ID: 1070797817

View in Genome Browser
Species Human (GRCh38)
Location 10:79227263-79227285
Sequence GGGTGTTTAACCTACCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070797817_1070797825 8 Left 1070797817 10:79227263-79227285 CCTTGCTGGTAGGTTAAACACCC 0: 1
1: 0
2: 0
3: 14
4: 49
Right 1070797825 10:79227294-79227316 TTGGGCTCATTCAACACTCAGGG No data
1070797817_1070797826 16 Left 1070797817 10:79227263-79227285 CCTTGCTGGTAGGTTAAACACCC 0: 1
1: 0
2: 0
3: 14
4: 49
Right 1070797826 10:79227302-79227324 ATTCAACACTCAGGGTCCCATGG No data
1070797817_1070797824 7 Left 1070797817 10:79227263-79227285 CCTTGCTGGTAGGTTAAACACCC 0: 1
1: 0
2: 0
3: 14
4: 49
Right 1070797824 10:79227293-79227315 TTTGGGCTCATTCAACACTCAGG No data
1070797817_1070797819 -10 Left 1070797817 10:79227263-79227285 CCTTGCTGGTAGGTTAAACACCC 0: 1
1: 0
2: 0
3: 14
4: 49
Right 1070797819 10:79227276-79227298 TTAAACACCCTCCCATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070797817 Original CRISPR GGGTGTTTAACCTACCAGCA AGG (reversed) Intronic
907862416 1:58366261-58366283 GAGTGTTTGATCCACCAGCATGG + Intronic
908989936 1:70074377-70074399 GGGTGTTTAATCTTCTAGAATGG + Intronic
911580540 1:99628704-99628726 GGGTGTGTGACTTATCAGCAGGG - Intergenic
919281532 1:195495823-195495845 GGGTGTCTGACCACCCAGCAAGG + Intergenic
922449081 1:225722243-225722265 GAGTGTTGAATCCACCAGCACGG + Intergenic
923322201 1:232845686-232845708 GGTTTTTTAAACTACCAGGAAGG - Intergenic
923529194 1:234800175-234800197 GGGTGTTGAATTTGCCAGCACGG + Intergenic
1062874779 10:934125-934147 TGAAGTTTAACCTACCAGCCGGG - Intergenic
1068255569 10:54505355-54505377 GGGTTTTTAACTTAGGAGCATGG - Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1079328251 11:19512523-19512545 GTGGTTTTAGCCTACCAGCAGGG - Intronic
1088553386 11:111037328-111037350 GGATGCCTAACTTACCAGCATGG - Intergenic
1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG + Intergenic
1098371576 12:69766188-69766210 GGGTGTTTACCTTTCTAGCAAGG + Intronic
1103280663 12:119755618-119755640 GGGCTTTTAGCCTAGCAGCAGGG - Intronic
1108517032 13:51213163-51213185 GGATGTTTAACCTAACTCCAAGG + Intergenic
1117879858 14:60302713-60302735 TGGTTTTCAACCTGCCAGCAAGG + Intergenic
1124685716 15:31780059-31780081 GGGTGATTAACCAACAAGGATGG + Intronic
1133039267 16:3051527-3051549 TGGTGTTTCACCAACCAGCTGGG + Intronic
1146842572 17:36166152-36166174 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146854884 17:36254111-36254133 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146865736 17:36334265-36334287 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1146870784 17:36378003-36378025 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147068606 17:37934877-37934899 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG + Intronic
1147080128 17:38014414-38014436 GGGTGTTCAGCCTGCCAGCAGGG - Intronic
1147085189 17:38058165-38058187 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1147096077 17:38138374-38138396 GGGTGTTCAGCCTGCCAGCAGGG - Intergenic
1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1148156776 17:45429230-45429252 GGTTATATAACCTCCCAGCAGGG + Intronic
1148642916 17:49201605-49201627 GGCTGTCTAACCTACTAGGAAGG + Intergenic
1149546410 17:57506970-57506992 ATGTGTTTAACCAAGCAGCAGGG - Intronic
1154346786 18:13549235-13549257 GGGCATTTAAACTGCCAGCAGGG - Intronic
1161836649 19:6652115-6652137 GGGTGTTTCACCCACAAGCCAGG - Intergenic
931605525 2:64048776-64048798 GGTTGATTAACCTACCAGAGAGG + Intergenic
938687598 2:133755554-133755576 GGCTGTTAAACCTTTCAGCAGGG - Intergenic
939000587 2:136729466-136729488 GGGTGTGAAACCTAACATCATGG - Intergenic
946679850 2:222202091-222202113 GGGTCTGGAACCTACCACCACGG - Exonic
948234363 2:236376843-236376865 AGGTTTTTAACCTACTAGCAAGG - Intronic
1172969547 20:38863355-38863377 GGGAGTTAAACCTGTCAGCAGGG - Intronic
1173602262 20:44304295-44304317 GGGTGATTACCCCAACAGCAAGG + Exonic
963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG + Intronic
969721365 4:8894430-8894452 GTTTGTTTAACCTTCCGGCAGGG + Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
973567618 4:52204069-52204091 GGGGGTTTAAACTATAAGCATGG - Intergenic
980534845 4:134104567-134104589 GGGTGTTTAACCAACCAAGTTGG - Intergenic
991000123 5:61774293-61774315 GGGTGTTAAAGGTTCCAGCACGG - Intergenic
995610888 5:113909303-113909325 GGGTGCAGAACCCACCAGCATGG - Intergenic
999865265 5:155694282-155694304 GAGTGTTTGGTCTACCAGCAGGG - Intergenic
1003161961 6:3643843-3643865 TGGTGTATTACCTACCACCAGGG - Intergenic
1006447626 6:34088754-34088776 GGGTGTTTCACCTAGCCACATGG + Intronic
1011666840 6:89642425-89642447 GGGAGTTTAATCTTCCAGTAGGG - Intergenic
1014859795 6:126451665-126451687 GGGTGTTTATCCCACCATCTTGG - Intergenic
1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG + Intronic
1032985004 7:137328132-137328154 GGGTCTTTAATCTGGCAGCATGG - Intronic
1038395641 8:27243696-27243718 GGTTTTTGTACCTACCAGCAAGG + Exonic
1045502340 8:102753167-102753189 GGCTCTTTAACCTCTCAGCAAGG - Intergenic
1050877525 9:10657643-10657665 GGGTATTTTACCTTCCAGCTTGG - Intergenic
1053267198 9:36724020-36724042 GGGTGTGTAAGCTGCCTGCATGG + Intergenic
1055904513 9:81277240-81277262 AGGTGTTCAAGCTACCAACAGGG + Intergenic
1056778006 9:89527912-89527934 GGGTGATTCACCTCCCAGCAGGG - Intergenic
1059708962 9:116849720-116849742 GCCTGTTAAACCTAGCAGCATGG - Intronic
1191060389 X:56289451-56289473 GGGTGTCTCAGCTAACAGCAAGG + Intergenic