017958 4:127675476-127675498 AAATCATTCCCAAAAACATAGGG + Intronic
981450112 4:144886992-144887014 AGATCATTATCATACACTTATGG + Intergenic
981546087 4:145894961-145894983 AAATTATTGTCATACACTACAGG + Intronic
982532939 4:156570452-156570474 AACTCAGTTTTAAACACTTAAGG + Intergenic
982793895 4:159623113-159623135 CAATCCTTGTTAAACATTTAGGG + Intergenic
983410548 4:167391436-167391458 AATGCATTGTCAAAAATTTATGG + Intergenic
984185139 4:176534418-176534440 AAACCACTGTCAAACAAGTAAGG - Intergenic
984543668 4:181072934-181072956 AAGTCACAGTCTAACACTTAAGG + Intergenic
984858415 4:184215779-184215801 AGATCTTTGTCAGACACTCACGG + Intronic
988053544 5:26061198-26061220 AAATAATAGTAAAACAATTATGG + Intergenic
988184661 5:27845179-27845201 ATATCTTTCTCAACCACTTAGGG - Intergenic
988422401 5:31022479-31022501 CAATCTTTATCAAAAACTTATGG + Intergenic
989452376 5:41601947-41601969 AAATCATTGTTATACTCTTTAGG + Intergenic
989701659 5:44273428-44273450 AAAACAGTTTCAAACTCTTAAGG - Intergenic
994843605 5:104957047-104957069 AAATCTTTGTCACACAGTTGGGG - Intergenic
994858497 5:105157580-105157602 AAATTTTTGTCAAGCATTTAGGG - Intergenic
995078583 5:108017509-108017531 AAATCAATATAAAACACTTGTGG - Intronic
995210885 5:109537217-109537239 ACATTATTTTCAAACACCTATGG + Intergenic
996117931 5:119639031-119639053 CAATCATTGTAAAATACTTCAGG - Intergenic
996440367 5:123483331-123483353 AAATCATTGTCCTCCACTTCTGG + Intergenic
999458977 5:151741401-151741423 AAATTATTATCAAACAGTTTTGG - Intergenic
999838150 5:155396801-155396823 AAATAATTGTCTAACAGTTGTGG + Intergenic
999967521 5:156825296-156825318 AAATCATTATAAAACAGTTTAGG - Intergenic
1000766773 5:165301428-165301450 AAATAGTTGTCAATAACTTAGGG - Intergenic
1001711696 5:173784089-173784111 AAATCACTCTAAAAAACTTAGGG - Intergenic
1002862311 6:1091054-1091076 AACTAATTGTCACACACTTCAGG - Intergenic
1003324524 6:5082516-5082538 AAATCAATGTAGCACACTTATGG - Intergenic
1005356374 6:24987541-24987563 AAATTATTTTGAAACACATAAGG + Intronic
1008778983 6:55078536-55078558 AAATAATTGACAAAAACTTCTGG + Intergenic
1008887112 6:56443643-56443665 ATATCATAGTCAAACACTTTGGG + Intergenic
1009316999 6:62232363-62232385 AAATCATTCTCAATTACATAAGG - Intronic
1010258025 6:73782521-73782543 AAATGAATGTCAATCACTTGAGG - Intronic
1010418410 6:75642782-75642804 AAATCAGTGGCAATCAGTTAAGG + Intronic
1010726536 6:79341223-79341245 AAATCATTGTGAAAAATTTTTGG + Intergenic
1013309268 6:108878687-108878709 AACACACTGTCAAGCACTTACGG + Intronic
1014325617 6:119988938-119988960 AAATTATTGTCTTACAGTTATGG - Intergenic
1014455559 6:121630207-121630229 GTCTCATTTTCAAACACTTATGG + Intergenic
1014547809 6:122753286-122753308 AAATCAGTGGAGAACACTTAGGG - Intergenic
1014567725 6:122970951-122970973 AAATATTAGTCAAACACTGATGG + Intergenic
1015380903 6:132567564-132567586 AAATACTTGTCAAACACAAATGG + Intergenic
1015635122 6:135267365-135267387 AAAACATTGTCAATCACTAGTGG - Intergenic
1017310638 6:152973025-152973047 ACATCATCTGCAAACACTTACGG + Exonic
1017830726 6:158126581-158126603 AAATCATTTTAAAACCATTATGG + Intronic
1020665487 7:11036344-11036366 AAATCAATGTAAAAATCTTAAGG + Intronic
1022651916 7:32285299-32285321 AAATTATTGTATAACATTTAGGG - Intronic
1022708518 7:32829987-32830009 AACTCAGTGTCAAATATTTAAGG - Intergenic
1022895108 7:34742096-34742118 AAATCCTTGAGAAAAACTTATGG - Intronic
1024124380 7:46277164-46277186 AAATTATATTCAAACACTTTAGG - Intergenic
1025814513 7:64898912-64898934 AAATAATTGTAGAAAACTTATGG - Intronic
1025969820 7:66311930-66311952 AAATTATTGGGATACACTTATGG - Intronic
1028273419 7:88821046-88821068 AAATCATTGTCAGTCAATTCTGG + Intronic
1028551519 7:92072948-92072970 AACTCCTTTTCAACCACTTAAGG - Intronic
1028857489 7:95608101-95608123 AAATCCTTGTCACACTCTTCTGG + Intergenic
1029822377 7:103158455-103158477 ATGTCATTGACCAACACTTATGG + Intergenic
1029845633 7:103409586-103409608 AAATTATTTGCAAGCACTTAAGG - Intronic
1030560809 7:111083376-111083398 AAAATATTGTCAAACATTTTGGG + Intronic
1030930401 7:115516641-115516663 AAATTATTGTCTCACAGTTACGG - Intergenic
1030947997 7:115750758-115750780 TATTCATTGTGAAACACTTCAGG + Intergenic
1031099817 7:117465741-117465763 AAATCATTGTCCAACACCTGTGG - Intergenic
1031347192 7:120683055-120683077 AAATCATTGCCAAAGACAGATGG + Intronic
1031573375 7:123386314-123386336 ATATCATTGGCAAATACTCATGG - Intergenic
1037114933 8:15213673-15213695 AAATAATTTTCACAGACTTAAGG + Intronic
1038772884 8:30500457-30500479 AACTCATTGTCAAGGACTGATGG + Intronic
1038973824 8:32669318-32669340 CAATCTTTGGCAAACATTTAGGG + Intronic
1039641927 8:39232593-39232615 AAATCATACTCATACACTCATGG + Intronic
1039777192 8:40748715-40748737 AATTCATTGACAATTACTTAGGG + Intronic
1040404308 8:47085488-47085510 AAATCATTGTAAAACATTGCAGG - Intergenic
1042459001 8:69040309-69040331 AAAACATTGACATTCACTTAAGG - Intergenic
1043563772 8:81525044-81525066 AACTCAGTCTCAAACTCTTAAGG - Exonic
1045627607 8:104074084-104074106 AAGTCAATGTAAAATACTTAAGG - Intronic
1046151796 8:110236750-110236772 ATATCAGTATCAAACACTCATGG - Intergenic
1049049979 8:140187057-140187079 AAATCTTTTTAAAACACTTACGG - Intronic
1052102593 9:24467725-24467747 AAATCATTATCATAAAATTAAGG - Intergenic
1056540932 9:87570802-87570824 AAACCATTTGCAAACACATAGGG + Intronic
1058585094 9:106499447-106499469 AAGTAATTGTCTAACACTTTGGG + Intergenic
1059053902 9:110958622-110958644 AAAACATTGGGAAACACTTCGGG + Intronic
1060164700 9:121401137-121401159 AAATCATTTGCTAACAATTATGG + Intergenic
1203527652 Un_GL000213v1:104879-104901 AAATCATTGTAAAACATTGCAGG - Intergenic
1187183233 X:16963424-16963446 ACATCATTCTCAAACACAAAGGG - Intronic
1188265871 X:28073597-28073619 AAATAAATGTCAAATGCTTAAGG - Intergenic
1188579495 X:31692864-31692886 AAATCTTTCTCAAACTCTTTTGG + Intronic
1189386010 X:40537457-40537479 AAATCATTTTCAAATAGTCATGG - Intergenic
1189889581 X:45585793-45585815 AAACCATTGTCAAATATATATGG + Intergenic
1189914249 X:45841367-45841389 AAATCAATGGCAAATACTTGAGG + Intergenic
1191831175 X:65418193-65418215 AATTAATTGTAAAACAATTAAGG - Intronic
1192055005 X:67765044-67765066 AAAGCATTCTGAAACACTTAGGG - Intergenic
1193616230 X:83691518-83691540 AAATGGTTTTCAAACACTTAGGG + Intergenic
1193948513 X:87767306-87767328 AAACCACTGTCAAACAATAAAGG - Intergenic
1194197436 X:90912641-90912663 ATATCACAGTCAAACACTGAAGG + Intergenic
1194325630 X:92513044-92513066 GAATGATTGTAAAACATTTAGGG + Intronic
1196258737 X:113553485-113553507 AAATCCTTTTTAAAAACTTAGGG + Intergenic
1196307249 X:114118649-114118671 AAATCAGATTCAAACCCTTAAGG - Intergenic
1199115671 X:143989232-143989254 AAATCATTTTCCCACACTTCTGG + Intergenic
1200544288 Y:4500156-4500178 ATATCACAGTCAAACACTGAAGG - Intergenic
1200634359 Y:5632210-5632232 GAATGATTGTAAAACATTTAGGG + Intronic
1200971322 Y:9155498-9155520 AAGTCATTGTCCAAAACTTATGG + Intergenic
1202139700 Y:21708803-21708825 AAGTCATTGTCCAAAACTTATGG - Intergenic