ID: 1070798073

View in Genome Browser
Species Human (GRCh38)
Location 10:79228703-79228725
Sequence CTCAGGGAACACTGAAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070798073_1070798081 4 Left 1070798073 10:79228703-79228725 CCACCATTTCAGTGTTCCCTGAG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1070798081 10:79228730-79228752 GGCCAGCTAGCTTCTGGTATGGG No data
1070798073_1070798082 5 Left 1070798073 10:79228703-79228725 CCACCATTTCAGTGTTCCCTGAG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1070798082 10:79228731-79228753 GCCAGCTAGCTTCTGGTATGGGG No data
1070798073_1070798080 3 Left 1070798073 10:79228703-79228725 CCACCATTTCAGTGTTCCCTGAG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1070798080 10:79228729-79228751 GGGCCAGCTAGCTTCTGGTATGG No data
1070798073_1070798084 16 Left 1070798073 10:79228703-79228725 CCACCATTTCAGTGTTCCCTGAG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1070798084 10:79228742-79228764 TCTGGTATGGGGCTAGTCTCAGG No data
1070798073_1070798079 -2 Left 1070798073 10:79228703-79228725 CCACCATTTCAGTGTTCCCTGAG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1070798079 10:79228724-79228746 AGTCAGGGCCAGCTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070798073 Original CRISPR CTCAGGGAACACTGAAATGG TGG (reversed) Intronic
900724350 1:4205689-4205711 TTCTGTGAACACTGAAAAGGAGG - Intergenic
901908140 1:12432477-12432499 CTCAGTGGACACTGAAAATGTGG + Intronic
902766558 1:18620210-18620232 CTAAAGGAAAACTCAAATGGAGG - Intergenic
903306807 1:22418596-22418618 CTCAGGGAACACTGAGAGTTTGG - Intergenic
904968854 1:34403085-34403107 CTCTGGGCACACTGACATGGGGG + Intergenic
905825076 1:41020982-41021004 CCCTGGGGCCACTGAAATGGTGG - Exonic
907431617 1:54415387-54415409 CTCTGGGCACACAGACATGGAGG + Intergenic
907523294 1:55039245-55039267 CCCAGGAAACACTGAAAAGGTGG + Intergenic
911154245 1:94623425-94623447 CTCAGAGAACACTTAGATGGGGG - Intergenic
911587748 1:99710476-99710498 CTGAGGAAACCCTGAGATGGAGG - Intronic
912696157 1:111843613-111843635 ATCAGAGAACCCTGAAATGCAGG - Intronic
913511058 1:119562920-119562942 CACAAGGAACACTGCACTGGGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
914806103 1:150993131-150993153 CTCAGGAAACTCTGAAAATGAGG + Intronic
916233700 1:162564215-162564237 CTCAGGGAACACACAGATGTAGG + Intronic
919422186 1:197383705-197383727 CTCAGGAAACACTGGCATGGAGG - Intronic
919730449 1:200910515-200910537 GTCAGGCAGCACTGAACTGGGGG + Intronic
919771134 1:201159351-201159373 CTCAGGCATCAGGGAAATGGGGG + Intronic
920202176 1:204266344-204266366 CTCAGGACACACCAAAATGGGGG - Intronic
921284382 1:213595873-213595895 TTCAGGGATCACTAAAATGTGGG - Intergenic
921660354 1:217793813-217793835 TTCAGTGAAAACTGAAAAGGAGG + Intronic
922169912 1:223145260-223145282 TACAGGGAACACTAAAATGTGGG - Intergenic
922616540 1:226964427-226964449 CTCAGGGTACAGGGAAATGGAGG - Intronic
923679895 1:236110908-236110930 GTAAGGGAACACGGAAGTGGTGG - Intergenic
924378715 1:243440402-243440424 CTCAGGAAACACTGAATTTCAGG + Intronic
1064770844 10:18721268-18721290 CTCAAGGCTCACTGGAATGGAGG - Intergenic
1065676266 10:28177814-28177836 CCCAGGGAACACTGTCATGCTGG + Intronic
1066218728 10:33314655-33314677 CTTAGGAAACACTGGTATGGAGG + Intronic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1069536422 10:69257031-69257053 TTCAGGGAACACTCATAGGGTGG + Exonic
1070798073 10:79228703-79228725 CTCAGGGAACACTGAAATGGTGG - Intronic
1070935797 10:80294092-80294114 ATCTGTGAACACAGAAATGGAGG - Intergenic
1071093862 10:81950667-81950689 CTCAGATAACACAGAAATGCTGG - Intronic
1071744795 10:88404888-88404910 CCCAGGGAATGCTGAAGTGGAGG + Intronic
1072917599 10:99548781-99548803 CTGAAGGAACACTGAGATGGTGG - Intergenic
1076365638 10:129919795-129919817 CTCAGGGAGCAGAGACATGGGGG - Intronic
1076844143 10:133060761-133060783 CTCTGGGCACACTGACAGGGTGG + Intergenic
1077402491 11:2366148-2366170 CCCAGGGACCATTTAAATGGGGG - Intergenic
1077555838 11:3225637-3225659 CTCAAGGACCACAGAACTGGAGG + Intergenic
1078729005 11:13959143-13959165 CTGAGGCAATACTGAAGTGGAGG + Intergenic
1079419107 11:20269489-20269511 CACAGGCAGCACTGAATTGGTGG - Intergenic
1080467135 11:32508211-32508233 CACATGGAAAACTAAAATGGTGG + Intergenic
1081255900 11:40894594-40894616 CTTAGGAAATACTGAAATGCTGG - Intronic
1082789650 11:57338516-57338538 CTCAGGGGACACTCAGAAGGGGG - Exonic
1085699194 11:78731121-78731143 CTCAGGGAGCACTGTAAAGAGGG + Intronic
1085772054 11:79334448-79334470 CTCAGGGAATAGAGAAATGGTGG - Intronic
1086602092 11:88645798-88645820 TTCAGGTAACAATGAAAAGGAGG + Intronic
1087130875 11:94668473-94668495 CACAGGTAACACTGACATGTTGG - Intergenic
1090099300 11:123777123-123777145 CTCAGGGTACAAGGAGATGGTGG - Intergenic
1092909054 12:13129201-13129223 CTCAGAAAAGAGTGAAATGGAGG - Intronic
1093702943 12:22243441-22243463 CTCATGGCACAGTAAAATGGAGG - Intronic
1093822946 12:23644026-23644048 CCCAGGACACACTGAAAGGGAGG - Intronic
1094284017 12:28772316-28772338 TTCAGGTCACACAGAAATGGTGG + Intergenic
1096420028 12:51449135-51449157 CTCAGGAAAAACTGAAGTGAGGG + Intronic
1097092743 12:56520227-56520249 CTCAGGGGACACAGGAAGGGTGG - Intergenic
1098138081 12:67423800-67423822 CTAAGGGCAGACTGAGATGGTGG - Intergenic
1098187013 12:67907758-67907780 GTAAGGGAACACTGCAGTGGGGG - Intergenic
1098445466 12:70561852-70561874 CTCAGAGAACTCTGCAATAGCGG - Intronic
1099324712 12:81200065-81200087 CCCAGGGAACACTTAGAGGGAGG - Intronic
1103164508 12:118758496-118758518 CTTAGGCATCACTGAGATGGTGG + Intergenic
1103879924 12:124158271-124158293 CCCAGGGAGGACTGGAATGGCGG + Intronic
1104717429 12:131025458-131025480 GTCAGGGAACCGTGACATGGAGG + Intronic
1106219477 13:27733818-27733840 CTCAGGGCCCACCAAAATGGAGG - Intergenic
1108593123 13:51928045-51928067 CCCAGGGCACACTGAGGTGGAGG + Intergenic
1108836068 13:54550437-54550459 CTCATGGAAGCCAGAAATGGAGG + Intergenic
1113134921 13:107078799-107078821 TTTAGGGAACACTAAAAAGGGGG - Intergenic
1114397948 14:22383946-22383968 CTCAGGGGACCCTGAGATGTTGG - Intergenic
1114416338 14:22547221-22547243 CTCAAGGAAACCTGAAATGCAGG - Intergenic
1115548951 14:34488074-34488096 ATCGGGGAACACTGAAATGAAGG - Intergenic
1116364361 14:44041081-44041103 CTAAGGCAATGCTGAAATGGGGG + Intergenic
1117053868 14:51890278-51890300 CTCAGGAAACACTGATTTGTTGG - Intronic
1118850050 14:69576233-69576255 CTCTGGCAACAGTGAAGTGGAGG + Intergenic
1119129107 14:72155337-72155359 CTCAGGGTACTCAGGAATGGTGG - Intronic
1119346723 14:73931177-73931199 TACAGGGAAAACAGAAATGGTGG - Intronic
1119417188 14:74479854-74479876 CTCTGGGACCACGGAACTGGGGG + Intronic
1120544388 14:85792620-85792642 CTCAGGGAGGACTGAATAGGTGG + Intergenic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1122546198 14:102524194-102524216 CTCAGGGAGCCCTGAAAGTGAGG - Intergenic
1123206200 14:106715567-106715589 CACTGGTAACACTGAAAAGGTGG + Intergenic
1123211283 14:106762977-106762999 CACTGGTAACACTGAAAAGGTGG + Intergenic
1124263554 15:28213924-28213946 CTCCGAGAACCCTGAAGTGGGGG - Exonic
1124314452 15:28655822-28655844 CTCCGAGAACCCTGAAGTGGGGG + Intergenic
1124559617 15:30759468-30759490 CTCAGGGAGCCCTGGAGTGGTGG - Intronic
1124671634 15:31646238-31646260 CTCAGGGAGCCCTGGAGTGGTGG + Intronic
1127068772 15:55267739-55267761 CTGAGGAAAAACAGAAATGGAGG + Intronic
1127205544 15:56713551-56713573 CTAATGGCATACTGAAATGGAGG + Intronic
1128131280 15:65228649-65228671 CTGAGGGCACACTGAAAGGAGGG + Intergenic
1128914377 15:71546532-71546554 GTCAGAGTACACTGAAATGCAGG - Intronic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1130081434 15:80737493-80737515 CTCAGGGATCAGTGAGTTGGGGG - Intronic
1131092114 15:89631134-89631156 CTCAGGGAACACAGATGTGTGGG + Intronic
1132289215 15:100687778-100687800 CTCAGGGTGGACTGAAATGGGGG + Intergenic
1135750769 16:25057135-25057157 AGCAGGGAACAAGGAAATGGGGG + Intergenic
1136701911 16:32152296-32152318 CTCCGAGAACCCTGAAGTGGGGG - Intergenic
1136765754 16:32775164-32775186 CTCCGAGAACCCTGAAGTGGGGG + Intergenic
1136802344 16:33095214-33095236 CTCCGAGAACCCTGAAGTGGGGG - Intergenic
1139401488 16:66685384-66685406 CTCAGGGAAGACTGCTGTGGGGG + Intronic
1140555441 16:75916053-75916075 CACAGGGAACACTGAGATGAGGG + Intergenic
1141829636 16:86502702-86502724 CTCAGGGAACCCTGGATTGTGGG + Intergenic
1142272106 16:89095256-89095278 CTCAAGGCAGACAGAAATGGCGG + Intronic
1203068143 16_KI270728v1_random:1037412-1037434 CTCCGAGAACCCTGAAGTGGGGG + Intergenic
1143405266 17:6673289-6673311 CTAAGGGAAAAATGAAATTGTGG - Intergenic
1145777748 17:27541037-27541059 TTCAGGGACCACTGGAATGAAGG + Intronic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1150656441 17:67042764-67042786 CACAGGGAACACAGAGGTGGGGG + Intergenic
1156395712 18:36698083-36698105 TTCATGAAACACTGAACTGGAGG - Intronic
1156777598 18:40811624-40811646 AACAGAGAACACTGACATGGAGG - Intergenic
1156979697 18:43270551-43270573 CTCATTGAACACTGCATTGGGGG + Exonic
1157558674 18:48631035-48631057 TTTAGGCACCACTGAAATGGGGG + Intronic
1160905915 19:1451692-1451714 CTCTGGGAACAGCCAAATGGTGG + Exonic
1166101254 19:40572628-40572650 CTCAGGTGAGACTGGAATGGAGG + Intronic
1168309811 19:55454778-55454800 CACAGAGAACAATAAAATGGGGG - Intronic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
926631462 2:15140259-15140281 TTCTGGGAAAACTGAAAGGGTGG - Intergenic
927213080 2:20650667-20650689 CTCAGGGAGCTCTGAAAGGATGG + Intronic
927625447 2:24712398-24712420 CTCAGGGGACATTGAATGGGCGG + Intronic
928138772 2:28709517-28709539 CACAGGGAACAAAGAGATGGAGG + Intergenic
929086434 2:38172179-38172201 TTCAGGAAACACTGAGCTGGAGG - Intergenic
929442252 2:41973397-41973419 CTCAGGCAGGTCTGAAATGGAGG - Intergenic
929845638 2:45522619-45522641 CTCAGGGATGGCAGAAATGGAGG - Intronic
930144068 2:47983113-47983135 CTCTGGAAATACTGAAATGGTGG + Intergenic
932999368 2:76902731-76902753 CTCAGTGAAAAATAAAATGGTGG - Intronic
933211515 2:79575336-79575358 CACAGGGAACCAGGAAATGGTGG - Intronic
933784489 2:85827909-85827931 CGCAGGCAACACTGAAAAGCAGG - Intergenic
934072576 2:88398164-88398186 TTCAGGGGACAGAGAAATGGAGG - Intergenic
935735068 2:106100037-106100059 TTCAGGGAACTCTAAAATGTTGG - Intronic
938138821 2:128780450-128780472 CTCTGGGCACACGGAGATGGGGG + Intergenic
938762119 2:134435411-134435433 ATAAGGCATCACTGAAATGGTGG - Intronic
940067861 2:149649880-149649902 CTAAAGGAACACAGAATTGGAGG + Intergenic
941628627 2:167859316-167859338 CTCAGGGAAAAATGAAAATGAGG - Intergenic
942639674 2:178048434-178048456 CTCATGGAAAACAGAAAAGGGGG - Intronic
942670184 2:178366769-178366791 CTCAGGGAACTATGAAATTAAGG - Intronic
943162732 2:184276353-184276375 CTCAGGGAACACTTGACTGCAGG + Intergenic
944368269 2:198950100-198950122 CTCAGAGTTCACTGACATGGTGG + Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
1169142182 20:3232946-3232968 CTCAGGGATCTCAGACATGGCGG - Intronic
1170162934 20:13333908-13333930 CTCAGGGAGCACTCACAGGGAGG + Intergenic
1171107134 20:22445330-22445352 CCCTGAGAACTCTGAAATGGAGG + Intergenic
1172989814 20:39026425-39026447 CTAAGGGAACAGTGTAATGAAGG + Intronic
1178016469 21:28351899-28351921 ATCAGGGAACACTGCTATGGAGG + Intergenic
1182025077 22:27111463-27111485 CACAGGCAGCACTGTAATGGAGG + Intergenic
1182289894 22:29268774-29268796 CTCAGGAAACCCTGAAAACGGGG - Intronic
1183976902 22:41517566-41517588 GTAAGGGAACACGGAAGTGGTGG - Exonic
951144421 3:19209981-19210003 CAAAGGGAACTCTGAAATGCAGG - Intronic
952139036 3:30458039-30458061 CTCAGGGAAGAGTGCAAAGGGGG - Intergenic
954690292 3:52392085-52392107 CACACTGACCACTGAAATGGAGG - Intronic
955101612 3:55855105-55855127 CTAAGGAAACACTCAAAAGGAGG + Intronic
957228828 3:77485016-77485038 CTCAGGGAAGACTGTAGTGAAGG - Intronic
960576063 3:119230771-119230793 CACAGGGCACATTGCAATGGGGG + Intronic
960581492 3:119282872-119282894 CTCATGGAGCAGTGAAAAGGGGG + Intergenic
962041598 3:131713037-131713059 CCCAGGGCACACTGATAGGGTGG + Intronic
963560596 3:146860125-146860147 CTCAGAGAACCTTGAGATGGTGG + Intergenic
964742871 3:159985984-159986006 CTAAGGGAATAATGAAAAGGGGG - Intergenic
965273264 3:166646666-166646688 CTCAGGGAAATCTGAAATCGGGG + Intergenic
968107808 3:196014649-196014671 CTGAGGAAACCCTGAAATGTTGG + Intergenic
968747402 4:2367419-2367441 CTCAAGAAACTCTGAAAGGGTGG + Intronic
970023964 4:11601240-11601262 CTCAGGGTGCAGTGAAAGGGAGG + Intergenic
973740043 4:53910900-53910922 CTAAGGGAAGGCTGAAATGCTGG + Intronic
974019225 4:56678186-56678208 CTCAGGGAACACAGCAACAGAGG - Intronic
974952526 4:68600335-68600357 ATGAGGGAAAACTGAATTGGTGG + Intronic
975909077 4:79247361-79247383 TACAGGGAAAACTGAAATGCAGG - Intronic
977111751 4:92965148-92965170 CTCAGGGAATACTGGGAGGGGGG + Intronic
977448869 4:97168342-97168364 TTCAGTTGACACTGAAATGGAGG - Intergenic
978762499 4:112369382-112369404 CTCAGAGAAGAGTGAAATGGTGG + Intronic
979587020 4:122432480-122432502 CTCAAGGAACACTCAAATATTGG + Intergenic
982485876 4:155965271-155965293 TTCAGGGAATATTGAAATGTGGG - Intergenic
983205013 4:164902615-164902637 GGATGGGAACACTGAAATGGAGG - Intergenic
983935369 4:173499288-173499310 CTCAGGGAACACGGATAGGATGG - Intergenic
984368331 4:178827999-178828021 CTCTGGGAACCCTGAAAATGTGG - Intergenic
984492292 4:180450388-180450410 CTATGGAAACACTGATATGGGGG + Intergenic
984825602 4:183921510-183921532 CTCCTGGACCACTGAAATGCTGG - Intronic
987651527 5:20747159-20747181 CTCAAGAAACACTGAAAAAGAGG - Intergenic
988508406 5:31844102-31844124 TTCAGGAAACACTGAATTGAGGG - Intronic
988744034 5:34114310-34114332 CTCAAGAAACACTGAAAAAGAGG + Intronic
991468978 5:66947303-66947325 GTCAAGGAACACTGAAATAAAGG + Intronic
992541144 5:77765431-77765453 CTCTGGGAACACAGAAAAGGGGG + Intronic
992621442 5:78597266-78597288 CACAGGGAGCTCTAAAATGGGGG + Intronic
994657906 5:102616870-102616892 TTCAGGGGACACTGAAATACTGG - Intergenic
995453803 5:112331464-112331486 CCCAGGGAACACTCAGTTGGGGG - Intronic
995966066 5:117909624-117909646 CTCAGGGAACACTGAAAGCCAGG + Intergenic
996223516 5:120961360-120961382 CTCAGGGCTCACAGAAATGAGGG + Intergenic
996416842 5:123219970-123219992 CTTTGGGAACACTGAAATGCGGG + Intergenic
997828430 5:137128424-137128446 CTCAGGGAACAATCAGATGGGGG - Intronic
998519722 5:142788840-142788862 CACAGAAAACACTTAAATGGTGG - Intronic
1000613004 5:163395944-163395966 AAAAGGGAACACTGAAATGTTGG + Intergenic
1001043626 5:168354711-168354733 CCCTGGGAAGACTGAAATGATGG - Intronic
1001355615 5:171020011-171020033 CTCAGTAAACAGTGAAATGAAGG - Intronic
1001630610 5:173172511-173172533 CTCTGTGGAAACTGAAATGGAGG - Intergenic
1003497718 6:6678806-6678828 ATCAGGGAGCCCTGGAATGGTGG - Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1006171879 6:32097828-32097850 CTCAAGGAACAGTGCACTGGGGG - Intronic
1007915077 6:45553655-45553677 CTCAGGGTCCACAGCAATGGTGG - Intronic
1009626757 6:66145397-66145419 CTCAGGGAACCCAAAAATTGGGG - Intergenic
1012477958 6:99635650-99635672 TTCAGGGAACACTGTATTGAAGG + Intergenic
1015536400 6:134271480-134271502 CTCAGGGAAAATAGAAATGCTGG + Intronic
1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG + Intronic
1017126549 6:151069814-151069836 ATCCGAGAACTCTGAAATGGTGG - Intronic
1019348184 7:540705-540727 CACAGGGAACACTCAGATGTTGG - Intergenic
1020329422 7:7002592-7002614 CTCAGGGAACACAGGTTTGGGGG + Intergenic
1021450872 7:20783592-20783614 CTCAGGGAACAAAGAAAAAGAGG + Intronic
1022211457 7:28214172-28214194 TTCAGGGATCACTGAGGTGGGGG + Intergenic
1022267728 7:28773802-28773824 CTTAGGGAACACTTAAATTCAGG + Intronic
1024895874 7:54261344-54261366 CTCAGGAAACACAGTCATGGTGG + Intergenic
1024932264 7:54676025-54676047 CTCAGGGAACACAGGGTTGGGGG + Intergenic
1025022855 7:55493565-55493587 CTCAGGAAAGACTGAAACTGTGG + Intronic
1031111292 7:117612699-117612721 CTCATGGAACACCGAGAAGGTGG + Intronic
1031478488 7:122250720-122250742 CTCAGGGAGCACTAAAGTGTTGG + Intergenic
1032800898 7:135316613-135316635 CTCAGGGAAGCCAGAAATGTAGG + Intergenic
1037840089 8:22238603-22238625 TTCAGGGAGCACTGGACTGGAGG + Intergenic
1038151274 8:24943605-24943627 CTCAGGGAAGATAGAAATAGGGG + Intergenic
1038242228 8:25820536-25820558 CTGAGAGGACATTGAAATGGAGG + Intergenic
1039086967 8:33789610-33789632 CTCAGGGAGCACTGGAATGTGGG + Intergenic
1040869091 8:52081481-52081503 TTCAGGGAACACAGGAATTGCGG + Intergenic
1041049017 8:53915191-53915213 GTGAGGGGAAACTGAAATGGAGG - Intronic
1042049845 8:64691649-64691671 CTCAGGCTACACTAAAGTGGAGG - Intronic
1042593771 8:70423885-70423907 CTGAGGGAAGACTGGATTGGCGG - Intergenic
1044743381 8:95349981-95350003 TTCTGGGAAAACTGAAATGTTGG + Intergenic
1045013122 8:97975849-97975871 CACTGGGAACACTGAGATCGAGG - Intronic
1046611378 8:116429417-116429439 CTCAGGAAACACAGTCATGGTGG + Intergenic
1048238392 8:132715900-132715922 TTAAGGGAAGACAGAAATGGTGG + Intronic
1052157740 9:25215583-25215605 CCCAGGGGACAATGAGATGGAGG - Intergenic
1053289322 9:36869607-36869629 CTCTGGGAACACAGAGAAGGGGG - Intronic
1055933034 9:81579478-81579500 CTCAGGGAAGCCTGAAATTGTGG + Intergenic
1056766565 9:89447788-89447810 TCCAGGGAGCACTGAAGTGGTGG - Intronic
1057143794 9:92745254-92745276 CGCAGGGCACACTGGGATGGGGG + Intronic
1058750861 9:108037222-108037244 CTCAGGGAACAGTAACAAGGGGG + Intergenic
1058922923 9:109634797-109634819 ATCAGGGAACACTGAGATCCTGG + Intergenic
1059394464 9:114025570-114025592 CACAGGGAACACTGTCATGCTGG - Intronic
1062294247 9:135815548-135815570 CTCAGGGCACAGTGAACTGGAGG - Intronic
1185786916 X:2898559-2898581 TACAGGGACCACTGCAATGGCGG - Intergenic
1186249919 X:7654752-7654774 CTCAGGGGGGACTGAAATTGGGG + Intergenic
1186424507 X:9453386-9453408 CTCCATGAACACTGAAAAGGAGG - Intergenic
1188371589 X:29376306-29376328 CTGGGTGAACACTGAAATGAAGG - Intronic
1189196854 X:39160652-39160674 ATCAGGGCACACTTGAATGGGGG - Intergenic
1192194300 X:69018371-69018393 CTCAGGGAACTCTGAGTTTGGGG + Intergenic
1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG + Intergenic
1193698713 X:84739269-84739291 GTCAGGCATCCCTGAAATGGAGG - Intergenic
1193789394 X:85800183-85800205 CTCAGGTAGCACAGAAATGAGGG + Intergenic
1194277270 X:91900640-91900662 CTCATAAAACACTGAAATGATGG + Intronic
1196201792 X:112894775-112894797 CTCAACCAAAACTGAAATGGTGG + Intergenic
1197249194 X:124197124-124197146 CACAGGGAAGACAGAAATAGAGG - Intronic
1198336922 X:135675402-135675424 ATCAGAGAACCCTGAAATTGAGG + Intergenic
1200594613 Y:5122738-5122760 CTCATAAAACACTGAAATGATGG + Intronic
1201056701 Y:10000836-10000858 CTCAGAGAACCCTGAGATAGTGG + Intergenic
1201287484 Y:12391645-12391667 TACAGGGACCACTGCAATGGCGG + Intergenic
1201985892 Y:19964828-19964850 CTCGGGGAACAGTGGGATGGGGG - Intergenic