ID: 1070797819

View in Genome Browser
Species Human (GRCh38)
Location 10:79227276-79227298
Sequence TTAAACACCCTCCCATCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070797817_1070797819 -10 Left 1070797817 10:79227263-79227285 CCTTGCTGGTAGGTTAAACACCC 0: 1
1: 0
2: 0
3: 14
4: 49
Right 1070797819 10:79227276-79227298 TTAAACACCCTCCCATCTTTGGG No data
1070797814_1070797819 15 Left 1070797814 10:79227238-79227260 CCTTAAGTGTTTGACAATGATTT 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1070797819 10:79227276-79227298 TTAAACACCCTCCCATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070797819 Original CRISPR TTAAACACCCTCCCATCTTT GGG Intronic
No off target data available for this crispr