ID: 1070799840

View in Genome Browser
Species Human (GRCh38)
Location 10:79238925-79238947
Sequence TAGGGGCCCAAGCAGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070799840_1070799856 27 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799856 10:79238975-79238997 GAGGGGTTCTGAGGTCTGGTGGG No data
1070799840_1070799854 23 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799854 10:79238971-79238993 ACAGGAGGGGTTCTGAGGTCTGG No data
1070799840_1070799846 5 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799846 10:79238953-79238975 GTGACCCCGTGTGTGGACACAGG No data
1070799840_1070799857 28 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799857 10:79238976-79238998 AGGGGTTCTGAGGTCTGGTGGGG No data
1070799840_1070799853 18 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799853 10:79238966-79238988 TGGACACAGGAGGGGTTCTGAGG No data
1070799840_1070799845 -2 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799845 10:79238946-79238968 TAGCTCTGTGACCCCGTGTGTGG No data
1070799840_1070799847 8 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799847 10:79238956-79238978 ACCCCGTGTGTGGACACAGGAGG No data
1070799840_1070799851 10 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799851 10:79238958-79238980 CCCGTGTGTGGACACAGGAGGGG No data
1070799840_1070799855 26 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799855 10:79238974-79238996 GGAGGGGTTCTGAGGTCTGGTGG No data
1070799840_1070799849 9 Left 1070799840 10:79238925-79238947 CCAGGATCCTGCTTGGGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1070799849 10:79238957-79238979 CCCCGTGTGTGGACACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070799840 Original CRISPR TAGGGGCCCAAGCAGGATCC TGG (reversed) Intronic
900592362 1:3465719-3465741 TGGGGGCCCCAGCAGGAGGCCGG - Intronic
900697848 1:4023288-4023310 CAGGGGCCCACACAGGAGCCTGG - Intergenic
902100462 1:13983522-13983544 GAGAGGCCCGAGCAGGAACCAGG - Intergenic
903818572 1:26083303-26083325 AAGGTGCCCAAGCAGGATGTTGG - Intergenic
904372494 1:30058750-30058772 GAGGGGCCTGAGCAGGATCCAGG + Intergenic
905972985 1:42155043-42155065 AAGGGGACGAAGCAGGTTCCAGG - Intronic
907296543 1:53459667-53459689 CAGGGGCCCAAGCAGGCCTCCGG + Exonic
907517432 1:55001471-55001493 AATGAGACCAAGCAGGATCCAGG - Intronic
916610461 1:166386557-166386579 TAGAGGCCCTAGCAGCTTCCTGG - Intergenic
921302147 1:213761688-213761710 TAGGTGCCCAGCCAGGTTCCTGG + Intergenic
923771475 1:236941663-236941685 TAGGGACCCACGCTGGATGCTGG + Intergenic
1064998764 10:21318648-21318670 TCTGGGCCCAAGCATGTTCCGGG + Intergenic
1067035356 10:42911598-42911620 GAGGGGCCCAGGCAGGAGGCTGG + Intergenic
1067459718 10:46448828-46448850 TTGGGGCCCAGGAAGGATACGGG + Intergenic
1067627469 10:47935785-47935807 TTGGGGCCCAGGAAGGATACGGG - Intergenic
1067977331 10:51041289-51041311 TAGAGCACCAAGCAGGCTCCTGG - Intronic
1070286628 10:75088099-75088121 TAGGGGCCCAAGGGGGATATTGG - Intergenic
1070799840 10:79238925-79238947 TAGGGGCCCAAGCAGGATCCTGG - Intronic
1070973349 10:80585878-80585900 GAGAGGCACAAGCAGGAACCGGG + Intronic
1071560974 10:86646683-86646705 TGGGGGCCCAAGCTGGATTCAGG - Intergenic
1073123659 10:101136552-101136574 TAGGGGCCCAAACTGGATTTGGG + Intronic
1075008194 10:118845531-118845553 CAGGGGACCAAGCAGGCTGCCGG + Intergenic
1077262369 11:1629687-1629709 CAGTGGCACAAGCAGGAACCAGG + Intergenic
1078266382 11:9758697-9758719 CAGGGGCCCGAGGAGGAGCCGGG - Intergenic
1078468281 11:11566968-11566990 AAGAGGCCTAAGCAGGATCCAGG - Intronic
1079111418 11:17607286-17607308 TAGGCTCCGAAGCAGGCTCCAGG - Intronic
1079336831 11:19577478-19577500 TAGGGGGCCCAGGAGGAGCCGGG - Intronic
1081329750 11:41788586-41788608 GAGAGGCGCAAGCAGGAACCCGG - Intergenic
1084272695 11:68037704-68037726 GTGGGGCCCAAGCGGGAGCCTGG - Intergenic
1084456665 11:69271653-69271675 TGGTGGCCCAGGCAGGACCCTGG - Intergenic
1086601776 11:88642049-88642071 TGGGTGCCCAAGCAGAAGCCTGG - Intronic
1088537539 11:110877326-110877348 AACGGGCCCAACCAAGATCCAGG - Intergenic
1091563228 12:1630063-1630085 CAGTGGCCCGAGCAGGGTCCAGG - Intronic
1092257558 12:6935885-6935907 GAGGGGCCCCAGGAGGAGCCTGG - Exonic
1093434285 12:19118081-19118103 TAGGGACCCAGGCTGTATCCAGG + Intergenic
1098588390 12:72182858-72182880 TATGGGCCAAAGCAGGAGTCTGG + Intronic
1099190237 12:79554364-79554386 GAGAGGCCCAGGCAGGAACCGGG - Intergenic
1104286717 12:127430879-127430901 TAGGAGCCCAAACAGAAGCCAGG - Intergenic
1106340770 13:28824483-28824505 TGGGGGCTCAAGCAGGGTCAAGG - Intronic
1112394281 13:99014212-99014234 TACTGGCCCAAGCAGGTCCCGGG + Intronic
1112783511 13:102927478-102927500 CAGAGCCCCAAGCAGGATGCTGG - Intergenic
1121441082 14:93949823-93949845 AAGGGGCACAGGCAGGGTCCTGG - Intronic
1122577828 14:102752828-102752850 TGGGGGCCCAGGGAGGACCCAGG - Intergenic
1123099048 14:105783335-105783357 TAGGGGCCTAGGCAAGCTCCAGG + Intergenic
1124345418 15:28918658-28918680 GCGGGGCCTATGCAGGATCCCGG + Intronic
1126572174 15:50164097-50164119 TAGAGCGCCAAGCAGGCTCCTGG - Intronic
1130570274 15:85036550-85036572 TATGGGCAGATGCAGGATCCAGG + Intronic
1132572379 16:649666-649688 TCGGGGACCAGGCAGGAGCCGGG - Intronic
1133177544 16:4026675-4026697 TAGAGACCCATGCAGCATCCAGG + Intronic
1135089304 16:19500174-19500196 TAGAAGCCCAAGCAGCAGCCGGG - Intergenic
1136010506 16:27360488-27360510 TATGGGCCCAAGCAAGTCCCAGG + Intronic
1140898834 16:79349758-79349780 TAGCAGCCCAAGGAGGATCTTGG - Intergenic
1143631065 17:8140645-8140667 CTGAGGCCCAAGCAGGACCCGGG - Exonic
1146170879 17:30632219-30632241 CATGGGCCCAAGGAGCATCCAGG + Intergenic
1146344330 17:32048223-32048245 CATGGGCCCAAGGAGCATCCAGG + Intronic
1146692680 17:34887549-34887571 TTGGTGCCCAAGCAGCACCCTGG - Intergenic
1146779802 17:35659366-35659388 TAGTGGGTCAAGCAGGGTCCTGG - Intronic
1147193239 17:38748949-38748971 CAGGCGCCCAGGCTGGATCCTGG - Intronic
1147373585 17:40010934-40010956 GAGAGGCTCAAGCAGGAACCGGG + Intergenic
1147431782 17:40375827-40375849 GAGAGGCGCAAGCAGGAACCGGG + Intergenic
1147997492 17:44368824-44368846 GAGAGGCCCAAGCGGGAACCCGG + Intergenic
1148784216 17:50137590-50137612 TAGGGGCCCAGACAGTGTCCTGG - Intronic
1150550370 17:66204278-66204300 TAGAGCACAAAGCAGGATCCTGG + Intergenic
1151757909 17:76085274-76085296 CAGGGGCCCATGCAGGAGCAGGG + Intronic
1153922853 18:9806552-9806574 GAGGGGCCCAAGAAGGGACCAGG + Intronic
1154177154 18:12093149-12093171 TGAGGGCCAAAGCAGGATCAGGG + Intergenic
1154435871 18:14341183-14341205 AAGGGGACCACGCAGGATACAGG - Intergenic
1156897237 18:42259667-42259689 TAGGGGCCCTACCAGCATCAAGG + Intergenic
1161585153 19:5101867-5101889 TAGGAGCCCAGGCAGGAGGCTGG - Intronic
1162780445 19:13004127-13004149 TAGGGGACTGAGCAGCATCCTGG - Intronic
1168502710 19:56906855-56906877 GAGGGGTCTAAGCAGGATCCTGG + Intergenic
925160709 2:1681542-1681564 TAGGGGCCGACGCTGGCTCCAGG + Intronic
927050649 2:19324889-19324911 TAGAGTCCCCATCAGGATCCAGG - Intergenic
929355155 2:41014810-41014832 TAGGAACCCAAGGAGGATGCAGG + Intergenic
930107897 2:47654464-47654486 TAGGGGGCCAAGCTGTGTCCTGG + Intergenic
932001431 2:67888796-67888818 TGGGGGCCCCATCAGGAGCCTGG + Intergenic
935354720 2:102187647-102187669 TGGGCGCCCGACCAGGATCCAGG - Intronic
935812957 2:106817749-106817771 TAGAGCACCAAGCAGGCTCCTGG + Intronic
938369071 2:130757355-130757377 TAGGAGCCCAAGCAGGGTTTAGG - Intronic
938767589 2:134470669-134470691 GAGGAACCCAAGGAGGATCCAGG + Intronic
939405059 2:141745648-141745670 GAGGGCACCAAGCAGGATCTTGG - Intronic
940402331 2:153262028-153262050 TAGAGGACCAAGCAAGCTCCTGG - Intergenic
944729601 2:202503384-202503406 GAGAGGCGCAAGCAGGAACCGGG + Intronic
947842711 2:233218653-233218675 AAGAGGAGCAAGCAGGATCCAGG + Intronic
1175638562 20:60606521-60606543 TATGGCCCCAATCAAGATCCAGG + Intergenic
1175707486 20:61191307-61191329 CAGGGGCTCAGGCAGGAGCCAGG - Intergenic
1177132968 21:17279781-17279803 TAGAGCACCAAGCAGGCTCCTGG + Intergenic
1177187914 21:17818940-17818962 GAGGGGCCCAAGCCGGAGCTGGG + Intronic
1177496891 21:21902418-21902440 GAGAGGCGCAAGCAGGAACCGGG + Intergenic
1179276151 21:39893548-39893570 GAGGGGCCACAGGAGGATCCAGG - Intronic
1180754071 22:18148075-18148097 CAGTGGCCCAAGCAGGGTGCTGG - Intergenic
1184945535 22:47801503-47801525 ATGGGGCCCAACCAGGAGCCAGG - Intergenic
949941461 3:9158095-9158117 TACAGGCCCGAGCAGGCTCCTGG - Intronic
950430475 3:12948021-12948043 CAAGGGGCCAAGCAGGCTCCTGG + Intronic
952033710 3:29175046-29175068 CAGAGGCCTCAGCAGGATCCAGG + Intergenic
953172945 3:40524541-40524563 TGAGGACCCAAGCAAGATCCTGG + Intergenic
953880764 3:46690299-46690321 TAGGGGACCATGGAGGGTCCAGG - Intronic
953932095 3:47010513-47010535 TAAGGGGCCCTGCAGGATCCTGG - Intergenic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
959868526 3:111300011-111300033 TAGAGCACCAAGCAGGCTCCTGG - Intronic
960404098 3:117238515-117238537 TAGGGCACCAGGCAGAATCCTGG + Intergenic
961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG + Intergenic
961442736 3:126962476-126962498 TAGGGGCTCATGCAGAATCCAGG + Intergenic
961504076 3:127358687-127358709 TAGGGACCCATGCAAGTTCCTGG - Intergenic
961718755 3:128878176-128878198 TAGGGGCCCACGTAGGAGGCAGG - Intergenic
962278543 3:134033328-134033350 TAGTTGCCCAAGCCAGATCCTGG - Intronic
962391770 3:134978263-134978285 GAGGGGCCAGGGCAGGATCCCGG - Intronic
965576290 3:170221934-170221956 CAGATGCCCAAGCTGGATCCAGG + Intergenic
966076035 3:175937376-175937398 GAGAGGCACAAGCAGGAACCGGG + Intergenic
966329044 3:178790441-178790463 TAGGGCACCAAGCAGGCTTCTGG + Intronic
976828251 4:89284131-89284153 TAAGGGCCTCAGCAGGATTCTGG + Intronic
978867133 4:113526847-113526869 CAGAGGCCCATGCAGGATCTGGG + Intronic
978923655 4:114217073-114217095 TGGGGCCCCAAGGAGGTTCCTGG - Intergenic
978939694 4:114421492-114421514 ATGGTGACCAAGCAGGATCCTGG + Intergenic
980682918 4:136187373-136187395 TAGAGGACCAAGCAAGAACCTGG + Intergenic
980970141 4:139559880-139559902 GAGGGGCCCAAGCAGTCTTCTGG + Intronic
982080530 4:151785323-151785345 TAGACACCCAAGCAAGATCCTGG - Intergenic
986046654 5:4044579-4044601 TAGAGCACCAAGCAGGATCTTGG + Intergenic
989812658 5:45696173-45696195 TAGGGGCCCGAGCCGGCTGCCGG + Intergenic
991554506 5:67880519-67880541 TAGGGGCCCCAGCAGTCTACTGG - Intergenic
991631526 5:68661009-68661031 TAGGATCCGATGCAGGATCCGGG - Intergenic
997228613 5:132227669-132227691 TAGGGGCCGGGGCCGGATCCGGG - Intronic
998216486 5:140241672-140241694 GAGCTGCCCATGCAGGATCCCGG + Intronic
999037883 5:148373881-148373903 TAGGAGCACTATCAGGATCCTGG - Intergenic
1001906863 5:175479927-175479949 TAGGTGCCCAGGGAGGATGCAGG + Intronic
1001977382 5:176011229-176011251 TAAGGGTCCAATCAGGTTCCAGG - Intronic
1002240044 5:177832550-177832572 TAAGGGTCCAATCAGGTTCCAGG + Intergenic
1004263375 6:14128310-14128332 GTGGGGCCCTAGCAGGATCAAGG - Intronic
1006134425 6:31887191-31887213 CAGGGCCCCAAGCTGGATCAGGG + Intronic
1006554230 6:34852090-34852112 TAGGGTACAAAGCAGGCTCCTGG - Intronic
1006878864 6:37321754-37321776 CAAGGGCCCAAGCAGGCTCTAGG - Intronic
1007956291 6:45920761-45920783 TAGGAGCCCCAGCAGGGCCCAGG + Intronic
1011648169 6:89480358-89480380 TAGGGGCGCATGAAGGAGCCAGG + Intronic
1011752673 6:90469028-90469050 TAGTGGCCCAAGCTGGATGAAGG + Intergenic
1012963430 6:105646990-105647012 TAAGGACCCAAGCAGAAGCCTGG + Intergenic
1014692445 6:124578243-124578265 TAGAGTACCAAGCAGGATCTTGG + Intronic
1015907307 6:138130105-138130127 TAGAGCACCAAGCAGGCTCCTGG + Intergenic
1018961867 6:168455067-168455089 TAGGGGCCCCTGCAGGGTGCCGG + Intronic
1019217921 6:170455461-170455483 TCCGGGGCCAAGCAGGGTCCTGG + Intergenic
1019486707 7:1292769-1292791 TAGGGGCAGCTGCAGGATCCAGG + Intergenic
1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG + Intronic
1021884859 7:25128665-25128687 TAGGGCACCAAGCAGGCTCCTGG - Intergenic
1022223580 7:28340104-28340126 TAGGGCACAAAGCAGGCTCCTGG - Intronic
1023860869 7:44217049-44217071 GAGGGGCCCAAGTAGGGTCTTGG + Intergenic
1027111145 7:75440906-75440928 TAGGGGTCCAAGCGGGAAACTGG + Intronic
1028835511 7:95370267-95370289 TGGGGGCCCATGCAGAATCAGGG + Intronic
1033502477 7:141965805-141965827 TAGAGCACCAAGCAGGATCTTGG - Intronic
1034855973 7:154547696-154547718 TAGGGGGACAAAGAGGATCCAGG - Intronic
1035601223 8:897974-897996 CAGGGTGCCAGGCAGGATCCAGG - Intergenic
1037034132 8:14144658-14144680 TAGAGCACCAAGCAGGCTCCTGG + Intronic
1037354139 8:17999117-17999139 TAGAGCACCAAGCAGGCTCCTGG - Intronic
1037918689 8:22788479-22788501 CTGGGGCACAAGCAGGGTCCTGG + Intronic
1038013922 8:23497407-23497429 CTGGGTCCCAGGCAGGATCCAGG + Intergenic
1041416025 8:57609582-57609604 TAGAGCACCAAGCAGGCTCCTGG + Intergenic
1043472958 8:80579139-80579161 TGGGGGCCGAAGCAGCGTCCAGG + Intergenic
1049416637 8:142498438-142498460 CAGAGGCCCAAGCAGGCACCCGG - Intronic
1049574308 8:143383398-143383420 TGGGGGCCCATGCAGGCCCCAGG - Exonic
1049574848 8:143385249-143385271 TAGGGAGCAAAGCAGGATCAGGG + Intergenic
1056424693 9:86464929-86464951 TAGAGTGCCAAGCAGGATCTTGG - Intergenic
1056795273 9:89654913-89654935 GAGGGGGCCAAGGAGGATCTTGG - Intergenic
1057141070 9:92727144-92727166 TAGGGGCCCAGGGAGGAGCTTGG - Intronic
1061357700 9:130118920-130118942 CAAGGCCCCAGGCAGGATCCAGG - Intronic
1061513716 9:131076417-131076439 AAGGGGCTCAAGCAAGATGCTGG - Intronic
1061757856 9:132827719-132827741 TTGGGGCCCACACAGGAGCCAGG - Intronic
1061861132 9:133469307-133469329 TAGGGGCCCCAGCAGGCCCAGGG - Exonic
1061908849 9:133712374-133712396 CAGGGGCTCAGGCAGGACCCTGG + Intronic
1192475442 X:71437729-71437751 AAGAGACCCAAGCAGGATCGGGG - Intronic
1192575276 X:72238757-72238779 TCGGGTCCCCAGGAGGATCCGGG + Intronic
1192676221 X:73199515-73199537 TAGAGGACCAAGCAGGCTCTTGG + Intergenic
1192679958 X:73242053-73242075 TAGAGCACCAAGCAGGATCTTGG + Intergenic
1192861766 X:75081004-75081026 TAGAGGCCCAAGTAGGAACCTGG + Intronic
1193756770 X:85418552-85418574 TAGAGCACCAAGCAGGTTCCTGG - Intergenic
1194877549 X:99208190-99208212 TAGAGCACCAAGCAGGCTCCTGG - Intergenic
1199086266 X:143633895-143633917 CAGGGGCCCAAGCAGCAGCCTGG + Intronic
1199188136 X:144940049-144940071 TAGGGCCCCAAGGCGGATCTGGG - Intergenic
1199265360 X:145821264-145821286 GAGGGGCCCAAGGAGGTGCCAGG + Exonic
1200282822 X:154792615-154792637 TAATACCCCAAGCAGGATCCAGG - Intronic