ID: 1070800829

View in Genome Browser
Species Human (GRCh38)
Location 10:79243551-79243573
Sequence CGGCGGCGGCGCGGGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1572
Summary {0: 1, 1: 3, 2: 39, 3: 242, 4: 1287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070800829_1070800847 5 Left 1070800829 10:79243551-79243573 CCCGGGCCCCCGCGCCGCCGCCG 0: 1
1: 3
2: 39
3: 242
4: 1287
Right 1070800847 10:79243579-79243601 GGGGCGCGGAGCGGGGATGCAGG No data
1070800829_1070800841 -4 Left 1070800829 10:79243551-79243573 CCCGGGCCCCCGCGCCGCCGCCG 0: 1
1: 3
2: 39
3: 242
4: 1287
Right 1070800841 10:79243570-79243592 GCCGCCGCCGGGGCGCGGAGCGG No data
1070800829_1070800844 -2 Left 1070800829 10:79243551-79243573 CCCGGGCCCCCGCGCCGCCGCCG 0: 1
1: 3
2: 39
3: 242
4: 1287
Right 1070800844 10:79243572-79243594 CGCCGCCGGGGCGCGGAGCGGGG No data
1070800829_1070800848 8 Left 1070800829 10:79243551-79243573 CCCGGGCCCCCGCGCCGCCGCCG 0: 1
1: 3
2: 39
3: 242
4: 1287
Right 1070800848 10:79243582-79243604 GCGCGGAGCGGGGATGCAGGCGG No data
1070800829_1070800843 -3 Left 1070800829 10:79243551-79243573 CCCGGGCCCCCGCGCCGCCGCCG 0: 1
1: 3
2: 39
3: 242
4: 1287
Right 1070800843 10:79243571-79243593 CCGCCGCCGGGGCGCGGAGCGGG No data
1070800829_1070800839 -9 Left 1070800829 10:79243551-79243573 CCCGGGCCCCCGCGCCGCCGCCG 0: 1
1: 3
2: 39
3: 242
4: 1287
Right 1070800839 10:79243565-79243587 CCGCCGCCGCCGCCGGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070800829 Original CRISPR CGGCGGCGGCGCGGGGGCCC GGG (reversed) Intronic
900091795 1:923996-924018 GGGCGGCGGGGCGGGGGCTTGGG + Intergenic
900117277 1:1034037-1034059 CGGAGGCCGCGCCGGGTCCCGGG - Intronic
900237545 1:1599938-1599960 CGGCGGCGTCGGGGCGGCCGCGG + Exonic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900342256 1:2194726-2194748 TGGAGGCGGCGCGGAGGCCGCGG - Exonic
900349396 1:2227661-2227683 CGGAGGCGGCGGTGGCGCCCGGG - Intergenic
900349511 1:2228076-2228098 CGGCGGCGGCGCGGGGCTCGGGG - Intergenic
900349662 1:2228481-2228503 CGGGGGACGCGCGGGGGGCCCGG + Intergenic
900349754 1:2228703-2228725 CGGCGGGGGCCGGGGGGGCCCGG + Exonic
901019763 1:6249708-6249730 GGGCGGCGGCGCGGGCTGCCGGG + Exonic
901022175 1:6261032-6261054 CGGCGGCGGCGGCGGCGCCTAGG - Intergenic
901057616 1:6455989-6456011 CGGCTGCGGCGCAGGGGCCAGGG - Intronic
901096233 1:6682482-6682504 GGGCAGCGGTGCTGGGGCCCGGG + Intronic
901332813 1:8423879-8423901 CGGGGGCGGGGCCGGGGCCGGGG - Intronic
901405121 1:9040143-9040165 CTGCAGCGCCGCGGGGACCCCGG + Exonic
901433872 1:9234704-9234726 CGGGGGCGGGGCGGGGGCGCCGG - Intergenic
901443399 1:9292947-9292969 AGGCGCCGGCGCCGGGGCCGGGG + Exonic
901443401 1:9292953-9292975 CGGCGCCGGGGCCGGGGCCGCGG + Exonic
901443468 1:9293123-9293145 AGGGGGAGGCGCGGGGGGCCGGG + Intronic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
901629031 1:10639256-10639278 CGGCGGCGTCGGGCGGGCCGGGG + Exonic
901641223 1:10694160-10694182 CGGCCCCGGCTTGGGGGCCCTGG + Intronic
901641262 1:10694256-10694278 CGGGGGAGGCCCGGGGGCCGCGG - Intronic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902304377 1:15525171-15525193 CGGGGGCGGGGCGGGGCCCTGGG - Intronic
902323595 1:15684370-15684392 CCGCGGTGGAGCGAGGGCCCAGG + Exonic
902323649 1:15684502-15684524 CGGCGGCGGGGCGGCGGCGGCGG + Exonic
902377170 1:16035266-16035288 CGGCGGCTGCCCGGGGCCCAAGG - Intergenic
902382348 1:16058525-16058547 CGGCGGCTGCCCGGGGCCCAAGG - Exonic
902476745 1:16692489-16692511 CGGCTGCGGCACAGGGGCCAGGG + Intergenic
902603605 1:17556266-17556288 TGGCGGCGGGGGGGGGGCCTGGG + Intronic
902783126 1:18717029-18717051 CGGCGGCGGCGGCGGAGCGCGGG - Intronic
903132728 1:21290226-21290248 CGGCGGCGGCGCCAGGGTCGGGG - Intronic
903233755 1:21936992-21937014 TGGCGCCGGCCCGGGGTCCCCGG + Intronic
903233967 1:21937560-21937582 GGGCGGGGGACCGGGGGCCCGGG + Intergenic
903324834 1:22563735-22563757 CGGCGGCGGCGGGGCGGGGCAGG + Intronic
903413716 1:23167882-23167904 GGGCGGCTGGGCGGGGGCCGGGG + Intronic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
903750176 1:25616685-25616707 CGGCTGCGGCGCGGCGGCGGCGG + Intergenic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903828650 1:26161969-26161991 CGGCGGCGGCTCGGAGGCAGCGG + Exonic
903950542 1:26993807-26993829 CGCCTGCGGCCCGGGGGCCCAGG + Exonic
904037926 1:27568698-27568720 CGGCCGCGGCGCGGGTGCCCGGG + Intronic
904171041 1:28592427-28592449 GGGCGGCGCCGGCGGGGCCCCGG + Intronic
904181439 1:28669097-28669119 CGGCCGCGCCGCCGGGGCTCGGG + Intronic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904244987 1:29181494-29181516 TGGCGGCGCCTCGGGGGCGCGGG - Intronic
904500118 1:30908520-30908542 CGGCGCCGGGGCCGGGGCCGCGG - Exonic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904782930 1:32964386-32964408 CGGCGGCGGCGGCGGAGCCTGGG - Exonic
904847331 1:33430453-33430475 CGGCTGGGGAGCGGGCGCCCCGG + Intronic
905124557 1:35707860-35707882 AGGTGGCGGGGCGGGGGCCGCGG + Intergenic
905137091 1:35808248-35808270 CGGCGGCGGCGCCCGGCCCGGGG - Exonic
905145294 1:35883280-35883302 GGGCGGCGGCGCGAGCGGCCGGG + Exonic
905179166 1:36156049-36156071 CGGCGCGGGCGCGGGGGGCTGGG + Intronic
905223407 1:36464291-36464313 CGGCCGCGGCGCGGGCCCCGCGG - Exonic
905347086 1:37318605-37318627 CTGCGGCAGCGCGGGGACGCGGG + Intergenic
905393983 1:37655687-37655709 TGGCGGGAGCGCGGGGGTCCCGG - Intergenic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
905569350 1:38991499-38991521 CGGCGGCGGCTCGGCGTCCGGGG - Exonic
905746280 1:40421453-40421475 CGGTGGCGGGGCGGGGGCGGGGG - Intronic
905789680 1:40783599-40783621 CGGGGGCAGCGCGCGGGGCCGGG - Intergenic
905863858 1:41366440-41366462 CGGCGGCGGGGGAGGGGCGCCGG - Intronic
906615832 1:47232239-47232261 GGGCGGGGGAGCGGGGGCCGCGG - Intergenic
907051030 1:51330227-51330249 AGGCGGAGGCGCGGGGACCCCGG - Intronic
907069205 1:51519000-51519022 CGGCGGCCGCAGGGGGGCTCCGG + Intronic
907278085 1:53327942-53327964 CGGCGGCGGCGCGGGGAGCGCGG - Exonic
907341220 1:53737879-53737901 CGGTGGCGGCGCAGGCGGCCGGG + Intergenic
907341337 1:53738328-53738350 GCGCCGCGGCGCGGGGGCCTGGG - Intergenic
907689143 1:56645245-56645267 CGGGGCGGGCGCGGGGTCCCGGG - Intronic
907883983 1:58576664-58576686 CGGCGGTGGGGCGGTGGCGCAGG + Exonic
908203281 1:61819608-61819630 AGGCGGCGGTGGGGGGGCGCGGG + Intronic
908355587 1:63323017-63323039 CGGCGGCGGGGAGGGGGCAGCGG - Intergenic
908401219 1:63774378-63774400 CGGCGGCGGCGGCGGCTCCCAGG - Exonic
908501205 1:64745193-64745215 CGGCGGCGGCGAGGGGGGCGCGG + Exonic
908581971 1:65525760-65525782 TGGCGGCGGCGCCGGGGCTCGGG - Intronic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
909547977 1:76868361-76868383 GTGCGGCGGGGCTGGGGCCCAGG + Intronic
910182983 1:84505953-84505975 CGGCGGCGGCGGGTGGGATCCGG - Intronic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
910277560 1:85465069-85465091 CGGCGGCGGCGGAGGCGGCCGGG + Exonic
910288810 1:85580872-85580894 GGGTGGCGGCGCGGTGGGCCCGG - Exonic
910839323 1:91546468-91546490 CGGGGGCGGCCCTGGGGCCTCGG + Intergenic
910935095 1:92480846-92480868 TGCCGGCGGCGCGGGGGCCGGGG - Exonic
911208735 1:95117905-95117927 CCCGGGCGGCGCGGGGGCCGCGG - Exonic
912381366 1:109249770-109249792 CAGGGGCGCCGCGGGGCCCCCGG + Intergenic
912505056 1:110150634-110150656 GGGGAGCGGCGCGGGGACCCAGG - Exonic
912670510 1:111620064-111620086 CGGTGTCGGGGCGGCGGCCCGGG + Intronic
914197331 1:145454417-145454439 GGCCGGCGGGGCGGGGGTCCCGG - Intergenic
914197347 1:145454447-145454469 CGGCGGCGGAGAGCGGGCCCGGG - Intergenic
914373388 1:147050784-147050806 CGGGGGAGGCGCGGGCTCCCGGG + Intergenic
914702937 1:150150348-150150370 CGTCGGCGCCGCGGCGGCCTGGG + Intronic
915246291 1:154558470-154558492 AGGGGGCGGCGCCGGGGGCCGGG - Exonic
915309776 1:155001211-155001233 GGGCGGCGCCAGGGGGGCCCTGG - Intergenic
915348336 1:155209175-155209197 CGGTGGCGGGGGGCGGGCCCAGG + Exonic
915902134 1:159854860-159854882 CGGCGGCGGTGCAGGGCGCCAGG + Exonic
915937793 1:160099002-160099024 CTGGGGCGGGGCCGGGGCCCGGG - Intergenic
916233301 1:162561489-162561511 CGGCCGCGGCCCGGGGCGCCGGG - Intronic
916233343 1:162561653-162561675 CCGCGGCGGCGGGGCGGGCCGGG - Exonic
916666994 1:166975589-166975611 GGGCGGCGGGGCGGAGGCGCGGG - Intronic
916890253 1:169106606-169106628 CGGCGGCGGGGCGGGGGCGGAGG - Exonic
916890255 1:169106612-169106634 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
917565231 1:176206726-176206748 CGGCGGCGGGGCGGTGTCCACGG - Exonic
917797525 1:178542735-178542757 CGGCGGGGGCGCGGGGGCGTCGG - Intronic
917846696 1:179026021-179026043 CGGAGGCGGCGGGGGCGGCCGGG + Exonic
917869592 1:179229621-179229643 CGGCGGCGGCGTTGGGGGCGCGG - Intronic
918151095 1:181798745-181798767 CGGCGGAGGCGCGGGGGGCCTGG + Exonic
918388882 1:184037523-184037545 CAGCGGCGGCGGGAGGGTCCTGG - Exonic
919075511 1:192808663-192808685 CGGCGGCCCGGCGGGGGCGCCGG - Intergenic
919101849 1:193105489-193105511 CGGCGGCGGCGCGGGCAGTCCGG - Intronic
920021231 1:202958126-202958148 CGGCGGGAGCGCGGGGACCCCGG - Intronic
920260541 1:204685273-204685295 CGGCGGCGGCGGCGCTGCCCAGG + Intronic
920379787 1:205528861-205528883 TGGCGGCGGAGGGGTGGCCCAGG - Intronic
920511784 1:206557232-206557254 CGGCGGCGGAGGGAGGGCGCTGG + Intronic
920912907 1:210233874-210233896 GGGCTGGAGCGCGGGGGCCCGGG + Intronic
920920257 1:210292540-210292562 CCGGAGCCGCGCGGGGGCCCGGG + Intergenic
921029797 1:211327056-211327078 CGGGGGAGGCGGAGGGGCCCGGG + Intronic
921355564 1:214281443-214281465 CGGCGGCGGCGGGCGGGAGCCGG + Intronic
921432800 1:215083021-215083043 CGGCGGCGGCGGGCAGGCGCGGG + Intronic
921604759 1:217139699-217139721 CGGCGGCGGCGGCGGTGCGCGGG + Intergenic
921882722 1:220272523-220272545 CGCCTAGGGCGCGGGGGCCCGGG + Intergenic
922250591 1:223845856-223845878 CGGCCGGGGCGGGGGAGCCCGGG - Exonic
922287546 1:224183250-224183272 CGGCGGCGGCGGCGGCTCCCCGG - Exonic
922440658 1:225653056-225653078 CGGCGGCGGCGCGGCGAGCGCGG - Exonic
922766395 1:228158681-228158703 GGGCCGCGGCGCGGGGGCGGGGG - Exonic
922958617 1:229626008-229626030 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
923007890 1:230066994-230067016 CGGCGGCGGCTGCGGGGGCCGGG - Intronic
923007903 1:230067035-230067057 CGGAGGCGGCGAGGGGGGTCAGG - Intronic
923372477 1:233327679-233327701 CGGAGGGGGCGGGGCGGCCCTGG + Intergenic
923684145 1:236142405-236142427 GGGCGGGGGCGCGCGGGCCGGGG + Intergenic
924415209 1:243850443-243850465 CGCCGGCGGGGCGGCGGCTCTGG + Intronic
924415213 1:243850451-243850473 GGGCGGCGGCTCTGGGCCCCGGG + Intronic
924436683 1:244048905-244048927 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
924511204 1:244730460-244730482 CGGCGGCGGGGCTGGCGCGCGGG + Intergenic
924524685 1:244835611-244835633 AGGCGGCGGCGCGTGGGGGCGGG + Exonic
924940924 1:248812097-248812119 CGGGGGCGGGGCCGGGCCCCAGG + Exonic
1062774733 10:135572-135594 CGGCGGCGGGGCGGCGGGGCGGG + Intronic
1063393667 10:5666561-5666583 CGGCGGCCGCGCGGCGACTCTGG + Exonic
1063395670 10:5685065-5685087 CGCCGGTGTCGCGAGGGCCCGGG + Exonic
1063407871 10:5813673-5813695 GGGAGGCGGCGCGCGGGCCGGGG + Intronic
1063418243 10:5890310-5890332 CGGCGGCGGCAGCGGGGTCCGGG + Intronic
1063504024 10:6580182-6580204 CGGCGGCGGCGCGGGGCGCGGGG + Intronic
1063504138 10:6580536-6580558 AGGCGGCGGCCGGAGGGCCCAGG + Intergenic
1064022811 10:11823398-11823420 GGGCGGCGGCGTGAGGGCTCCGG + Exonic
1064086243 10:12348836-12348858 TGGCAGCCGCGCGGGCGCCCTGG - Intergenic
1064209082 10:13348119-13348141 CGGCGGCGGCGGCGGGGGCCCGG + Exonic
1064443047 10:15370864-15370886 CGGCGGCGGCGGGAGGGTCCCGG - Intronic
1065023200 10:21517336-21517358 CGGCGGCGGCGCCCGGGCGCTGG + Exonic
1065099867 10:22321790-22321812 CGGCGGCGCGGCCGGGGCGCGGG - Intronic
1065533632 10:26697755-26697777 AGCCGGCGGCGCGGAGCCCCGGG + Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1065660282 10:27998925-27998947 AGGCGGCGGCGGCGGCGCCCGGG - Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066464238 10:35639521-35639543 GGGCGGGGGCGCGGGCGCCACGG - Exonic
1066697743 10:38093985-38094007 CGGCAGCGTCGCGGGGCCACAGG + Intergenic
1067103714 10:43351276-43351298 GGGCGGGGGAACGGGGGCCCGGG - Intergenic
1067227807 10:44386707-44386729 CGGCCGCAGCGCTGGGGCTCCGG + Intergenic
1067830792 10:49610176-49610198 CGTCGGCGGGGCGGGGGCCGGGG - Intronic
1067972812 10:50991717-50991739 CGGCGGGGGCGGGTCGGCCCAGG + Intronic
1068637401 10:59362692-59362714 CGGCGGCGGGGCTGGGACCCCGG + Intronic
1068783327 10:60944282-60944304 CGGCGGCGGAGCGAGGTGCCGGG - Intronic
1069024013 10:63521258-63521280 TGGCGGCGGCGCGTTGGCCCGGG - Intergenic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1070257631 10:74825525-74825547 AGGCGGCGGCGGTGGGTCCCGGG + Intergenic
1070610162 10:77927078-77927100 CGGCGGCGGGGCTGTGGCCACGG - Intergenic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1070877389 10:79826386-79826408 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1070895809 10:79982252-79982274 GGGCGGCGGCGGGGGCGCTCGGG + Intronic
1071579485 10:86756579-86756601 CGGCGCGGGTGCGGGGGCCTGGG - Intergenic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1073059415 10:100724504-100724526 CGGAGGACGCGCGGGGCCCCGGG + Intergenic
1073099663 10:100999945-100999967 CGGCGGAGGTGAGGGGGGCCGGG + Exonic
1073325846 10:102643732-102643754 CGGCGGGGGCGCCGGGCCTCGGG + Intergenic
1073363608 10:102919083-102919105 CGCCGGCGGCTCGGGGTCCACGG + Exonic
1073491448 10:103855616-103855638 AGGGGACGGGGCGGGGGCCCCGG + Intergenic
1074121735 10:110498358-110498380 CGGCGGCGGCGTCGCGGCCGTGG + Exonic
1074399043 10:113126741-113126763 CGGCGGCGGCGCGGGCTGCAGGG + Intronic
1074503353 10:114044999-114045021 CGGCGGCGGCGGCGGGGCGCGGG - Exonic
1074721826 10:116271437-116271459 CGGGGGTGGCCCGGGAGCCCGGG - Intronic
1074843146 10:117374955-117374977 CGTCGGCGGGGCGGGGGTCTCGG + Exonic
1075119131 10:119651576-119651598 CGGCGGCGGAGAGGGGCCCACGG + Exonic
1075430299 10:122374772-122374794 CCGCGGCGGCGCGGGTGCTCCGG + Exonic
1075801865 10:125159443-125159465 TCGCGGCGGGGCGGGGGGCCTGG - Intronic
1076650100 10:131981729-131981751 AGGAGGCGGCGCGGGAGCCGAGG - Intronic
1076722097 10:132397182-132397204 CGGCGGCGGCGGCGGGGCGGGGG + Exonic
1076749888 10:132537417-132537439 CAGCCGCGGCGCGGGGGGCGGGG + Intergenic
1076778615 10:132711567-132711589 CGGGGGCTGGGCGGGGGCTCAGG - Intronic
1076792921 10:132786252-132786274 CGGCGGGGGCGCGCGGGCGGGGG - Intergenic
1076895361 10:133308836-133308858 CGGGGGCTGCGCGGGGGCTGTGG - Exonic
1076909316 10:133379328-133379350 CGGCAGCGTCGGGGAGGCCCCGG + Exonic
1076985980 11:236370-236392 CGGAGGCGGGGCCGGGGCGCCGG - Exonic
1076986000 11:236409-236431 CGGAGGCGGGGCTGGGGCGCCGG - Exonic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1077008534 11:370015-370037 CGCGGGCGGCGCGGGGGGCGCGG + Intronic
1077008548 11:370048-370070 CGGCGGGGGCCCCGGGGCGCGGG + Intronic
1077010361 11:376736-376758 CGCACGCGGCGCTGGGGCCCGGG - Exonic
1077018474 11:407180-407202 CGTCGGCGGCGCAGGGGCGGGGG + Intronic
1077065542 11:639571-639593 CGGGCGGGGCGCGGGGGCGCCGG - Intronic
1077100344 11:819694-819716 CGGCGGCGGCCGCCGGGCCCCGG - Exonic
1077137522 11:1008423-1008445 GGCAGGTGGCGCGGGGGCCCTGG - Intronic
1077159946 11:1108085-1108107 CGGCTGCAGCGTGGGGGTCCTGG + Intergenic
1077185475 11:1233713-1233735 CGGCGGGGGCTCGGAAGCCCGGG + Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077473551 11:2776070-2776092 CGGCAGCGGGGAGGGTGCCCAGG + Intronic
1077495484 11:2884848-2884870 CGGGGCCGGGGCGGGGGCCGGGG + Exonic
1077514211 11:2992065-2992087 CGGCGGCCGCGGCGGGGCCTGGG - Intronic
1077555746 11:3225337-3225359 CGGCAGCCCCGCAGGGGCCCGGG + Intergenic
1077923092 11:6655862-6655884 GGGCGGAGGGGCGGGGGCTCGGG - Intergenic
1078210287 11:9265039-9265061 CGGCGGCGGCGGAGGGGGCTCGG - Exonic
1078210380 11:9265283-9265305 CGGCGGCGGCGCGGAGGGGAAGG - Exonic
1078246098 11:9574144-9574166 GAGCGGCGGCGCTCGGGCCCGGG - Exonic
1078498257 11:11841995-11842017 CGGCGGCGGCGGCGGAGCCCTGG + Exonic
1078514103 11:12008508-12008530 CGGAGCGGGCGCGGGGGCCGTGG + Exonic
1078679550 11:13463042-13463064 CGGGGGCGGCGCGGGAGGCTGGG - Intronic
1079076723 11:17389145-17389167 CGGCGGCGGCGGGCGGGGCCGGG - Intronic
1079451199 11:20601247-20601269 CGGCGGCGGGGCGGCAGCCGCGG - Exonic
1079459761 11:20669488-20669510 CGGCGGCGGCGTGGGGCTCGGGG - Intergenic
1080034873 11:27700420-27700442 CGGCGGCAGCGTCGGGGACCCGG + Intronic
1080503833 11:32893349-32893371 CGGCGGGGTCGCGGTGGACCAGG + Intronic
1081425874 11:42926061-42926083 TGGAGGAGGAGCGGGGGCCCAGG + Intergenic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1081812845 11:45922996-45923018 TGGCGGGCGAGCGGGGGCCCCGG + Exonic
1081831504 11:46119963-46119985 CGGCGGCCGCGGGGCGCCCCCGG - Intronic
1081831878 11:46121442-46121464 CGGCGGAGGTGCTGCGGCCCGGG - Intergenic
1081831976 11:46121706-46121728 GGGCCGAGGCGCGGGGGCCCGGG - Intergenic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1081896835 11:46593978-46594000 CGGCGGCGGCGCCGGGTCGAGGG - Intronic
1081938136 11:46918593-46918615 GGGCTGCGGCGCGGGGGGCGGGG - Exonic
1082025109 11:47565815-47565837 CGGGGACGGGGCAGGGGCCCGGG - Intronic
1082789224 11:57335739-57335761 CTGCGGCCTCGCGAGGGCCCCGG + Exonic
1083171096 11:60924507-60924529 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1083329612 11:61891458-61891480 CGGCGGCGGAGGCGGCGCCCGGG - Exonic
1083571365 11:63763731-63763753 CGGCTGCGGGGCGGGGGCGGAGG + Exonic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1083670865 11:64299413-64299435 CGGCGGCGGGGCGGCGGGCCCGG - Exonic
1083741346 11:64713096-64713118 CGGTGGCGCCGCGCAGGCCCTGG + Exonic
1083758419 11:64803248-64803270 CGGGGGCGGGGCTGAGGCCCGGG + Intergenic
1083774687 11:64888646-64888668 GGGGGGCGGGGCGGGGGGCCAGG + Intergenic
1083795442 11:65014180-65014202 CGGCGGCCGGGAGGGGGCTCCGG + Exonic
1083883225 11:65558392-65558414 CGGCGGCGGCGAGGGGGGCTGGG + Intronic
1083888815 11:65585620-65585642 CCGCCGCAGCGCGGGGTCCCGGG + Intronic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1083997311 11:66278707-66278729 CGGCGGAGGAAGGGGGGCCCCGG - Intronic
1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG + Intergenic
1084000173 11:66291839-66291861 CGGCGGCGGCGTTGGCGGCCCGG - Intergenic
1084021316 11:66419991-66420013 CGGCTGCGGCGGGCGGGGCCTGG - Intergenic
1084066136 11:66705368-66705390 TGGCAGCGGCGCGGCGGGCCCGG - Exonic
1084146148 11:67266415-67266437 CGGCGGCGGCTCCGGGGCGCGGG + Exonic
1084151351 11:67289308-67289330 CGGCGGCAGCGCGGGCGGCAGGG - Exonic
1084165584 11:67373422-67373444 CGGCCCCGGCGCGGGGCTCCCGG + Intronic
1084265612 11:68003869-68003891 CGGCGGGGGCGGGGCGGGCCGGG - Intronic
1084295979 11:68213601-68213623 CGGCGGCGGTGCGGGCGGCAGGG - Intronic
1084319157 11:68363952-68363974 CGGCTGGGGCGCGGGGGCGAGGG + Intronic
1084363737 11:68684810-68684832 CGGCGGCCGGGCCAGGGCCCTGG - Intronic
1084387743 11:68854789-68854811 CCGCGGCTGCGCGGGCGCCCTGG - Intergenic
1084515758 11:69637323-69637345 CGGCGGCGGCTCGCGGGAGCCGG - Intergenic
1084973031 11:72781697-72781719 CGGCGGCGGCGCTGGCACCCCGG - Intronic
1084973049 11:72781736-72781758 CCGGGGCCGCGCGGGGGCTCTGG + Intronic
1085043999 11:73343085-73343107 TGGCGGCGGGGCGGGGGGCGGGG - Intronic
1085205831 11:74731368-74731390 CGGCGGCGGCGCGGCGGCCGCGG + Intronic
1085485669 11:76860964-76860986 CGGCGGCGGCGTGATGGCTCCGG + Exonic
1085641617 11:78196530-78196552 AGGCGAGCGCGCGGGGGCCCGGG - Exonic
1086561629 11:88175490-88175512 GGGCGGCGGGGCGGGGGCTGGGG + Intergenic
1087014620 11:93543227-93543249 CGGCGGCGGGGCGGGCGAGCCGG - Intronic
1088259123 11:107928350-107928372 CGGGGGCGGGGCGGGGGCGGTGG - Intergenic
1089244705 11:117110533-117110555 CGGCGGCGACGGGGAGGCTCAGG + Intergenic
1089346983 11:117796987-117797009 CGGCGGAGGCGGCGGGGCCAGGG - Intronic
1089432656 11:118436566-118436588 CGGCGGCGGCGGGGGGCGCCGGG + Exonic
1089499909 11:118925791-118925813 CGGCGGTGGTGCAGCGGCCCCGG + Intronic
1089543674 11:119206305-119206327 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1089596548 11:119584499-119584521 CTGCGGTGGGGCGGGGGCCGCGG + Intergenic
1089729430 11:120511440-120511462 TTGCGGCTGCCCGGGGGCCCGGG - Intergenic
1090190396 11:124762772-124762794 CGCCGGCCGCGCGGGCTCCCTGG + Intergenic
1090375166 11:126283163-126283185 GGGCGGGGTCGCGGGGGACCGGG + Intronic
1090635799 11:128689860-128689882 CCGCGGCGGCGGGAGGGCCGGGG - Intronic
1090699148 11:129279151-129279173 CGGCGGCGCGGCGGGGCCGCGGG - Intronic
1090780384 11:130002201-130002223 CGGCGGTTGCGCGGGCGCTCCGG - Intronic
1090817791 11:130314453-130314475 CGGCGGCGGCCCGGGGGGAGGGG + Exonic
1091558701 12:1594492-1594514 GGCGGGCGGCGAGGGGGCCCCGG + Intronic
1091613976 12:2035131-2035153 CTGCGCCGGCGCGTGTGCCCGGG + Intronic
1091823256 12:3491746-3491768 CGGCGGCGGCGCGGTGGTCCGGG - Intronic
1091915368 12:4269325-4269347 CGGCGGCGGCGCGGCGGGTCTGG - Intergenic
1092365385 12:7872862-7872884 CGGCGGGGGCGCAGCGGCCCGGG - Intronic
1092743058 12:11649042-11649064 CGTCTGCGGCGCGGCCGCCCCGG + Intergenic
1092861515 12:12724045-12724067 CGGCGGAGGCGCGGCCGCCCGGG - Intergenic
1093894687 12:24562738-24562760 CGGGGGCGGGGGGGGGGCGCGGG + Intergenic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1094682685 12:32679689-32679711 CGGAGCCGGCGCGGCGGGCCTGG + Intronic
1095261660 12:40105616-40105638 CGGCGGCGGCGTCGGGGACCTGG - Exonic
1095440794 12:42237784-42237806 CGGGGGCGGCCGCGGGGCCCGGG - Intronic
1095752682 12:45729281-45729303 CGGCGGCGGCGGCGGGGCTAGGG - Intergenic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096078396 12:48818600-48818622 CGGGGGCGGCGAGGGGGCGGCGG - Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096365485 12:51025886-51025908 CGTCGGCGCCGCAGGGGGCCGGG - Intronic
1096461189 12:51822026-51822048 TGGCGGCGGTTCCGGGGCCCTGG - Intergenic
1096489768 12:52007133-52007155 CGGCTGCGGCAGGGGGTCCCGGG - Exonic
1096647761 12:53047687-53047709 TGGCAGCGGCGCTCGGGCCCCGG + Intronic
1097155062 12:57006420-57006442 CGGCGGCGGCGATGGTGCTCGGG - Exonic
1097188969 12:57210517-57210539 GGGTGGCGGGGCTGGGGCCCAGG - Intronic
1097218139 12:57430484-57430506 GGGCGGCGGTGCGGGGGCAGGGG - Intronic
1098105963 12:67069314-67069336 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1098550375 12:71755144-71755166 CGGCGGCGGCGGCGGGGCGGCGG + Exonic
1098550376 12:71755147-71755169 CGGCGGCGGCGGGGCGGCGGCGG + Exonic
1098550377 12:71755150-71755172 CGGCGGCGGGGCGGCGGCGGCGG + Exonic
1100391733 12:94150073-94150095 CGGCGGCGGCGGCGGCTCCCCGG - Intronic
1100444744 12:94650308-94650330 CGGCGGGTGCGCGCGGGCCCGGG - Intronic
1101371762 12:104137692-104137714 CGGCGGCGGCGCGAGTCCCCGGG - Intronic
1101592900 12:106139199-106139221 CGGCGGCGGCGGCGGCGGCCAGG + Exonic
1101593046 12:106139683-106139705 CGGAGAGGGCGCGGGGGCCGGGG - Exonic
1101813630 12:108129312-108129334 CGGCAGCGGCGCGGGAGCTAGGG + Intergenic
1102026009 12:109714637-109714659 CGGGGGCCGCGCGGGCGCTCAGG - Exonic
1102197163 12:111033993-111034015 CGGCGGCGGCGAGGGGCAGCGGG + Intergenic
1102197199 12:111034077-111034099 CGGCGGCGGCCCCGGGGCTGGGG + Exonic
1102197409 12:111034854-111034876 CGGCGGCGGCGGCGGCCCCCGGG - Intronic
1102371015 12:112382318-112382340 CGGCGGCGGCGGCAGGGCCGGGG - Intronic
1102893007 12:116575898-116575920 CGGCGACGACGCGAGGGTCCCGG - Exonic
1102962007 12:117099190-117099212 GGGGGGCGGCGCGGGGACCGGGG - Intronic
1103074269 12:117969310-117969332 CGGGGGCGGCGGGGGAGGCCGGG + Intergenic
1103120039 12:118372668-118372690 CGGCGGCGGCGCCGGGCCCGGGG - Exonic
1103309098 12:119989970-119989992 CGGCGGCGGCGGCGGGACTCCGG - Exonic
1103410844 12:120710506-120710528 CGGCGTCGGCGGCTGGGCCCGGG + Exonic
1103433037 12:120904153-120904175 CGGCGGCGGCGCGGAGAACAAGG + Exonic
1103474810 12:121210434-121210456 CAGCCGCCGCGCCGGGGCCCCGG + Intronic
1103488197 12:121296742-121296764 CGGCGGGCGCGCGGGGGGCGGGG + Intronic
1103534776 12:121626860-121626882 CGGTGGCGGGGCGGGGCCCCCGG - Exonic
1103595573 12:122022662-122022684 GGGCGGCGGGGCGCGGGCCGGGG - Intronic
1103623711 12:122203914-122203936 CGGCGTCCTCGCGGGGACCCTGG - Intronic
1103649707 12:122422835-122422857 CGGCGGGCGCGCCGGGGCCAGGG - Intergenic
1103850267 12:123928409-123928431 CGGCGGTGGCTCGGGGGCAGTGG + Exonic
1104980148 12:132570057-132570079 CGGGAGCCGGGCGGGGGCCCCGG - Exonic
1104983410 12:132583666-132583688 CCGCGGCGGCCCGGGGGGCGTGG - Exonic
1105000480 12:132687275-132687297 GGGCGGCGGCGCGCGGACCCAGG - Exonic
1105011944 12:132761911-132761933 CCGGGGCGGCGCGGGGGACACGG + Intergenic
1105411859 13:20177528-20177550 GGGAGGCGGCGCGGTGGCCGCGG - Intergenic
1105472074 13:20703743-20703765 CGGCGGCGGCGGCGGGGGCCGGG + Intronic
1105557244 13:21459011-21459033 CTGCGGCGGGGCGCGGGCCGCGG - Intronic
1105918803 13:24941590-24941612 CGGGGGAGGGGAGGGGGCCCGGG - Intergenic
1106516918 13:30464570-30464592 CGGCGGCGGCGCGGGCCTGCAGG - Intronic
1106517110 13:30465247-30465269 CGAGGGCGGCGCGGGGGCCTGGG - Intronic
1106517156 13:30465375-30465397 CGGCGGCGGCGGGAGGGCAGCGG - Intronic
1106720012 13:32427556-32427578 CGGCGGCGGGGAAGGGGCCGGGG + Intronic
1106735853 13:32586980-32587002 CGGCGGCGGCGGGAGGGCGCGGG - Intronic
1106956354 13:34942734-34942756 CGGCCGGGGGGCGGGGGCCGAGG + Exonic
1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG + Exonic
1107604034 13:42040820-42040842 CAGCGGCGGCGGCGGGGACCCGG + Intronic
1110558510 13:76886251-76886273 CGGCGGCGGCGGCGGGGCGCAGG - Exonic
1110572977 13:77026710-77026732 GGGGGGGGGCGCGGGGGCCGGGG - Intronic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1112504971 13:99970092-99970114 CGGCGGCGGCGGCGCGGCCGGGG + Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112506787 13:99980633-99980655 CGGCAGCGGGGCGGGGGCGCGGG + Intergenic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1112580565 13:100674149-100674171 AAGCGGCGGCTCGGTGGCCCCGG + Intronic
1113201072 13:107867609-107867631 CGGCGGGGCCGCGGGGCCCGGGG + Intergenic
1113643628 13:111976370-111976392 CGGCGGCGGCCCGCGGTGCCAGG + Intergenic
1113655116 13:112063114-112063136 CGGGGGCGGGGCGGGGGTGCTGG - Intergenic
1113655930 13:112067772-112067794 CGGCGGCGGCGGGGGCGCCAAGG + Exonic
1113775632 13:112943465-112943487 GGGCCGGGGCGCGGCGGCCCGGG + Intronic
1113779750 13:112969264-112969286 CGGAGGCGGGGAGGGGGCCACGG - Exonic
1114458466 14:22872219-22872241 CGGCGGAGCCCCGGGCGCCCAGG - Exonic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115851319 14:37592384-37592406 TGGCGGCCGCGTAGGGGCCCAGG + Exonic
1115851789 14:37595150-37595172 CGGCGGCGGCGCGGCGGGCGGGG + Intronic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1117176684 14:53153020-53153042 CGGCGGCGGCGCCTGGGAGCTGG - Exonic
1117251858 14:53946862-53946884 CGGCGGCGGCGGGGGCACCAGGG - Intergenic
1117377382 14:55129101-55129123 CGGCGGCGGCTCGGGGTGTCTGG + Exonic
1117424424 14:55580264-55580286 CGGCGGCGGCGGCGGCGCCTCGG + Intronic
1117680681 14:58200077-58200099 CGGCCGCGGCGCGCCGGGCCCGG - Intronic
1117875933 14:60249733-60249755 CGGCGGCGGCGGGCAGGCCTGGG + Intronic
1118350996 14:64972360-64972382 CGGCGGCGGCGCAGGGGAAGGGG - Intronic
1118607681 14:67515348-67515370 CCGCGGCGGCGCGGGGTCCGGGG + Intronic
1118887569 14:69879559-69879581 CGGCGGCGGGGAGCGGGCCGTGG - Exonic
1118992426 14:70809034-70809056 CGGCGGCGGCGGTGGGCCCCGGG - Exonic
1119219364 14:72893587-72893609 CAGCGGCGGGGCGGGGGCCGCGG + Intronic
1119290506 14:73491499-73491521 CGACGCCGTCGCAGGGGCCCCGG - Exonic
1119325781 14:73759057-73759079 CTGCGGCGGCGCGGGCGTGCGGG + Intronic
1119500894 14:75126780-75126802 CGGCGGCGGCGCGGCGGAGCAGG - Exonic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1119539259 14:75428096-75428118 CGGCGGCGGGGCTGGCGCCGCGG + Intronic
1119551194 14:75515189-75515211 CGGCGGCTGCCCGGGGCCGCTGG - Intergenic
1119860361 14:77931643-77931665 TGGCGCTGGCGCGGGTGCCCAGG - Exonic
1120788018 14:88554710-88554732 CGGCCGCGCGGCGGGGCCCCGGG - Exonic
1120881308 14:89417040-89417062 CGGCAGGGGCGCGGGGGTCGCGG + Intronic
1121050493 14:90816459-90816481 CGGCGGGCGCGGCGGGGCCCCGG + Intronic
1121352636 14:93185257-93185279 CGGCGGCGGCGACGGGGGCCGGG + Exonic
1121417361 14:93788567-93788589 TGGCGGCTGCGCGGGCGCCCGGG + Intergenic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1122081547 14:99270797-99270819 CGGCGGCGGCGCTGGTGGCGGGG - Intronic
1122131243 14:99605271-99605293 CGGCGGCCTCGCGGGACCCCCGG + Intergenic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122162330 14:99793426-99793448 CGGCGGCGGCGCGGCCGGGCCGG + Exonic
1122183492 14:99971975-99971997 CGGCGGCGGGGCGCGGGACGCGG - Intronic
1122183493 14:99971981-99972003 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
1122221235 14:100240060-100240082 CGGCGGGGGCGCGGCGGCGGCGG + Intronic
1122517206 14:102317340-102317362 AGGTGGCGGCGCGGGGACTCGGG - Intergenic
1122543304 14:102509500-102509522 CGGGCGCGGCGCGGGGGACGGGG + Intronic
1122558127 14:102592439-102592461 GGGCGGCGGGGCGGGGGAGCGGG - Intergenic
1122582340 14:102778178-102778200 GGCGGGCGGCGCGGGGGTCCGGG + Intronic
1122620960 14:103057467-103057489 CGGCGGCGGCGGGGAGGGCGCGG - Intergenic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122666678 14:103334696-103334718 CGGCGGGCGGGCGCGGGCCCGGG + Intronic
1122904511 14:104795619-104795641 CGGCGGCGGCACGCGAGGCCCGG - Intronic
1122917516 14:104865760-104865782 CGGTGCCGGGGCGGGGACCCGGG - Intronic
1122942040 14:104985842-104985864 CGGCGGGGCCGCGCGGGACCAGG - Exonic
1122975463 14:105168949-105168971 CGGCGGGGGCACGGGGCCTCGGG + Intergenic
1122978564 14:105181092-105181114 CGGCGGGGGCGCGGGGGACGCGG + Intronic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1122993298 14:105248980-105249002 CGGCGGCGGCGCTGGCGCGGGGG - Exonic
1123024922 14:105420005-105420027 CGGCGGCGGCGGAGGGGCCCGGG - Exonic
1123025068 14:105420326-105420348 CGGGGGTGGCGGGGGGGCGCGGG + Intronic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1202899784 14_GL000194v1_random:28384-28406 CGGCGCAGGCGCGGGGGGCGGGG - Intergenic
1123413006 15:20074431-20074453 CGGCAGCTGCGCGGCGGCACCGG - Intergenic
1123522348 15:21081544-21081566 CGGCAGCTGCGCGGCGGCACCGG - Intergenic
1123671563 15:22664515-22664537 CCGCAGCGGCGCGAGGGGCCCGG + Intergenic
1123676520 15:22714899-22714921 CGGCGGCGGCCCGGCGATCCCGG - Intergenic
1123684351 15:22786685-22786707 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1123710025 15:22980293-22980315 CCGCGGCGGCTTGGGGGTCCTGG + Exonic
1124328738 15:28789159-28789181 CGGCGGCGGCCCGGCGATCCCGG - Intergenic
1124427085 15:29571067-29571089 CGGCGGCGGGGCTCGCGCCCGGG - Intergenic
1124469319 15:29968961-29968983 CGGCGGCGGCGGGAGCGGCCGGG - Intergenic
1124652339 15:31483307-31483329 CGGCGGCGGCGCGAGGCGCGCGG - Exonic
1124848009 15:33310695-33310717 CGGGGGCGGTGCGGGGGCCCTGG - Intergenic
1124957181 15:34367182-34367204 CGGCGGCGGCGCTCTGGCCCGGG + Exonic
1125463318 15:39926714-39926736 AGGTGGCGGGGCCGGGGCCCTGG + Intergenic
1125674364 15:41494451-41494473 CGGGGGCTGCACGGGGGACCTGG + Intronic
1125675988 15:41502865-41502887 CGGCGGCTGCCCGGGTGCCCGGG + Intronic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1125685037 15:41559054-41559076 CGTCAGCAGCGCGGGGTCCCCGG - Exonic
1125689620 15:41585526-41585548 CGGTGGCGGCCCGTGGGCGCGGG + Intergenic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1126736621 15:51737542-51737564 CGGCGGCGGCGAGGGGGCCGAGG + Exonic
1127144149 15:56007371-56007393 CGGCGGCGGCGGGGGAGGCGGGG + Intergenic
1127867266 15:63042805-63042827 TGGCGGCGGCGAGGGGCCCTGGG - Exonic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1128056469 15:64703223-64703245 CGGCGGCGGCGGTGGCGGCCGGG - Exonic
1128067863 15:64775615-64775637 CGGCGGCGGGGGGCGGGCGCCGG + Intergenic
1128115426 15:65102163-65102185 CGGGGGCGACGCGGGGGCGGCGG + Exonic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128161061 15:65423007-65423029 TGGGGCCGGCGCGGGGGCCAGGG + Exonic
1128374784 15:67066721-67066743 CGGCGGCGGAGGAGGGGCTCCGG - Intronic
1128454962 15:67827130-67827152 AGGCGGGGGTGCGGGGGGCCCGG + Intronic
1128482814 15:68054514-68054536 CTGCGGCGGGCCGCGGGCCCCGG + Intronic
1128547750 15:68579231-68579253 CCGCGGCGGAGCGGGGGCGCGGG - Exonic
1128877608 15:71215073-71215095 CGACGGCGGCGGCGGCGCCCCGG + Exonic
1129082480 15:73052677-73052699 TGGCGGCGGAGCGGGGAGCCCGG + Exonic
1129189138 15:73927413-73927435 CGGCGTGGGCGCGGGGGCGGCGG + Exonic
1129263537 15:74382139-74382161 TGGCGGCGGGAGGGGGGCCCAGG + Intergenic
1129287967 15:74541145-74541167 CGGGGGCGGGGCGGGGCCACAGG - Intergenic
1129752821 15:78077685-78077707 CGGCCGCGGCGCGGAGGCGCAGG - Intronic
1129817248 15:78565718-78565740 CGATGGCGGCGCGGGGGTCAGGG + Exonic
1129852279 15:78800298-78800320 ACGCGGCGGCGCGGCGGCCTGGG - Exonic
1129893787 15:79089491-79089513 CGGCGGCGGCGCAGGGGGCGGGG + Intronic
1129933710 15:79432259-79432281 CAGCCGCGGCGCGCTGGCCCTGG + Intergenic
1130076676 15:80695579-80695601 CGGCGCCGGCGCGTCCGCCCCGG + Exonic
1130348108 15:83067257-83067279 CTGCGGAGGCGCGAGGCCCCCGG - Exonic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1130613430 15:85381159-85381181 CGGCGCCGACCCGGGGACCCGGG - Intronic
1130969045 15:88718073-88718095 CCGCGTCGGCTTGGGGGCCCTGG + Intergenic
1131056708 15:89379198-89379220 CGGCTGCGGCTCCGGGGACCGGG - Intergenic
1131108689 15:89751027-89751049 CGGAGGGGGCGCGGGGGTCCCGG + Exonic
1131144345 15:90001680-90001702 CGGCGGGGGCGCGGGGGGCGCGG + Intronic
1131144434 15:90002030-90002052 CGGCGGCGGCGCGGGAGGCCCGG + Intronic
1131515398 15:93073304-93073326 AGGCGGCCGGGCGGGGACCCAGG + Intronic
1131635716 15:94231416-94231438 CGGCGGCAGCGCGGGCGCTTGGG + Intergenic
1132055560 15:98648554-98648576 CGGCGGCGGCGCGGCGAGGCTGG + Intergenic
1132111595 15:99105711-99105733 TGGCGGCGGCGCGGCGGGGCCGG - Exonic
1132252064 15:100341637-100341659 CGGCGGCGGCGCGCCTGCCACGG + Intronic
1132365124 15:101251562-101251584 CGGCGGCGGCGGCGCTGCCCGGG - Exonic
1132382152 15:101373433-101373455 CTGGGGCAGCGCGGGAGCCCAGG + Intronic
1132512819 16:352686-352708 CGGCGGGGGCGCTCGGGCCTGGG - Intergenic
1132512843 16:352725-352747 CGGGGGCGGGGCCGGGGCGCGGG + Intergenic
1132527845 16:426260-426282 CGGCGGCGGGGCGGACGGCCCGG - Exonic
1132544732 16:527950-527972 CGGCGGGGGCGAGCGGGCCCGGG + Exonic
1132560201 16:590061-590083 GTGGGGCGGCGCGGCGGCCCTGG + Intronic
1132568651 16:634694-634716 AGGTGGGGGAGCGGGGGCCCAGG - Intronic
1132604654 16:788636-788658 CGGCGGCGGCGCGGGAGGTTCGG + Exonic
1132607804 16:800790-800812 TGGGGGCGGCGCCAGGGCCCAGG - Intergenic
1132652226 16:1026688-1026710 CTGCCGCGGTGCGGGGGACCTGG - Intergenic
1132683570 16:1153329-1153351 GGGCGGAGGCGCTGGGGGCCGGG + Exonic
1132683589 16:1153363-1153385 GGGCGGAGGCGCTGGGGGCCGGG + Exonic
1132719655 16:1309498-1309520 CGGCGGCGGGGCGCGGGCAACGG + Intronic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1132851505 16:2026929-2026951 CGGCGGCGGCGCTGGGCACCCGG - Exonic
1132889381 16:2196491-2196513 CGGCGGCGGCCCCGCGGCACCGG + Exonic
1132934579 16:2474210-2474232 CGGGGACGGGGCGGCGGCCCAGG - Intergenic
1132985662 16:2765962-2765984 CGGCGGCGGAGGGGAGGCTCTGG + Exonic
1132987874 16:2777358-2777380 CGGCGGCTGCGGGGCGGCACGGG - Intergenic
1133029741 16:3004690-3004712 CGGCGGCGGCTCGGAGACCAGGG - Intergenic
1133032931 16:3020322-3020344 CGGGGGCGGGGCGGCGGCCGTGG + Exonic
1133038290 16:3046610-3046632 CGGCGGCCTCTCGGGGTCCCGGG - Intergenic
1133097709 16:3458369-3458391 CGGCGGCGGGGAGTGGGCGCTGG + Intronic
1133156451 16:3880136-3880158 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
1133156545 16:3880396-3880418 CGGCGGCGGCGGCGGGCCGCGGG - Exonic
1133232156 16:4371964-4371986 CGGCGGCGGCGCAGGGAGCCGGG - Exonic
1133325043 16:4937123-4937145 GAGCGGCGGCGCGGGGAGCCCGG + Exonic
1133362624 16:5186456-5186478 CGGAGGCGGCGGGGAGGCTCAGG + Intergenic
1133513423 16:6483222-6483244 CCACGGCGGCGCCAGGGCCCGGG - Intronic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1134143631 16:11742845-11742867 CGGCGGCGGCGCGGCTGACGTGG - Exonic
1134149875 16:11797195-11797217 CGGCGGCGGCGGCGGGGCCTGGG + Intronic
1134482316 16:14630296-14630318 CGGCGGCGGGGGCGGGGCCAAGG + Intronic
1134615808 16:15650385-15650407 AGGCGGTGGCCCGGGGTCCCGGG - Intronic
1134656105 16:15949600-15949622 CGGCGGCGGCGCAGGGAGCCGGG - Exonic
1135382756 16:22008196-22008218 AGGCAGCGGCGCGGGGACTCCGG + Exonic
1135479955 16:22814224-22814246 CGGCGGCGGCGCGGCTGTGCGGG - Exonic
1135517619 16:23148953-23148975 CGGCGGCGGCGTGGGCGCGGCGG + Exonic
1135607328 16:23836015-23836037 CGGCCGCGGCGCGCGGAGCCGGG - Exonic
1135745800 16:25015273-25015295 CGGCGGCGGCCCGCGGGGCTCGG + Exonic
1136419531 16:30123180-30123202 CGGCGGCGGCTCAGGGGGGCGGG - Exonic
1136453962 16:30370109-30370131 GGGCGGCGGCGAGGGGGCCGCGG + Exonic
1136498736 16:30659330-30659352 CGGGGGCGGCGCCGGCTCCCCGG + Exonic
1137426572 16:48385377-48385399 CGGCGGCGGCGGCGGCGGCCAGG - Intronic
1137617704 16:49856959-49856981 CGGCGGCGGCGGCTGCGCCCCGG + Intronic
1137708012 16:50548605-50548627 CGGCGACGGCGGCGGGGCCCGGG - Intronic
1137926611 16:52547007-52547029 GGGGCGCGGCGCTGGGGCCCGGG + Exonic
1138105624 16:54285951-54285973 CGGCGGCAGCGCGGGGGCCCGGG - Exonic
1138247628 16:55479285-55479307 CGGCGGCGGCGGCGGGGGCTGGG + Exonic
1138507700 16:57486400-57486422 CGGCGGCGGCGCCGGGCTCCAGG + Exonic
1138591233 16:58000678-58000700 GGCGGGCGGCGCGGGGGCCAGGG + Intronic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1139364850 16:66427088-66427110 GGGCGGCGGCGCGGGGACGACGG + Intergenic
1139390601 16:66604781-66604803 CGGCGGCGGCGGTAGGGCCGGGG - Exonic
1139402938 16:66696643-66696665 CGGCGGCGGCGGGCGGGCCGCGG - Exonic
1139409929 16:66751242-66751264 CGGCGGCGGGGCGTTGCCCCAGG - Intronic
1139433791 16:66925075-66925097 CAGCGGCGGGGCGGGGCCCCAGG + Exonic
1139451167 16:67029123-67029145 CGGCGGCGGCGGCGGCGGCCGGG + Intronic
1139469446 16:67170478-67170500 CGGCGGGGGCGGGGCGGCCAGGG - Intronic
1139484693 16:67248954-67248976 CGGCGGCGACGCGGGGCCGGCGG + Exonic
1139534413 16:67562686-67562708 CGGCGGCGGAGCGGGCGCCGCGG + Exonic
1139917836 16:70439126-70439148 CGGCGGCGGCGGCGGCGCTCGGG - Intronic
1140078521 16:71723572-71723594 CGGGCGCGGCGCGGAGGCCTCGG + Intronic
1140221591 16:73048062-73048084 CGGCGGCGGCGGGCAGGCCGGGG - Exonic
1140223272 16:73058774-73058796 CGGCGGCGGCTCCGGCTCCCCGG - Intronic
1140416087 16:74774735-74774757 GGGGGGCGGAGCGGGGGCCATGG + Exonic
1140478776 16:75251579-75251601 CGGCAGCTGCGCGGCGGCACCGG - Intronic
1140663990 16:77212429-77212451 CGGGGGCGGAGCGGGGGACCTGG - Intronic
1141079236 16:81036043-81036065 CGCCGGCGGCGCGGGGACAGCGG - Exonic
1141079282 16:81036220-81036242 GGCCGGCGGCCCGGGGGGCCGGG + Intronic
1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG + Intronic
1141608577 16:85169243-85169265 CGGCGGCGGCGGCGGGGCCCGGG - Intergenic
1141665294 16:85462683-85462705 CGGCGGGGGCGCCGCGGCGCGGG + Intergenic
1141840129 16:86568576-86568598 CGCCTGCGCCGCGGCGGCCCCGG - Exonic
1141948162 16:87324314-87324336 AGGCTGCGGGGCTGGGGCCCTGG + Intronic
1141959032 16:87392380-87392402 CGGCGACGACGCGAGGGTCCCGG - Exonic
1141972264 16:87492282-87492304 CGGGGGCGGCCGGGGGGCGCCGG + Intergenic
1141989477 16:87602237-87602259 CGGAGGGGGCGGGGGCGCCCCGG + Intronic
1142049936 16:87951614-87951636 GGGCTGCGGCGCGGGCGGCCCGG - Intronic
1142049938 16:87951622-87951644 CGGCGGCGGGGCTGCGGCGCGGG - Intronic
1142118930 16:88376497-88376519 CGGCGGCAGAGCGAGGGCCCCGG - Intergenic
1142197126 16:88744132-88744154 AGGCGGGGGCGCGGGGCCCCTGG - Intronic
1142206374 16:88785014-88785036 ATGGGGCGGTGCGGGGGCCCCGG + Exonic
1142293016 16:89201345-89201367 CGGGCGCGGGGCGCGGGCCCGGG + Intronic
1142567582 17:850630-850652 GGGGGGCGGCGTGGGGGCCCCGG + Intronic
1142614219 17:1125498-1125520 CGGGGGCTGTGCGGGGGCCTGGG + Intronic
1142631305 17:1228538-1228560 CGGCGGCAGGGCCGGCGCCCGGG - Intronic
1142699214 17:1649328-1649350 CGGCGGCGGCGCGCGGCCCGCGG + Intronic
1142763487 17:2054065-2054087 CGGAGGCGGAGCGTGGGCCGCGG + Intergenic
1142810339 17:2393071-2393093 CGGGGGCGGCGCGGCGTCACGGG - Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1142855101 17:2724692-2724714 CGGCGGTGGCGCCGGGGCCCGGG + Intergenic
1142863377 17:2776699-2776721 CGGCGGCGGCGAGGGGCGCCAGG + Intergenic
1143053282 17:4143893-4143915 CCGCGGCGGCCCAGGGGACCCGG + Exonic
1143223751 17:5282675-5282697 CGAGGGCGGCGCGGGCGCCCCGG + Intronic
1143519357 17:7436898-7436920 AGGAGGCGGCGAGGGGGCTCAGG - Exonic
1143708621 17:8718169-8718191 CGGTGGCGGCGGGGAGGCTCAGG + Intergenic
1143750114 17:9021685-9021707 CGGCGGCGGGGCCGGGACCGGGG + Intronic
1143750265 17:9022193-9022215 CGGCTGCGGGGTGGGTGCCCAGG + Intronic
1143783243 17:9240270-9240292 CGGCGGCCGCGCCCAGGCCCAGG - Exonic
1143904532 17:10198450-10198472 CAGCGGCTCCGCGGGGTCCCAGG + Exonic
1144269142 17:13600937-13600959 CGGCGGCGGCGAGGAGGCGGGGG - Exonic
1144500839 17:15786216-15786238 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1144724540 17:17495253-17495275 CGGCGGCGGCGGCGGCGACCCGG - Exonic
1144764230 17:17724217-17724239 CGGCGGCGGGCCGGGGGCTCGGG - Intronic
1144910053 17:18673023-18673045 CGGCGGCGGCGCCCGGGAGCCGG - Exonic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1145063139 17:19744787-19744809 CGGCGGGGGCGCGCGGGGCGCGG + Intronic
1145094075 17:20009569-20009591 CGTCTTCGCCGCGGGGGCCCCGG + Intronic
1145163000 17:20588878-20588900 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1145747885 17:27333285-27333307 CAGCTGCGGGGCGGGGCCCCGGG - Intergenic
1145828219 17:27893265-27893287 GGGCGGGGGCGCGGGGGCAGCGG - Intronic
1146022604 17:29292835-29292857 CGGTGGCGGCGCGCGGCCCCGGG - Intronic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146058703 17:29593551-29593573 CGGCGCCGGAGCCGGGGCCCGGG - Exonic
1146132636 17:30291970-30291992 CGGCGGCGGCGGGGAGGCTGAGG + Exonic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146371005 17:32265779-32265801 CGGGGGCGGCGCGCGGGCGGGGG - Intergenic
1146371097 17:32266015-32266037 CGGCGGCGGCGCGGGGACCGGGG + Intergenic
1146371263 17:32266557-32266579 CAGCGGCGGGGAGGGGGCTCCGG - Intronic
1146398670 17:32487339-32487361 AGGCTGCGTCGCGGGGGCGCGGG + Intronic
1146438909 17:32876872-32876894 TGGCGCCAGCGCGGGGGCTCAGG + Exonic
1146763509 17:35498173-35498195 AGGCGGCGGCGTGGGGAGCCGGG + Intronic
1147139625 17:38453879-38453901 CGCGCGCCGCGCGGGGGCCCGGG - Intronic
1147150374 17:38510569-38510591 CGGCGGCGGCGCTGGCCTCCCGG + Exonic
1147168602 17:38605707-38605729 GGGCGGGGGCGCGGGGGGCGGGG + Exonic
1147629245 17:41919183-41919205 CGGGGCCGGGGCGGGGCCCCGGG + Intronic
1147643195 17:42017594-42017616 CCGCGCCGGGGCGGGAGCCCAGG + Exonic
1147793082 17:43025287-43025309 GGGAGGCGGCGGCGGGGCCCGGG + Exonic
1147971142 17:44219578-44219600 AGGCGGCGGCGCTGGGGCGGCGG + Intronic
1147987510 17:44315026-44315048 CTGCGGCGGGGCGGGGGACGGGG + Intronic
1147994637 17:44354063-44354085 CGGCGGCGGCGCGGCAGGCGGGG + Exonic
1148048719 17:44759087-44759109 CGGAGCCGGGGCGGGGGCGCGGG - Exonic
1148090259 17:45019094-45019116 CGAGGGCGGCGCGGGCGGCCCGG + Intergenic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148323615 17:46771441-46771463 CGGCAGCGGCGCCCGGGCCCCGG + Intronic
1148356471 17:46978932-46978954 CGGCGGCGCCGGGGCCGCCCTGG - Exonic
1148603072 17:48908649-48908671 CGGCGGCAGCGGGCGGGGCCGGG + Exonic
1148777966 17:50106107-50106129 GGGGGGCGGTGCTGGGGCCCAGG + Intronic
1148836570 17:50468850-50468872 CGGCGGCGGGGCGCGGGCAGCGG + Exonic
1148929969 17:51120324-51120346 CGGCGGCAGGGCGGGGGCCGCGG - Intronic
1148936228 17:51166399-51166421 CGGCGGCGGAGGAGGGGCGCAGG - Intronic
1149430651 17:56593880-56593902 CGGCGGCGGCGCAGGGCGCGTGG - Exonic
1149610532 17:57955335-57955357 CGGCGGCGCGGCTGGGGCGCGGG + Intergenic
1149865773 17:60150192-60150214 CGTCGGTGGCGCTGGGGTCCCGG + Intronic
1150373635 17:64662314-64662336 CGGCGGCGGCCCCAGGTCCCGGG - Intergenic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150561923 17:66302329-66302351 CGGCGGCGGCGGCGGCGGCCGGG - Intergenic
1150643455 17:66964584-66964606 CGGCGGCGGCGGGGGAGGCGCGG + Intergenic
1150747241 17:67825786-67825808 CGGCGGTGGCGGCGGGGCCGGGG - Exonic
1150791887 17:68205748-68205770 CGGCGGCGGGGCCGGGGCAGGGG - Intergenic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1151611929 17:75182319-75182341 CGGCGGCGGGGCGAGGGTTCGGG - Intergenic
1151767588 17:76140234-76140256 CGGGGGCAGGGCGGGGGCCTTGG + Exonic
1151828696 17:76537576-76537598 CGGCGGCGGTGGCGGGGCGCGGG + Exonic
1151831796 17:76557195-76557217 CCGCGGCTGCCCAGGGGCCCGGG - Intergenic
1152049180 17:77959072-77959094 CGGCGGCGGCGCGGGCGAGTGGG - Intergenic
1152197281 17:78925147-78925169 CGGCGGCGGGCTGGGGGCGCGGG + Exonic
1152356499 17:79810123-79810145 GGGCTGCGGCGCGCGGGCCCCGG - Intergenic
1152357715 17:79814835-79814857 CGGCGGCGGCGGGAGGGGCGCGG + Intergenic
1152362436 17:79838973-79838995 GGGCGGGGGCCCGGGGGCCGAGG - Intronic
1152362536 17:79839338-79839360 CGGCGGCGGCGGGGGCGCTTCGG - Exonic
1152403361 17:80082760-80082782 CGGCGGGGGCCCGGGGGCCTGGG - Intronic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152628649 17:81399793-81399815 CAGCGGCGCTGCGGTGGCCCAGG - Exonic
1152687769 17:81703061-81703083 CGACGGCGGCACTGGGGGCCCGG + Intronic
1152697423 17:81804086-81804108 CGGCGGCGGAGGGCGGGCTCGGG - Intergenic
1152714362 17:81891430-81891452 CGGCCGCGGCGGTGGGGCGCAGG - Exonic
1152720730 17:81922685-81922707 GGCCGGCGGCAAGGGGGCCCCGG + Exonic
1152729028 17:81960953-81960975 CGGCGGCGGCGGGGGATGCCGGG + Exonic
1152743497 17:82028846-82028868 TGGGGGCGGCGGGGGGACCCCGG + Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1152834210 17:82519323-82519345 AGGCGGCGGCCCGCGAGCCCAGG - Intergenic
1152864032 17:82711663-82711685 CGGCGGTGTCGTGGGGGCGCCGG + Intergenic
1152870863 17:82752334-82752356 CGGCGGCGGCGCGGAGCGCGAGG + Exonic
1153006224 18:500642-500664 CGGCGGCGGCGAGGGAGGACGGG - Exonic
1153219042 18:2846705-2846727 CGGCCGCGTCCCGGGGGGCCGGG + Intergenic
1153515166 18:5895444-5895466 CGGCGGCGGCTCGGGGCGGCCGG + Exonic
1153773399 18:8433098-8433120 CGGCGGCGGGGTGGGGGTCCAGG + Intergenic
1153794456 18:8609645-8609667 CCGAGGGGGCGCCGGGGCCCGGG + Exonic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1153997436 18:10454524-10454546 CGGCGGCTGCCCGGGGGCGGTGG + Intergenic
1154125569 18:11689526-11689548 CGGGGGCGGCGCGCGGGACTAGG - Exonic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154501016 18:14998112-14998134 CGGCACCAGCGCGGGGGCCCCGG + Intergenic
1155284207 18:24271875-24271897 CGGGCGCGGCGCGGGAGTCCTGG - Intronic
1155392720 18:25352303-25352325 CGGCGGCGGCGGGCGGGGCTCGG - Intergenic
1155972247 18:32092946-32092968 AGGCGGCAGCCCGGGGTCCCGGG - Intronic
1156008431 18:32470448-32470470 TGGCGGCGGCGGGGGAGCGCGGG - Intronic
1156099618 18:33578343-33578365 CGGCGGCAGCAGCGGGGCCCGGG - Intergenic
1156171845 18:34494371-34494393 CGGCGGGGGCGGGTGGGCACGGG + Intronic
1156446939 18:37243912-37243934 CGGCGGCGGCGGCGGCGACCCGG + Exonic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1157473682 18:48008309-48008331 CGGCGGCCACGCGGGGGCGCTGG + Intergenic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1157794215 18:50559967-50559989 CGGCGGTGGCGCTGGGGAGCCGG - Intergenic
1157867213 18:51197258-51197280 CGGCTGCGGCAGGGGGGCCGGGG + Exonic
1157867267 18:51197438-51197460 AGGCGGCGGGGCTGGGGACCCGG + Intronic
1158436009 18:57435860-57435882 CGGGGGCGGCGGCGGGGGCCCGG + Exonic
1158478810 18:57803129-57803151 CGGGGGCTGGCCGGGGGCCCGGG + Intergenic
1158601936 18:58863495-58863517 CGGCGGCGGCGGCTCGGCCCGGG - Intronic
1158954193 18:62523670-62523692 GGGCGGCGGCGGGGGGCCCTCGG + Exonic
1158976689 18:62716430-62716452 CGGCGGCGGCTCCGGGCCCCTGG - Exonic
1158980160 18:62752240-62752262 GGGTGGGGGCGCGGGGGGCCTGG - Intronic
1159586808 18:70289449-70289471 CGGCCGCGGCGCGCCGGCCTGGG + Intronic
1159947848 18:74457277-74457299 CGCGGGCGGCGGTGGGGCCCGGG - Intronic
1160163968 18:76494882-76494904 GGGCGGCGGGGCGAGCGCCCGGG - Intronic
1160164126 18:76495349-76495371 CGTCCGCCCCGCGGGGGCCCCGG + Intergenic
1160453160 18:78979226-78979248 CGCCGGCGGCGCAGAGGCCCAGG + Intergenic
1160453344 18:78979749-78979771 CGGCGGCGGCGGGGGGGGCGCGG + Intergenic
1160453651 18:78980824-78980846 CCGAGGCGGTGCGGGGGCCCGGG - Intronic
1160557669 18:79736500-79736522 CGGCAGGGGGCCGGGGGCCCAGG + Exonic
1160592343 18:79951548-79951570 CGGGGGCGGCGCGGGGTCCTCGG - Intronic
1160691046 19:460832-460854 CGGCGGCGGCGCGGGCGGCTGGG - Exonic
1160701084 19:507749-507771 CGGCGGCGCCGGGGAGCCCCCGG + Exonic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1160706343 19:531910-531932 TGGCGGCGGCGGAGGGGCCCGGG - Exonic
1160718733 19:588553-588575 CGGGGCCGGCGTGGGGGCGCAGG + Intergenic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160826363 19:1082273-1082295 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1160873122 19:1285959-1285981 CGGCGGCGGGGCGGGGCGCCGGG - Intergenic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160897202 19:1408340-1408362 AGGCGGCGGCGACGGCGCCCTGG - Intronic
1160927958 19:1556015-1556037 CGCCGGCGGCGGGAGGTCCCGGG + Exonic
1160930476 19:1567684-1567706 CGGCAGCGACCCGGGGGCCACGG + Exonic
1160930583 19:1567986-1568008 CGGCGGCGGCGTGGGGGCGGCGG - Exonic
1160947401 19:1650149-1650171 CGGGGGCTGGGCGGGGGTCCTGG + Intronic
1160948031 19:1652417-1652439 CGGCGGCGGCGCGCGTGGCCCGG + Intronic
1160967703 19:1753839-1753861 CGGCGGCGGTGGGGGCGCCGGGG + Exonic
1160987997 19:1848402-1848424 CGGCGCCAGTGAGGGGGCCCTGG - Exonic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1160996682 19:1885302-1885324 GCGCGGCCGCGCGGGGTCCCGGG - Intronic
1161029494 19:2051112-2051134 CGGCGGCGGCACTGCGGCCCCGG - Exonic
1161068990 19:2251191-2251213 CAGGCGCGGCGCGGAGGCCCGGG - Exonic
1161172434 19:2819767-2819789 CGGAGGCGGCGCTGTGACCCAGG + Intergenic
1161284688 19:3463267-3463289 CGGCAGAGGCGCGGGGGCCCGGG - Intronic
1161309360 19:3585551-3585573 CGGCGGCGGCGGCGAGGGCCCGG + Exonic
1161317379 19:3623936-3623958 CCGCGGCCGCCCGGGGGCTCTGG + Exonic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161450707 19:4343862-4343884 CGGCGGCGGGGCCGGGGCGGGGG + Exonic
1161461434 19:4400150-4400172 CGGGGGCGACGAGGTGGCCCAGG - Intronic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161487551 19:4543979-4544001 GGGGGGCTGCTCGGGGGCCCGGG + Exonic
1161583929 19:5094977-5094999 CGGGGGCGGCGCCGGGGGCGGGG + Intronic
1161672781 19:5623450-5623472 CGACGGTGGCTCGCGGGCCCTGG + Intronic
1161702372 19:5802520-5802542 CCGCGGCGGGGAGGGGGCACAGG + Intergenic
1161702980 19:5805108-5805130 GGGCGGCGGCGAGAGGGACCTGG - Intergenic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1161990385 19:7681196-7681218 CGGGGGCGGCCCGGAGCCCCTGG + Intronic
1162033206 19:7926052-7926074 CGGCGGCGGCGGCGGCGGCCCGG + Exonic
1162145508 19:8610655-8610677 CGGCGACGGCGCGGAGGCCCCGG - Intronic
1162235914 19:9309616-9309638 CCGCGGCGGCGGGAGGCCCCGGG + Intronic
1162238158 19:9324423-9324445 AGGCGGCTGCGCTGGGGCCTCGG + Intronic
1162299309 19:9835273-9835295 CAGCGGCGGCGGGCGGGCGCGGG + Intronic
1162357461 19:10194923-10194945 CGGCGGCAGCGCAGGCGCCCCGG + Exonic
1162361629 19:10223941-10223963 CGGAGGCGGGGCGGGACCCCGGG - Exonic
1162506855 19:11090652-11090674 CGGAGGCGGCTCCGGGGACCCGG - Intronic
1162535835 19:11262466-11262488 CGGCGGCGGGGCCGGGGCCCGGG - Intronic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162778692 19:12995757-12995779 CGGCGGCCGCGCTCGGGCTCGGG - Exonic
1162817920 19:13207543-13207565 CGGGGGCGGCGAGGAGGCCATGG - Exonic
1162861126 19:13506381-13506403 CGGCGGCGGCTCGGCGCCTCGGG + Intronic
1162861172 19:13506504-13506526 GGGGCGGGGCGCGGGGGCCCGGG + Intronic
1162931963 19:13961978-13962000 GGGCGGGGGCGCGGGGGCTGGGG + Exonic
1162954496 19:14090770-14090792 CGGCGGCGGCGGGGAGGGGCCGG - Intronic
1163118297 19:15200877-15200899 CGGCGGCGGCCACGGGCCCCCGG + Exonic
1163282406 19:16325628-16325650 CGGCGGCGGGGGGCGGCCCCCGG - Exonic
1163320566 19:16572319-16572341 GGGCCACGGCGCGGGGGGCCCGG - Exonic
1163427019 19:17245524-17245546 CGGCGGGGGCGCGCGGGCCATGG + Exonic
1163508030 19:17719707-17719729 CGGCGGCGGCGGCGGGACCCGGG + Intronic
1163708624 19:18832374-18832396 CGGTGGCGGCGCGGGAGGCCCGG + Exonic
1163845756 19:19637406-19637428 CGGCGGGGGCGGCGGGGCCTCGG + Exonic
1164639217 19:29812251-29812273 GGGCGGCGTCGCGGGGCGCCCGG + Intronic
1164639259 19:29812356-29812378 CGGCGGGGGCGGCGGGACCCCGG + Intronic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165056136 19:33177330-33177352 CGTAGGCGGCGCGGGGACCCAGG + Intergenic
1165227463 19:34365107-34365129 CGGGGGCGGGGCCGGGGCTCAGG + Intronic
1165242882 19:34481799-34481821 CGGCGGCCACGCGCGGGCCGGGG - Exonic
1165274284 19:34734398-34734420 CGGGGGCGGCGGCGGGGCTCAGG + Intronic
1165274285 19:34734404-34734426 CGGCGGCGGGGCTCAGGCCCTGG + Intronic
1165349517 19:35268502-35268524 CGGCGGCGGCGCGAGCCCCGGGG - Intergenic
1165349684 19:35269065-35269087 CGGGGGGGGCGCGGGGCCCGGGG - Exonic
1165408236 19:35643383-35643405 CGGCGGCGGGGATGGGGCCCGGG - Exonic
1165493918 19:36141047-36141069 CGGCGGCGGCGGGGGAGGCGGGG + Exonic
1165595297 19:37007718-37007740 CGGTGGCGGCGCGGCGGCCTCGG - Intergenic
1165721410 19:38082116-38082138 CGGGGGAGCCGCGGGGGGCCCGG + Exonic
1165760067 19:38315873-38315895 CGGCGGCTGCGGGGACGCCCCGG - Exonic
1165774326 19:38395848-38395870 CGGCCGCTGCGCAGAGGCCCCGG + Exonic
1165879468 19:39032174-39032196 CGGCTCCGGCGCGGGGACCCGGG + Exonic
1165907791 19:39204176-39204198 CGGAGGCGGGGCAGGCGCCCTGG + Exonic
1165924887 19:39320807-39320829 CGGCGGCGGGGCCGGGCCCGGGG - Intergenic
1166094452 19:40530447-40530469 CGGCCGCCGCGCGGGGGCGAGGG + Intronic
1166106371 19:40600096-40600118 CGGCGGCGGCCCCGGGGGCCAGG + Exonic
1166121627 19:40690484-40690506 AGGCGGGGGCGCCCGGGCCCTGG - Exonic
1166304257 19:41928598-41928620 CGGCGGCGGCGCGGGGGAGGGGG + Intronic
1166830979 19:45639451-45639473 GGGCAGGGGCGCGGCGGCCCGGG - Intronic
1166852846 19:45768686-45768708 CGGCGGCGGCGGCCGGGGCCGGG - Exonic
1166873773 19:45885447-45885469 CGGCGGCGGCGTGTCGGGCCAGG - Exonic
1166888065 19:45973475-45973497 CGGCGGCGGCTGCGGGGCCGCGG + Exonic
1167056142 19:47112549-47112571 TGGCGGCGGCGGGGGGGTCCCGG + Exonic
1167103904 19:47419477-47419499 CGGCGGCGGCTCAGGGGTGCTGG + Intronic
1167257999 19:48442679-48442701 CGGCCGCGGCGCGGGGTACGCGG - Exonic
1167258152 19:48443151-48443173 CGCGGGCGGCGCGGGGGGCACGG + Exonic
1167266532 19:48485586-48485608 GGGCTGGGGGGCGGGGGCCCGGG + Exonic
1167268247 19:48493874-48493896 CGGCGGGGCCGCGGGGCCCCGGG - Exonic
1167286955 19:48603692-48603714 CGGAGGCGACGCGGGGGCCACGG + Exonic
1167384976 19:49157814-49157836 CGGAGGGAGCGCCGGGGCCCTGG + Exonic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167469193 19:49666040-49666062 AGGAGGCGGCGGTGGGGCCCCGG + Exonic
1167483118 19:49745313-49745335 CTGCGGCTGCTCGGGGGCCTGGG - Exonic
1167557470 19:50205297-50205319 CGGCGGCGGCGGCGGCGCCAGGG - Intronic
1167631747 19:50629977-50629999 CGGCGGAGCGGTGGGGGCCCAGG - Exonic
1167638638 19:50668537-50668559 CGGCGGCTGCGGGGAGGCCGGGG + Exonic
1167859269 19:52269963-52269985 CGGCTGCGGCGCTGCGCCCCAGG - Intronic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168100395 19:54138249-54138271 AGGCGGCGGCGGGCGGGGCCCGG - Intronic
1168154052 19:54463461-54463483 CGGCGGGGGCGCGGGTTCCGTGG + Exonic
1168307312 19:55442641-55442663 CGGGGCGGGCGCGGCGGCCCGGG - Exonic
1168336494 19:55600286-55600308 CGGCGGCGAGGCGGGGGCGGCGG - Intronic
1168339118 19:55613794-55613816 CGGCGGGGGGCCGGGGGCGCAGG - Exonic
1168347147 19:55655410-55655432 CGGAGGTGGCGCGGGGGACGCGG + Intronic
1168694421 19:58396598-58396620 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
1168694498 19:58396859-58396881 CGGCGTCCAGGCGGGGGCCCAGG - Exonic
1202647157 1_KI270706v1_random:153007-153029 CGGCTGCAGCTCGGGTGCCCAGG + Intergenic
1202710760 1_KI270714v1_random:18313-18335 CGGCTGCGGCACAGGGGCCAGGG + Intergenic
925169930 2:1744216-1744238 CGCCGGGGGCGCGGGGTCCGGGG - Intronic
925307558 2:2861092-2861114 AGGCCGGGGCGCAGGGGCCCGGG + Intergenic
925376109 2:3387635-3387657 TGGCGGCGGCGAGGAGACCCCGG + Exonic
925927800 2:8682526-8682548 CGGCGGCGGGGCGGGGACCCCGG - Intronic
926154738 2:10447796-10447818 CGGCGGCCGCGCGCTGGCCGGGG - Intronic
926202569 2:10812492-10812514 CGGCGGAGGTGCGGGTGCGCGGG - Intronic
926580974 2:14632845-14632867 CGGCGGTGGCGAGTGGGTCCTGG - Exonic
927181092 2:20447272-20447294 CGGTGGGGGCGCGGGGGCATAGG - Exonic
927667572 2:25042763-25042785 CGCCGGCGGCGCAGAGGCCCGGG + Intronic
927684500 2:25161278-25161300 CGATGACGGCGCAGGGGCCCAGG - Exonic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
928186561 2:29115709-29115731 CGGCGGCGGGGTTGGGGCCGGGG + Intronic
928518325 2:32064136-32064158 CGGCACCGGCGCCGGGGCCGAGG - Exonic
928549521 2:32357292-32357314 CGGCGGGGGCGGGGGCGGCCGGG + Exonic
928983214 2:37156899-37156921 CGGCGGCGGCGCAGGTGAGCAGG - Exonic
929151159 2:38750546-38750568 CGTCGGCGGCGGGAGGGCCTCGG + Intronic
929460858 2:42101358-42101380 CTGCGGCGCCGCGCGGGCCTCGG - Intergenic
929511456 2:42568695-42568717 CGGCGGCGGCGGGCGGGGCTCGG + Intronic
929604697 2:43226651-43226673 CTGCGGCGGGGCGGGCGCGCCGG + Intergenic
929701844 2:44169103-44169125 CGGCGGCGGCGTGAGGGGCCGGG + Exonic
929701900 2:44169316-44169338 CGGCCGCGCCGCCGAGGCCCCGG + Intronic
929778829 2:44944497-44944519 GAGCGGCGGCGCGGGGGAGCCGG + Intronic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
929983188 2:46699489-46699511 GGACGACGGCGCGGGGGCCGGGG - Intronic
930011473 2:46941192-46941214 AGCTGGCGGCGCCGGGGCCCGGG + Exonic
930096398 2:47570116-47570138 AGGCGGAGGCGCGGGCGCGCTGG - Exonic
930096445 2:47570294-47570316 CTACGGCGGGGCGGGGGCCGGGG + Exonic
930700836 2:54456695-54456717 CGGGGGCGGCGCGGGGAGCCCGG + Intronic
931602594 2:64019214-64019236 CGGAGGCGGCGCTGCGGACCCGG - Intergenic
931649514 2:64454887-64454909 CGGTGGCGGGGCGCGCGCCCCGG - Intronic
931710881 2:64988806-64988828 CGGGCGCGGTGAGGGGGCCCGGG - Intronic
931728227 2:65130600-65130622 CGGGGGCGGGGAGGGGGCCGGGG + Intergenic
932591526 2:73070800-73070822 CCCCGGCGGCGCGGGGGCCCGGG + Intronic
933666715 2:84970837-84970859 CGGCGGCGGCGGCGGCGGCCAGG + Intergenic
933666852 2:84971265-84971287 CGGCGGCGGGGAGGCGGCGCGGG - Exonic
933751127 2:85602610-85602632 CGGCGGCGGCGGGGCGCTCCGGG - Intronic
933908291 2:86914936-86914958 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
934566972 2:95346589-95346611 CGGCGGCGGCGCGGCGGCGGGGG - Intronic
934763898 2:96869937-96869959 AGGCGGCGACGCGGGGGCAGGGG - Exonic
934882445 2:97995719-97995741 CGGCGGCGGCGCGGAAGCCGTGG + Exonic
934966826 2:98731007-98731029 CAGCGGCGGCGCGCGGGGGCGGG - Intronic
934993186 2:98935863-98935885 CGGGGTGGGCGCGGGGGCACCGG - Intronic
935149066 2:100417510-100417532 GGGCCGCGGCGCGGAGGCCTCGG - Exonic
935592567 2:104855630-104855652 CGGGGGCGGCGCAGGGGGCGGGG + Exonic
935971506 2:108534412-108534434 GGCCGGCCGCGCGGGGGCGCGGG - Intronic
936122660 2:109760352-109760374 CGGCGGCGGCGCAGGGCCGGGGG + Intergenic
936122669 2:109760369-109760391 CGGGGGCGGGGCCGGGGGCCAGG + Intergenic
936122693 2:109760421-109760443 CGGCGGCGGCGCAGGGCCGGGGG + Intergenic
936141786 2:109947592-109947614 CGACGGCGGGGCGGGCTCCCAGG - Intergenic
936178474 2:110245540-110245562 CGACGGCGGGGCGGGCTCCCAGG - Intergenic
936202904 2:110423892-110423914 CGACGGCGGGGCGGGCTCCCAGG + Exonic
936222000 2:110611052-110611074 CGGCGGCGGCGCAGGGCCGGGGG - Intergenic
936222024 2:110611104-110611126 CGGGGGCGGGGCCGGGGGCCAGG - Intergenic
936222033 2:110611121-110611143 CGGCGGCGGCGCAGGGCCGGGGG - Intergenic
936390776 2:112071301-112071323 TGGCGGCGGCGGGGGGGCGGGGG - Intronic
936433289 2:112482306-112482328 CGGCGGCTGCCCGGCGGCCCGGG + Exonic
937283876 2:120737626-120737648 GAGCGGCGGAGAGGGGGCCCGGG - Intronic
938018397 2:127885998-127886020 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
938368845 2:130756269-130756291 CGGCCGCGGCGCGCGGCGCCGGG + Exonic
938392411 2:130916238-130916260 AGGCGGGGACGCGGGGGCGCTGG - Intronic
938397857 2:130963974-130963996 GGGCGGCGGTGCGGCGGCCGCGG - Intronic
938451539 2:131425315-131425337 CGGCGGCGGCTCGGGGAGCGAGG - Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
938500187 2:131828301-131828323 CGGCACCAGCGCGGGGGCCCCGG + Intergenic
939612930 2:144332286-144332308 CGGCTGCGGCGCGGGGAGCCGGG - Intronic
939629651 2:144516884-144516906 CTGGGGCAGGGCGGGGGCCCAGG - Intronic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
939969661 2:148644965-148644987 CGGCGGCGGCGGGGCGGGCGGGG - Exonic
941816297 2:169799133-169799155 CGGCGGAGCCGAGGGGGCGCGGG + Intronic
941929898 2:170929161-170929183 CTGCGGCGTCGCAGCGGCCCGGG + Exonic
942043348 2:172085169-172085191 GGGCGGCGGCGCGGAGCCGCTGG + Intronic
942278053 2:174336793-174336815 CGGCGGCGGCGGAGGAGCCGAGG - Exonic
942314199 2:174682939-174682961 CGGCGGGGGGGCGGCGGCGCCGG - Intergenic
942446140 2:176080241-176080263 CGGCGGGGGCGCCGGGGCCGGGG - Exonic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
942454743 2:176130070-176130092 GGGCGGCGGCGCGCGGGGGCTGG + Exonic
942461674 2:176172416-176172438 CGGCGGAGGCGCAGGCGACCGGG + Exonic
943060497 2:183037946-183037968 CGGCGGAGGCGGGCGGGCCCGGG - Intronic
943645997 2:190408419-190408441 GGGCGGCGGCTCGGGGCGCCGGG - Exonic
943725335 2:191246101-191246123 CGGCGGGGGAGGAGGGGCCCGGG + Intronic
944221857 2:197310937-197310959 CGGGGGCAGCGCCGGGGGCCGGG - Intronic
944413476 2:199463086-199463108 CGGCCGCGGGCCGGGGGACCGGG + Intronic
944495920 2:200307035-200307057 CGGCGGAGGCTGGGCGGCCCGGG - Intronic
944582122 2:201140146-201140168 CGGCAGCGGCGGGGCGGGCCAGG + Intronic
944675853 2:202033890-202033912 CGGCGGCGGCGGCGGGCGCCAGG + Intergenic
944933630 2:204545548-204545570 CGGCGGCGGCGGCGGCGCACGGG - Intergenic
945241550 2:207681450-207681472 GGGCGGCGGCGGGGGCACCCGGG - Intergenic
945466006 2:210171292-210171314 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
946325289 2:218981771-218981793 CAGCGGTGGCGGCGGGGCCCGGG + Exonic
946340030 2:219060754-219060776 CGGCGGCGGCGGGGGGCGGCGGG + Intergenic
946692285 2:222319063-222319085 CGGCGGCGGCCCGAGGGCACGGG - Intergenic
946702141 2:222424574-222424596 CGGCGGCGGAGCGCGGCCCCGGG + Exonic
947418481 2:229921702-229921724 CGCCGGCGGCGGCGGGGCCGCGG - Intronic
947506631 2:230712928-230712950 AGGCGCCGGGGCGGGGGCACAGG + Exonic
947566720 2:231198816-231198838 CGGCGGCGGAGCGGGCGCGTCGG - Intronic
947800870 2:232928005-232928027 CGGCGGCGGGGCGGGTGCGGGGG + Intronic
947800881 2:232928034-232928056 CGGGGGCCACGCCGGGGCCCTGG + Intronic
947860559 2:233354678-233354700 AGCCCGCGGCGCGGCGGCCCGGG + Intronic
948046850 2:234951931-234951953 GGGCGGGGGCGCGGGGGGCGGGG - Intergenic
948116039 2:235494642-235494664 CGGCGGCGGCGGGGGGCGCGCGG + Exonic
948487206 2:238288582-238288604 CGCCGCCGGCGCGCGGGCCTCGG - Exonic
948801506 2:240435528-240435550 GGGGCGCGGCGCGGGGGCGCGGG - Intergenic
948801581 2:240435730-240435752 CGGCGGCGGCGCGGGGCGCGCGG - Exonic
948824678 2:240568498-240568520 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
948824696 2:240568535-240568557 CGGCGGCCGCGCCGGGCCGCGGG - Intronic
948824771 2:240568856-240568878 CGGCGGCGGCGGGGGCGCGACGG - Exonic
948865510 2:240772889-240772911 GGGAGGCCGGGCGGGGGCCCTGG - Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
948893096 2:240916476-240916498 CGCAGGGGGCGCGGGGGCGCGGG - Intergenic
948953752 2:241272230-241272252 TGGCGGCGGGGCGGGGGTCTGGG - Intronic
949004281 2:241636812-241636834 CGGCCGGGGCGCGGGGGAGCGGG - Intronic
949004332 2:241636908-241636930 GGGCGGGGGCGTGGCGGCCCGGG + Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168795882 20:610033-610055 CGGCGGCGGCGCGGGCCCCGTGG - Exonic
1168804443 20:664198-664220 CGGCGGGGACGCGGGGGGCTCGG - Exonic
1168804451 20:664215-664237 CGGCGGCGGGGCGGGGGCGGCGG - Exonic
1168855026 20:1002228-1002250 CGGCGGCGGCACGGCGGGCGCGG + Exonic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169065421 20:2692424-2692446 CGGCGGCGACGGGGAGGCCGCGG + Intergenic
1169065572 20:2692821-2692843 CGGCGGCGGCGGGATGGCCCGGG + Intergenic
1169065598 20:2692879-2692901 CGGCCGCGGCGGGGCGGCGCGGG + Exonic
1169214723 20:3786501-3786523 CGGCGGCGGCGCCGGGCCCCGGG - Exonic
1169483440 20:6006217-6006239 CGGCCGCGCCGCGGGGTCTCGGG - Exonic
1169483542 20:6006566-6006588 AGGCGGCGGCGGGCCGGCCCTGG + Intronic
1169486858 20:6041530-6041552 CGGTGGCGGTGCCGGTGCCCCGG - Exonic
1169867705 20:10218732-10218754 CGGGGGCGGGGGCGGGGCCCGGG - Intergenic
1170756800 20:19212477-19212499 CGGGGGCGGCGGGGGCGGCCGGG - Intergenic
1170756806 20:19212488-19212510 CGGCGGCGCGGCGGGGGCGGCGG - Intergenic
1171011497 20:21511849-21511871 CGGTGGCGGCGAGGAGGCCTCGG - Exonic
1171346529 20:24469904-24469926 CGGCGGCGGCGTGGCGCCCGCGG + Intronic
1172037298 20:32019100-32019122 TGGGGGCGCCGCGGAGGCCCGGG + Exonic
1172037339 20:32019244-32019266 CGGCGGCGGCGCGGGAAAGCCGG + Exonic
1172109411 20:32536521-32536543 CGGCGCAGGCGCGTGCGCCCCGG + Intronic
1172143915 20:32743278-32743300 CGGCGGCGGGGCGTGGGGCGCGG - Intronic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172474535 20:35226896-35226918 CGGCGGCGGCGGCGGGGGCAGGG + Exonic
1172618707 20:36306396-36306418 CGGAGCCGGGGCGGGGGCCGGGG + Exonic
1172684908 20:36746111-36746133 CGGCGGCGGCGAGAGGGGCGGGG + Intergenic
1173210744 20:41029480-41029502 GGCCGGCGGCTGGGGGGCCCCGG - Intronic
1173243437 20:41317620-41317642 CGGCGGCGACGCCGGAGCCGCGG + Intronic
1173548099 20:43914683-43914705 GGCCGGGGGCCCGGGGGCCCGGG - Intergenic
1173734190 20:45348075-45348097 CCGCGGCGGGGCTGAGGCCCGGG + Intronic
1173939067 20:46894760-46894782 ACGCAGCGGCGCGGGGACCCGGG + Exonic
1174357828 20:50010113-50010135 CGGCGGCGGCGAGGGGGCGGCGG + Intergenic
1174373937 20:50112998-50113020 CAGAGGCGGCGCGGGGACCCTGG + Intronic
1174380696 20:50153674-50153696 CGGCGGCGGCGGCAGGGCCGCGG + Exonic
1175108229 20:56629224-56629246 GGGGGCCGGCGCGGAGGCCCAGG - Intergenic
1175210482 20:57350923-57350945 GGGGGGCGGCGCGGGGGGGCGGG + Intergenic
1175399663 20:58693129-58693151 CGGCGGCGGCGGGGGTGCGGCGG - Intronic
1175415927 20:58800938-58800960 CTGAGCCGGCGTGGGGGCCCTGG - Intergenic
1175439646 20:58981547-58981569 CGGCCGCGCCGCGGGACCCCGGG - Intronic
1175470261 20:59222413-59222435 CGGCGGGGGCGGAGGGGGCCCGG - Intronic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175847240 20:62065375-62065397 CGGCGGCGGCGGCGGGCACCGGG + Exonic
1175902958 20:62367177-62367199 CAGCAGCGGCGCGGGGCCCCGGG + Exonic
1175911505 20:62407318-62407340 CGGCGGGCGCGCGGGCGCGCGGG - Intergenic
1176005667 20:62861211-62861233 CGGGGACGGAGCGAGGGCCCGGG - Exonic
1176029796 20:63006470-63006492 CGGCGGCGGCGGCGCGGGCCAGG - Exonic
1176128965 20:63488219-63488241 CGGGGGCGGGGCGGGGGCCCGGG + Exonic
1176131766 20:63499304-63499326 CGGGGGCGGGGCGGGGGGCAGGG + Exonic
1176148042 20:63574135-63574157 GGGCGGGGGCGCGGGGGTCCAGG - Intronic
1176148045 20:63574143-63574165 GGGCGGAGGGGCGGGGGCGCGGG - Intronic
1176178880 20:63740474-63740496 CGGGGGCGGCGGCGGGGCCCCGG + Exonic
1176194367 20:63830740-63830762 CGGCGGCGGCGGGAGGTGCCGGG + Intronic
1176194523 20:63831131-63831153 CGGCGCCGGCCCGGCGGCCGCGG - Intronic
1176221072 20:63969657-63969679 CGGCGCCGGCGCGGGGCGCGGGG + Intronic
1176234935 20:64049686-64049708 CGGCGGCGGGGCGGGCGGGCGGG + Intergenic
1176242082 20:64079884-64079906 CGGCGGCGGCGCGAGTGGCTCGG - Intronic
1176547284 21:8207443-8207465 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176548445 21:8211824-8211846 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1176548594 21:8212224-8212246 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176549031 21:8213617-8213639 CGGCGGCGGCGCCGCGTCCTCGG + Intergenic
1176549491 21:8214997-8215019 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176550024 21:8217030-8217052 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
1176555189 21:8251652-8251674 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176556337 21:8256030-8256052 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1176556488 21:8256432-8256454 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176557386 21:8259226-8259248 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176566235 21:8390490-8390512 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176567376 21:8394859-8394881 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1176567525 21:8395259-8395281 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176568416 21:8398031-8398053 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176574109 21:8434676-8434698 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176575276 21:8439072-8439094 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1176575427 21:8439474-8439496 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176576328 21:8442261-8442283 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176604713 21:8819767-8819789 CGGCTGCAGCTCGGGTGCCCAGG - Intergenic
1176679706 21:9812839-9812861 CGGCGTGGGAGCGGGGGCCGCGG + Intergenic
1176681412 21:9821298-9821320 CGGCGTGGGAGCGGGGGCCGCGG + Intergenic
1176681977 21:9824116-9824138 CGGCGTGGGAGCGGGGGCCGCGG + Intergenic
1177011048 21:15730334-15730356 CGGCGGAGGCGCGAGGAGCCGGG + Exonic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1178351165 21:31873728-31873750 CGGCGGCGGCGCGGAGGACGCGG + Exonic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178610059 21:34072912-34072934 GGGCCGCGGCGCGCGGGCTCGGG - Intergenic
1178865098 21:36320410-36320432 CGGGGGCTGCGGCGGGGCCCGGG + Intronic
1179150575 21:38805643-38805665 CGGAGGCGGCGAGGGAGCGCGGG - Intronic
1179495233 21:41767064-41767086 CGGCGGCTGCCCAGGTGCCCAGG + Exonic
1179561584 21:42219215-42219237 CGGCGGCGGCGGCGGGGACGAGG - Exonic
1179563966 21:42234920-42234942 CCGCGGCGGAGCGGCGGCGCGGG + Intronic
1180005464 21:45018715-45018737 CGGAGGCGGGGCGGGGCCCTGGG + Intergenic
1180211605 21:46298123-46298145 CGGCGGCCTCGCCGTGGCCCTGG - Intergenic
1180347003 22:11711372-11711394 CGGCTGCAGCTCGGGTGCCCAGG - Intergenic
1180354750 22:11829462-11829484 CGGCTGCAGCTCGGGTGCCCAGG - Intergenic
1180614905 22:17120695-17120717 CGGCGGGGGCGCCGCGGCCGGGG - Exonic
1180699716 22:17774558-17774580 CCGCGCCGGCGCGGGCTCCCCGG - Intronic
1180960686 22:19761043-19761065 CGGCGGCGGGCCCGGGGCGCCGG - Exonic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1180972915 22:19824923-19824945 CGAGGGCAGGGCGGGGGCCCAGG - Intronic
1181057849 22:20268302-20268324 CGGCGGCGGCGCGGGGGTTGGGG + Exonic
1181057857 22:20268325-20268347 CGTGGGCGGCGCGGCGGGCCGGG + Exonic
1181094431 22:20495852-20495874 AGCCGGCGGGGCGGGGGCCTGGG + Exonic
1181478028 22:23180582-23180604 CGGCGGCGGCACGGCGGCGGCGG + Exonic
1181650907 22:24258639-24258661 CGGCAGCTGCGGGGGAGCCCAGG - Intergenic
1181956405 22:26590281-26590303 GGGCGGCGGGGCGGGGTTCCCGG - Intronic
1182236998 22:28883791-28883813 CGGCGGCGGCCCGTGGCCCCTGG - Exonic
1182278623 22:29205816-29205838 CAGCGGCGGCGCAGGGGGCGGGG + Intergenic
1182335524 22:29581024-29581046 CGGCGGCTGCTGGGGGGCCCGGG - Exonic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1183444426 22:37843880-37843902 CGCGAGCGGCGCGGGGGCCCGGG - Intronic
1183444475 22:37844076-37844098 CGGCGGCGGCGCGGGCCTCTCGG - Exonic
1183702213 22:39457237-39457259 CGGCGGGCGCGCGGGGGGCGCGG - Intergenic
1183713652 22:39521050-39521072 CGGCGGCAGGGCGGCGGCGCGGG + Exonic
1183780297 22:39994998-39995020 CCGCGGCGGGGCCGGGGCCAGGG + Exonic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1183913085 22:41092919-41092941 TGGGTGCGGCGCGGGGACCCCGG + Exonic
1184034109 22:41910491-41910513 CGCGGGCCGCGCGGGGGCCCCGG + Exonic
1184035257 22:41915000-41915022 CGGAGGCCGCGCCGGGGCCGCGG + Intergenic
1184121351 22:42452617-42452639 GGCAGGCGGCGCTGGGGCCCGGG - Intergenic
1184347746 22:43923884-43923906 CGGCGGCGGGGCGGGGGCGCGGG - Exonic
1184465901 22:44668784-44668806 CGGCGGCGGCGCGGGGACCGAGG + Intronic
1184620424 22:45672248-45672270 CGGGGGCGGCGCCTGGGTCCAGG - Intronic
1184796852 22:46737939-46737961 CGGGGGCGGCTTGGGGGACCCGG - Intronic
1185020525 22:48372114-48372136 AGGCGGAGGCGCCGGGGACCTGG - Intergenic
1185028940 22:48431697-48431719 CGGTGGTGGGGTGGGGGCCCCGG - Intergenic
1185278861 22:49961386-49961408 CGGCGGCGGCGGCGGGGGGCGGG + Intronic
1185278863 22:49961392-49961414 CGGCGGCGGGGGGCGGGCGCGGG + Intronic
1185296702 22:50058288-50058310 CGGCGGCGGCCCCGGGGCGTGGG + Intergenic
1185315653 22:50178182-50178204 CAGGGGCGGGGCCGGGGCCCGGG - Exonic
1185315661 22:50178199-50178221 GGGCGGCGGGGCGGGGGCAGGGG - Exonic
1185335800 22:50270392-50270414 CGGCGGCGGCGGGCGGGGCGGGG + Exonic
1185381303 22:50508488-50508510 GGGCTGCGGGGCGGGGGCTCCGG + Intronic
1185397654 22:50600967-50600989 CGGCGGCGGGGCTGGGGCGGCGG - Intronic
1185409647 22:50674906-50674928 TCGCGGAGGCGCGGGGTCCCGGG + Intergenic
1203252157 22_KI270733v1_random:123728-123750 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203253327 22_KI270733v1_random:128127-128149 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1203253478 22_KI270733v1_random:128529-128551 CGTCGGCGGCGGCGCGGCCCCGG - Intergenic
1203254378 22_KI270733v1_random:131319-131341 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203254914 22_KI270733v1_random:133356-133378 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
1203260211 22_KI270733v1_random:168811-168833 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203261382 22_KI270733v1_random:173206-173228 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1203261532 22_KI270733v1_random:173607-173629 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203262434 22_KI270733v1_random:176398-176420 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203262970 22_KI270733v1_random:178435-178457 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
950487816 3:13283133-13283155 AGCAGGAGGCGCGGGGGCCCCGG - Intergenic
950534297 3:13570412-13570434 CTGCGGCCACGCTGGGGCCCAGG - Exonic
950902996 3:16513701-16513723 CGGCGGCGGCGGGGGCGCGTCGG - Exonic
951780194 3:26354464-26354486 GGGCGGCGGAGCGGGGGCGGGGG - Intergenic
951898382 3:27632892-27632914 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
951898386 3:27632909-27632931 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
951898390 3:27632926-27632948 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
951898394 3:27632943-27632965 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
952888343 3:38025130-38025152 CGGGGGCGGGGCCAGGGCCCAGG + Intronic
952889197 3:38029673-38029695 CGGGGGCGGGGCGGTGTCCCGGG - Intronic
952929293 3:38347052-38347074 GGGCAGGGGCGCGGGGGCCCCGG - Intronic
952942277 3:38454044-38454066 CGGCGGCGGGGCACGGGCCGGGG - Exonic
952942290 3:38454069-38454091 CCGGGGCGACGCGGGGGCCGGGG - Exonic
953167361 3:40477253-40477275 TGGCGGCGGCGCGGGCCCCTCGG - Exonic
953413274 3:42701941-42701963 CGTCGGCTGCTGGGGGGCCCAGG - Intronic
953680666 3:45035923-45035945 AGCCGGCGGGGCGGGGGCCGTGG + Exonic
953724765 3:45388446-45388468 GGGCGTCTGCGCGGCGGCCCGGG - Intergenic
954004218 3:47578866-47578888 CAGCGGCGGCGCGGGAGGCGGGG - Exonic
954025635 3:47781457-47781479 CGGCGGGGGCGTGGCGGGCCCGG + Intronic
954076833 3:48187913-48187935 CGGCGGCGGTGCGGGGGCTCCGG + Exonic
954152096 3:48662732-48662754 AGGCGGAGGGGCGGGGGCCCGGG - Exonic
954194914 3:48990679-48990701 CGGGGGCAGCGTGGGGACCCGGG - Intronic
954277962 3:49554674-49554696 CGGGGCCGGGGCCGGGGCCCGGG - Exonic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
954468871 3:50674949-50674971 CCGCGGCGGCGCCGGGAGCCGGG + Intergenic
954632793 3:52056289-52056311 CGGCGGCGGCTGGGGGCACCCGG - Exonic
954702002 3:52455481-52455503 CGGGGGCGGGGCGAGGGCGCAGG + Intronic
954763947 3:52897462-52897484 CGGGAGGGGCGCGAGGGCCCAGG + Exonic
954778995 3:53045741-53045763 CGGCGGCGGCGCCGGGGCGGGGG - Intronic
954795904 3:53161281-53161303 CGCCCGCCGCGCGGAGGCCCGGG + Exonic
955368743 3:58332966-58332988 CGGCGGCGGCCGGGCGTCCCGGG + Exonic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
955997027 3:64688045-64688067 GGGCGGAGGCGGGGGGGCCGCGG + Intergenic
956638317 3:71389235-71389257 CGGCGGGGGGGGGGGGGGCCGGG + Intronic
956659324 3:71583061-71583083 CGGGGCCGGTGCGGGGTCCCGGG - Intronic
956678146 3:71754082-71754104 CGGCGGCGAGGCGGCCGCCCTGG + Exonic
956813594 3:72888202-72888224 CGGCGGCGGCGGCGGCCCCCAGG - Exonic
960228504 3:115195987-115196009 CGGGGGCGGGGGGGGGGGCCAGG + Intergenic
960582743 3:119294678-119294700 CGGCCTCGGCACGGCGGCCCCGG + Exonic
961012908 3:123448119-123448141 CGGCGGCGGCTCGGCGGCGGCGG - Exonic
961013163 3:123449007-123449029 CGGCGGCGGCGAGGGCGGCTCGG + Exonic
961252690 3:125520196-125520218 CGGCGGCGGCGCAGGCGCACTGG - Exonic
961446293 3:126983224-126983246 CGGCGGCGGCGCGGGCGGCTGGG + Intergenic
961536683 3:127575147-127575169 CGGCAGCCACGCGGGGGCGCCGG + Intronic
961654295 3:128432961-128432983 GGGCGGCGGGGCTGGGGCGCGGG - Intergenic
961654317 3:128433019-128433041 CGGGGGCGGCACGCGAGCCCGGG - Intergenic
961743199 3:129046639-129046661 AGGAGGCGTCGCCGGGGCCCCGG + Intergenic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
961827476 3:129606588-129606610 CGGCGGCGGCCCGGGCGCTAAGG + Exonic
962277951 3:134030031-134030053 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
963827312 3:149970287-149970309 GGGCTGGGGCGCGCGGGCCCCGG - Intronic
963904451 3:150762651-150762673 CGGCGGCGGCGGGGCCGGCCCGG - Exonic
964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG + Intergenic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
966860809 3:184230137-184230159 TGGCGGCCGCGGGGGGCCCCGGG + Intronic
966866521 3:184261479-184261501 CGGCGGCGGTGGCGGGGACCGGG + Intronic
966911414 3:184562240-184562262 CGGCGGCGGCGGGCGGGCTCTGG - Exonic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
967685274 3:192409901-192409923 AGGCGGCGGCGCGGCGGCGGGGG - Intronic
967880358 3:194297256-194297278 CGTGGGCGCAGCGGGGGCCCGGG - Intergenic
967916725 3:194583908-194583930 CGGCGGCGGGGCGGGGCCGCGGG + Intergenic
967924189 3:194633389-194633411 CGGCGGCGGCGAAGGCGCCGGGG + Exonic
967930429 3:194686776-194686798 CGGCGGCGGCGGCGGAGCGCCGG - Exonic
968213333 3:196867781-196867803 GGGCGGGGGCGGGGCGGCCCCGG + Intergenic
968258176 3:197297952-197297974 CCGCGGGGGTGCGGCGGCCCAGG - Intronic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
968382281 4:107425-107447 CGGCCGGGGCGCCGGGGCCCTGG - Intergenic
968434107 4:576190-576212 CGGCGGCGGCGGCGCGGGCCCGG - Intergenic
968514806 4:1011585-1011607 CGGGGGCGGGTCGGGGGTCCGGG + Intronic
968514825 4:1011673-1011695 GGGCGGCGGGGCGAGGGGCCCGG - Intronic
968674980 4:1872045-1872067 CGGGGCCGGCGCCGGGGCCAGGG + Intronic
968698532 4:2043995-2044017 CGGGGGCGACGCAGGGGCTCTGG - Intergenic
968701287 4:2059361-2059383 CGGCGGCAGCTCAGGGGCGCGGG - Intergenic
968756407 4:2418420-2418442 CTGCGACAGCGCGGGGGCTCCGG - Exonic
968803194 4:2756303-2756325 CGGCGGCCGCGCGGCCTCCCGGG - Exonic
968820187 4:2844074-2844096 CGGCGGGGGCGCGGGGAACTGGG + Intronic
969113952 4:4859989-4860011 CCGCGGCGGCGCTGGGGGCCTGG - Exonic
969413339 4:7043423-7043445 CGGCGGCTGGGCTGGGGCCGCGG + Exonic
969524446 4:7697041-7697063 TGGCTGCTGCGCTGGGGCCCTGG - Intronic
969611909 4:8232204-8232226 GGGCGGCGGGGCGGGGGCACAGG + Intronic
970332793 4:15002880-15002902 CGGCGGCGGCGCGGGCAGCCCGG + Exonic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
970456349 4:16226990-16227012 CGGCCGCGGCGGCGGGGGCCCGG + Intronic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971457812 4:26860800-26860822 CGGCGGCGGCGCGGGAGCTGGGG + Intronic
971635136 4:29047790-29047812 GGGCGGCGGCTGGGGGGCTCAGG - Intergenic
972265337 4:37453998-37454020 CGGCGGCGGCGGCGGGGTCCCGG - Intronic
972396618 4:38663983-38664005 CGGAGGCGGCGCGGGAGGCGGGG + Intergenic
972543122 4:40056637-40056659 CCGCCTCGGCGCGGCGGCCCGGG - Intergenic
973373411 4:49271170-49271192 CGGCTGCAGCTCGGGTGCCCAGG + Intergenic
973613654 4:52659237-52659259 GGGCGGCAGCGCGGCGGCCTGGG + Exonic
973759068 4:54100581-54100603 CAGCGGGGGCGCAGGGGCCGGGG + Exonic
974385698 4:61200793-61200815 CGGCGGCGGCGCAGAGCCCGGGG + Intergenic
975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG + Intronic
975541294 4:75514599-75514621 CGGCAGCGGCGCGGAGACGCTGG + Exonic
975883645 4:78939529-78939551 TGGCGGCGGCCCGGGCTCCCGGG + Intergenic
976600710 4:86935283-86935305 CGGCGGCGGCGTCGGGGGCCGGG - Intronic
977257550 4:94757927-94757949 CGGCGGCGGCGGAGCGGCCGCGG + Intergenic
977257726 4:94758520-94758542 GCCCGGCGGGGCGGGGGCCCAGG + Intronic
977564532 4:98567802-98567824 TGGTGGCGGGGCGGGGGGCCTGG + Intronic
978351524 4:107825034-107825056 CGGCGGCCGCGGGAGGGACCCGG + Intronic
978384635 4:108167722-108167744 TGGCGGCGGCGGGGGGGACCCGG - Exonic
978954591 4:114598699-114598721 CGGCTGGGGGGCGGGGGGCCTGG + Exonic
979122924 4:116926276-116926298 GGGCGGCGGCGCGGGTGGCCTGG - Intergenic
979349264 4:119627300-119627322 GGGCGGCGGCGCGGAGGCCGGGG - Intronic
979455638 4:120922838-120922860 CTGCGGGGGCGCGGGGGGCGCGG + Exonic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
980075153 4:128287243-128287265 CGGCCGAGGCGCGGGGGTCCCGG + Intronic
981128440 4:141132818-141132840 CGGGGGCGGGGAGGGGGCCCCGG - Exonic
981491618 4:145346295-145346317 GGCGGGCGGCGCGGGGCCCCAGG + Intergenic
981920231 4:150078532-150078554 CGGGGGAGTCGCGCGGGCCCAGG - Intronic
982042371 4:151409038-151409060 CGGCGGCGGGGGCGGGGCCGGGG + Intergenic
982157212 4:152535268-152535290 CGGCGGGGCCGGGGGGGACCCGG - Exonic
982224408 4:153152969-153152991 CGGCGGCGTCGCTGGGGCTGAGG + Intronic
982573214 4:157076168-157076190 CGGCGGTGGCGCGGGCGGCTGGG + Exonic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745989 4:159104011-159104033 CGGCGGCGGCGCGGGGCCCGCGG - Intergenic
983061509 4:163166479-163166501 TGGCTGCGGCGCCGGGGTCCCGG + Exonic
984667997 4:182448829-182448851 CGGCGGCCGAGCCGGGGCGCTGG + Intronic
984668066 4:182449093-182449115 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
984823597 4:183905667-183905689 CGGCGGCGGCGCGGGGACCTTGG - Exonic
984928321 4:184825858-184825880 CCGCGGCGGTGCCCGGGCCCCGG - Intronic
985129097 4:186723881-186723903 CGGCGCCGGCGGGCGGGGCCGGG - Intronic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
985478374 5:92255-92277 CGGGGGCGGCCCAGGCGCCCGGG + Intergenic
985629855 5:1008750-1008772 CGGGGGCGCTGCGGGGGCCGCGG + Intergenic
986132225 5:4942345-4942367 CGGCGCCCGCGCGGCTGCCCAGG + Intergenic
986297091 5:6448745-6448767 CGGCGGCTGCGGCGGGGGCCGGG + Exonic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986330679 5:6714135-6714157 CGGCCGCGGCGGGGGCGGCCGGG + Intergenic
986330812 5:6714622-6714644 AGGGGGCGGCCCCGGGGCCCAGG + Exonic
986330816 5:6714633-6714655 GGGCCGCGGCGCCTGGGCCCCGG - Exonic
987374009 5:17217825-17217847 CCGCGGCGGCGCGGGGCCACCGG - Intronic
990308696 5:54518156-54518178 AGACGGCGGCCCGGGCGCCCCGG + Exonic
990557776 5:56952288-56952310 CGGGGGCGGCGAGGGGCGCCGGG - Intronic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991435921 5:66596871-66596893 CGGCGGGCGCCCGGGCGCCCAGG - Exonic
991676539 5:69094232-69094254 CGGCGGCGGCTCGTGAGCCCCGG + Exonic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
992067452 5:73120705-73120727 CGGCGCAGGCGCGCGGGCCGGGG - Intronic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
992078906 5:73216159-73216181 CGGCGGCGGCCAGGGCGGCCAGG + Intergenic
992530093 5:77645222-77645244 CGGGCGGGGGGCGGGGGCCCGGG - Intergenic
992530140 5:77645309-77645331 CGGCGGCGGCGCGGGCCGGCTGG - Intergenic
992663610 5:78984903-78984925 CGGGGGCGGCGCGGGCGGCGGGG + Intronic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
993900228 5:93579826-93579848 CGGCGGCGGCGAGAGAGCACCGG - Intergenic
994043615 5:95284655-95284677 CGCCAGCGCCGCGGGGACCCGGG - Intergenic
994107322 5:95961732-95961754 CGGCGGCGGCGGCGGCACCCCGG - Exonic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
996765336 5:127030283-127030305 CGGCGGCGGCGAGAGGGGACGGG - Intronic
996937352 5:128965005-128965027 ATTGGGCGGCGCGGGGGCCCTGG - Intronic
997265023 5:132490407-132490429 CGGAGCCCGCGCGGAGGCCCGGG + Intronic
997653055 5:135536178-135536200 CGGCGGCGTCGCGCGGCCCCGGG + Intergenic
997912431 5:137889324-137889346 CGGCTGCGCCGCAGGAGCCCGGG - Intronic
998157698 5:139795890-139795912 CGGCGGCGGCGGGGCGGGACAGG + Exonic
998364318 5:141618932-141618954 CGGCGTAGGCGCGGGGTCGCCGG - Exonic
998374522 5:141682074-141682096 CGCCGGCGCCGAGGGGGCCTGGG + Intronic
999268822 5:150284553-150284575 GGGCGGCTGCGCGGGGGCGGAGG + Intronic
999727015 5:154446016-154446038 GGGCGGCGGCCGGGCGGCCCAGG + Exonic
1000302948 5:159972304-159972326 CCGCGGCGGCCGGGGGGCTCAGG - Exonic
1001065090 5:168529624-168529646 CGGCGGCGGCCAGGGGGGCAAGG + Exonic
1001070293 5:168579527-168579549 GAGCGGCTGCGGGGGGGCCCCGG - Exonic
1001070306 5:168579562-168579584 TGGCGGCGGCTCCGGGGACCGGG - Exonic
1001395896 5:171419587-171419609 CGGCGAGGGGGCGGGGGGCCGGG - Intergenic
1001401976 5:171451221-171451243 CGGGGGAGGCGCCGGGGGCCGGG - Intronic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002006430 5:176238413-176238435 CGGCGGCGGGGCGGCGGCAGCGG - Exonic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002081214 5:176738535-176738557 CCGCGGCGGCGTGGAGACCCAGG - Intergenic
1002160721 5:177312526-177312548 CGGCGGAGGGGCGGCGGACCCGG + Intronic
1002186786 5:177458334-177458356 CGAGGGTGGCGTGGGGGCCCTGG + Exonic
1002190070 5:177473348-177473370 CGGCGGCGGGGCGGCGGGGCGGG + Intronic
1002190078 5:177473386-177473408 CGGCGGCGGCGCGGGGACAAAGG + Intronic
1002204690 5:177554360-177554382 CGGCGGGGGCTCGGGCGCCTGGG + Exonic
1002211152 5:177600131-177600153 CGGAGGCGCCGCGTAGGCCCGGG + Exonic
1002219954 5:177672259-177672281 GGCCGGCGGGGCGGTGGCCCGGG - Intergenic
1002415932 5:179121112-179121134 CGGAGGCGGCGGAGGGGCGCGGG - Intronic
1002591053 5:180291926-180291948 CGGCGGCGGAGCCGGGGCCGCGG - Exonic
1002621975 5:180494470-180494492 CGACGGCGGCGCGGAGGCGAAGG + Exonic
1002927181 6:1611329-1611351 CGGCGGCGGGGCGGAGGGCGCGG - Exonic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1002927311 6:1611795-1611817 CGGCGGCGGCGGGGGAGGCCAGG + Exonic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003112173 6:3259370-3259392 CGGGAGCTGCGCGCGGGCCCCGG + Intronic
1003139111 6:3456601-3456623 CGGAGGCTCCGCGGGCGCCCCGG + Intronic
1003178506 6:3771864-3771886 CCGCGGCGGGGCGGGGACTCAGG - Intergenic
1003325328 6:5086094-5086116 CGGCCGCGGCGCTCGGCCCCGGG - Exonic
1003552275 6:7109288-7109310 GGGAGGGGGCGCGGGGGGCCCGG - Intronic
1003942636 6:11044240-11044262 CGGCTGTGGCGCGGCGACCCGGG + Exonic
1004044686 6:12012442-12012464 CGGCGGCGGCGGCGGCGCCTGGG - Exonic
1004216780 6:13711248-13711270 CGGCGGGGGCGGCGGGGCCGCGG + Exonic
1004216784 6:13711257-13711279 CGGCGGGGCCGCGGTGGCCGGGG + Exonic
1004216935 6:13711763-13711785 CGGGGGCGACGCGGGAGCGCGGG + Intergenic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1004650249 6:17600885-17600907 GGGCGGCGGCGCCGCGGCCTGGG - Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1005826260 6:29633099-29633121 AGGAGGCGGCGCCGGGGACCAGG + Exonic
1005987705 6:30884633-30884655 CGGCGGCGGGGCGAGGGGCGGGG - Intronic
1006239500 6:32665104-32665126 CGGCGGCTGCGGGGGCGGCCGGG - Intronic
1006337429 6:33427981-33428003 TGGGGGCGGCGGCGGGGCCCGGG - Intronic
1006369186 6:33633753-33633775 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1006725502 6:36196795-36196817 CGGCGGCGGCGGCCGGGCCGGGG + Exonic
1006950811 6:37819889-37819911 CGGTGGCGGCGGCTGGGCCCGGG - Exonic
1007161098 6:39792433-39792455 CTGCGGGAGCGCGGGCGCCCTGG + Intronic
1007368219 6:41409216-41409238 AGGCGGCTGCGCGGGCGCCTCGG - Intergenic
1007371281 6:41428192-41428214 CGGAGGCGGCGCGGCGGCCACGG + Intergenic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1007752022 6:44076598-44076620 CGGCGGCGTGGCGGGGACTCTGG + Intergenic
1009975638 6:70667999-70668021 CGGCAGCGGGGCGGGGAGCCTGG - Exonic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1010703301 6:79077766-79077788 CGGCGGCGGGGCCGCGGCCCGGG - Intronic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1011194004 6:84763989-84764011 CGGCGGCGGCGCGGGCGAAAAGG - Exonic
1012400012 6:98835095-98835117 TGGCGGCGGCGGGGGGGGCGGGG + Exonic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1013099478 6:106974865-106974887 CGGCGGCGGCGGGGGCGCTGGGG - Intronic
1013230511 6:108157785-108157807 CGGCTGCGGCGGGGGCGGCCGGG - Intronic
1013273258 6:108561084-108561106 AGGCGGCGGCGGCGGCGCCCGGG + Exonic
1013273259 6:108561090-108561112 CGGCGGCGGCGCCCGGGAGCCGG + Exonic
1014001545 6:116370992-116371014 CGGCGGGGGCGCGGAGGGCTCGG + Exonic
1014098245 6:117482799-117482821 CGGCGGCGGCGCACTGGCGCGGG + Exonic
1014137628 6:117907493-117907515 CGGCGGCGGCACGGGCGCGAGGG + Intergenic
1015149273 6:130020000-130020022 CGGCGGCCGCGCCGGGGCGGCGG + Intronic
1015525882 6:134175242-134175264 CGGCGGGTGCGCGGCGGCCACGG + Intronic
1015773538 6:136792276-136792298 AGGCGGCGGCGCGGCGGCGAGGG - Exonic
1015965369 6:138692373-138692395 CTGGGTCGGCGCGGGGGCCGCGG - Intronic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1016378719 6:143450814-143450836 CGGCGGCTGCGCGGCGGCAGCGG + Intronic
1016386716 6:143536961-143536983 CGGCGGCGGGGCCGGAGCACCGG - Intronic
1016386757 6:143537070-143537092 CGCCGGCGGGGCGGGCGCCTCGG - Intronic
1016590216 6:145735505-145735527 CGGCGGCGGCGCGAATACCCGGG + Exonic
1016937253 6:149456612-149456634 GGGCGGCGGGGCGGGGGGCCGGG - Intronic
1016965846 6:149718036-149718058 CGGCGGCGGCGGCGGTGGCCTGG - Exonic
1017103089 6:150865711-150865733 CGGCGGCGGCGGGAAGGACCTGG - Exonic
1017103139 6:150865877-150865899 CGGAGGCGGCGCGGAGGGCCCGG - Exonic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1017954812 6:159169273-159169295 CGACGGGGGCGGCGGGGCCCGGG - Intergenic
1018420983 6:163640932-163640954 CAGCGGCGGAGAGGTGGCCCAGG + Intergenic
1018856468 6:167678762-167678784 CGGGGGCGGGGCGGGAGGCCGGG - Intergenic
1018876775 6:167827573-167827595 CCCCGGCGGCGCGGGGGGCGCGG + Intronic
1019111894 6:169723908-169723930 TGGCGGCGGCGGCCGGGCCCGGG - Exonic
1019111903 6:169723936-169723958 CGGCGGCGGCGCGGGGCGCTCGG - Exonic
1019282495 7:207539-207561 GGGAAGCGGGGCGGGGGCCCTGG - Intronic
1019379215 7:712440-712462 AGGCGGCTGCGCGGGGACGCGGG + Intronic
1019395726 7:816736-816758 AGGCGGGGGCCCGGGGGCCGGGG + Intronic
1019474369 7:1236823-1236845 CGGCGGGGGCGCGGGGCCGGCGG - Exonic
1019563189 7:1667842-1667864 CGGCGGCGGCGCCGGCGTCCGGG + Intergenic
1019662565 7:2232826-2232848 CGGCGGGGTCCCGGGGTCCCGGG - Intronic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019894856 7:3975860-3975882 CGGCAGTGGTGCGGGGGTCCTGG + Intronic
1019989551 7:4682247-4682269 CAGCGGCGGCGCGGGGGGCGGGG - Intergenic
1020085429 7:5307762-5307784 CTGCTGCTGCGTGGGGGCCCGGG - Exonic
1020105716 7:5421395-5421417 CGGCGGCGGGCCCGCGGCCCGGG + Exonic
1020204675 7:6105265-6105287 CGGCCGCGGCGGGCGGGCACCGG + Intronic
1020274296 7:6615504-6615526 CGGCGGCGGCGGCGGGGGCCGGG + Intergenic
1020274366 7:6615684-6615706 CGGGGGCGGGGCGGGCGCCGCGG - Exonic
1020275491 7:6622251-6622273 GGGCGGCGGAGCGGCGGTCCCGG + Exonic
1020278237 7:6637322-6637344 CGACGGCGGCGCGTGGGCACCGG - Exonic
1021451048 7:20784412-20784434 CGGCGGCGGCTCGGCGGGCTCGG - Exonic
1021828056 7:24573763-24573785 CGGCGGCGGCGCCGCGGTCGGGG + Intronic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1022396091 7:29989361-29989383 CGGCTGCGGTGCGGGAGCCCGGG + Intronic
1022396249 7:29989879-29989901 CGGCGGGGCCCCGGGGGCCGGGG - Intronic
1022427928 7:30285462-30285484 GGGCGGCGGCGGGGGCGCTCGGG + Exonic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023287105 7:38631398-38631420 TGGCGGCGGCGCGGAGGAGCGGG + Exonic
1023381169 7:39609834-39609856 CGGCGGTGGCTCGGCGTCCCAGG - Intronic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1023940377 7:44765503-44765525 AGGGGGCAGCGCCGGGGCCCAGG - Exonic
1024520938 7:50304009-50304031 CGGCGGCGAGGGGAGGGCCCGGG + Intergenic
1024579755 7:50792729-50792751 GGGCCGCGGCGCGCGCGCCCGGG - Intronic
1024579946 7:50793331-50793353 CGCCGGCGGCGCGGGGCGCCCGG - Intronic
1025106561 7:56175510-56175532 GCGCGGCGGCGCGGGGTCCTCGG + Intergenic
1025615714 7:63114444-63114466 CGGCGGCGGCGGCTGGTCCCTGG + Intergenic
1025739042 7:64182008-64182030 CGGCGGCGGCGCCTGGTCCGGGG - Intronic
1025762262 7:64405623-64405645 GGGAGGGGGCGAGGGGGCCCCGG - Intergenic
1025929405 7:65982188-65982210 CGGTGGCCGAGCGGGGGACCGGG - Exonic
1026822291 7:73557647-73557669 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1027374891 7:77538528-77538550 TGGCGGAGGCGGGGGGGCGCTGG - Intronic
1029098340 7:98106955-98106977 CGGCGGCGGCGCAGGCGGGCGGG + Exonic
1029123184 7:98281702-98281724 CGGCGGGGACGCGGCGGACCGGG - Exonic
1029123187 7:98281711-98281733 CGGCGGCGGCGGCGGGGACGCGG - Exonic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1029640400 7:101816394-101816416 CGGCGGCGGCGCGGGGCCCGGGG - Intronic
1029896490 7:103989702-103989724 TGGCGGCGGCGGGGGGGACGCGG - Intergenic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031361826 7:120857365-120857387 GGGCGGCGGGGCGGGGGCGGGGG + Intronic
1031629728 7:124032550-124032572 GGGCGGCGGGGCGGGGGTCGCGG - Exonic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032037547 7:128531439-128531461 CGGGTGCGGCGCGGAGGGCCGGG - Intergenic
1032068796 7:128791508-128791530 CGGAGCCGGCGCGGGAGCCGCGG + Intronic
1032074576 7:128830351-128830373 CGGCGGGGGGGCGGCGGTCCGGG + Intergenic
1032119319 7:129144962-129144984 CGGTGGCGGCGGCGGGGCCATGG + Exonic
1032344748 7:131107527-131107549 GGGGGACGGCGAGGGGGCCCCGG + Intergenic
1033159087 7:138981244-138981266 CGGCGTCGGCGCCGCGCCCCCGG + Exonic
1033173946 7:139108551-139108573 CGGAGACGGACCGGGGGCCCAGG + Intronic
1033253289 7:139778055-139778077 CGGGGGCGGGGCGCGGGGCCGGG + Intronic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1034147113 7:148883756-148883778 CGGCCGCGGCGGGAGCGCCCGGG - Intronic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034174750 7:149091267-149091289 CGCCGGGGGCGCGGAGGCCGTGG + Intergenic
1034222777 7:149459496-149459518 CGGGGGCGGCGGGGGAGGCCGGG - Intronic
1034222995 7:149460165-149460187 CGGCGGCGACTCCGGGGGCCCGG - Intronic
1034223033 7:149460281-149460303 CGACGGCCGCGCGCGAGCCCCGG - Intronic
1034251266 7:149692729-149692751 GGGCGGCGGCGGGAGCGCCCAGG - Intergenic
1034264130 7:149773126-149773148 CGCCCGCGCCGCGGGGACCCAGG + Exonic
1034414721 7:150958401-150958423 CGCGGGCGGCGCGGGCGCCCCGG - Exonic
1034455401 7:151167485-151167507 CGGGGGCGGCGGCGGGGGCCCGG - Exonic
1034461274 7:151199310-151199332 CGGCCGCGGGGCGGGGGTGCAGG - Intronic
1034463266 7:151210275-151210297 CGGCAGCAGCCCGGGGGCCGTGG - Intronic
1034469716 7:151248744-151248766 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1034469856 7:151249231-151249253 CGGCGGCGGTGGGTGTGCCCGGG + Intronic
1034470337 7:151251508-151251530 CGGCGCCAGTGTGGGGGCCCGGG + Intronic
1034522673 7:151632452-151632474 GGGCGGCAGCGCCTGGGCCCGGG + Intronic
1034578932 7:152025942-152025964 CGGCGGCGGCGCGCGGGGCCTGG + Intronic
1034951056 7:155297543-155297565 CGGCCGCGGAGCTGGGGCCTGGG - Intergenic
1034977926 7:155458710-155458732 AGGCGGCGGCGCGGGCGGCTCGG + Exonic
1035021896 7:155805214-155805236 CGGCGGCGGCCCCTGGGCCCAGG - Intronic
1035203302 7:157279864-157279886 TGGGGGCGGGGCGGGGGGCCCGG - Intergenic
1035266030 7:157690775-157690797 CAGCGGCTGCGCGGCGGCACGGG + Intronic
1035310057 7:157961901-157961923 CGGCGGCCGCACCGGGACCCGGG + Intronic
1036032706 8:4991669-4991691 GGGCGTCGGCGCTGGGCCCCGGG - Intronic
1036295122 8:7528911-7528933 CGGAGGTGGCGCGGGGGCCCTGG + Intergenic
1036327441 8:7792080-7792102 CGGAGGTGGCGCGGGGGCCCTGG - Intergenic
1036432327 8:8702376-8702398 CGCCGTCGGCGCGGCGGGCCGGG + Exonic
1036482417 8:9150793-9150815 AGGCGGCCGCGCGGGGGTGCTGG - Intronic
1036701574 8:11016670-11016692 CGGAGGCGGGGCCGGGGGCCTGG - Intronic
1036811117 8:11868160-11868182 CGCGGGCGGCGGGAGGGCCCGGG - Exonic
1037305146 8:17497025-17497047 CGGGGGCGGGGCGCGGGGCCGGG - Intergenic
1037529223 8:19757338-19757360 CGGCGGCGGCTCGGGCGGGCGGG + Intronic
1037928801 8:22865377-22865399 CGGTGGCGGCGGCGGGACCCCGG + Intronic
1038311659 8:26449831-26449853 CGGCGATGGCGCGGGGACCGGGG + Intronic
1038542496 8:28401850-28401872 CGGCGCCGGAGCCGCGGCCCCGG - Intronic
1038554118 8:28494548-28494570 GGGCTGCGGAGCGGGGGCCCGGG + Intronic
1038554191 8:28494780-28494802 CGGCGGCAGCGCGGGGTGCCGGG + Intronic
1038761260 8:30385211-30385233 GGCCGGCGGGGCGCGGGCCCGGG + Intronic
1038807977 8:30812445-30812467 CGGCGGCCGGGCTGGGGCTCGGG - Exonic
1038883509 8:31639666-31639688 CGGCGGCGGCGCGGGGGGTGGGG + Intronic
1038883593 8:31640035-31640057 GGGCGGCGGAGCCGGGGCGCTGG - Intronic
1039454603 8:37698407-37698429 CGGCGGCGGCGGCGCTGCCCAGG - Exonic
1039476563 8:37841953-37841975 CGGGGGCGCGGCGGGGGCGCTGG + Exonic
1039921468 8:41896797-41896819 CGGCGGCGAAGCGGGGGGGCGGG + Intergenic
1039936597 8:42051641-42051663 GGGCGGCGGCGCGCGGGCCGCGG + Intronic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1040471310 8:47737826-47737848 GGCGGGCGGCGCGGGGCCCCTGG - Exonic
1041355242 8:56993426-56993448 CGGCGGCGCGGCGGGGCCCGCGG - Exonic
1041673679 8:60517091-60517113 CGGCGGCGGCGGGCGGCGCCTGG + Exonic
1041689881 8:60678634-60678656 AGGTGGCGGCGCGCGGGCGCGGG + Intergenic
1041690149 8:60679627-60679649 CGGCGGCGGCTCGGGGACGGCGG + Intronic
1041690398 8:60680417-60680439 CGGCGGCGGCGGCGGCTCCCGGG + Intronic
1042155584 8:65841577-65841599 GGGCCGCGGCTCGGGGGCTCCGG + Exonic
1042155729 8:65842135-65842157 CTGCGGCGGCGCGGGGCGCTGGG - Intronic
1043148338 8:76682476-76682498 CGGCGCGGGCGCGGGCGCCGCGG + Intronic
1044343149 8:91070676-91070698 CGGCGGCGGCGCGGGGTAGGGGG - Intronic
1044698989 8:94949451-94949473 AATCGGCGGTGCGGGGGCCCCGG + Intronic
1045211661 8:100106009-100106031 CGGCGACGGCGCGCGGGCTCCGG + Exonic
1045582970 8:103499924-103499946 CGGCGGCGGCGCAGGGCGCGCGG + Intergenic
1048214269 8:132480880-132480902 CGGCGGCGGCGGCGGCACCCAGG + Exonic
1048968413 8:139630381-139630403 CGGCGGCGGCGGCAGAGCCCAGG - Intronic
1049165353 8:141122238-141122260 CGGCGGTGGGGAGGGGGCCGGGG - Intronic
1049177904 8:141205723-141205745 TGACGGCGGCGCAGGGGCCAGGG - Intergenic
1049411433 8:142475577-142475599 CGGCGGCTGCGAGGGGGTGCTGG + Exonic
1049419584 8:142510862-142510884 CGGCGGGGACGCGGGCGCCCCGG - Intronic
1049532021 8:143159663-143159685 TGGGGGCGGCGCGGGGGCTTGGG + Exonic
1049532249 8:143160357-143160379 CGGGGGCCGCGCGGGGGGCGGGG + Intronic
1049552628 8:143267503-143267525 CGGCGGCGGCTCCGGGTGCCTGG + Intronic
1049585278 8:143430102-143430124 GGGCCGCCGAGCGGGGGCCCCGG - Exonic
1049585408 8:143430506-143430528 CGGCGGGGGCGGGGGGGCGCCGG + Intergenic
1049620879 8:143597882-143597904 TGGCTGCGGCGGGGGGGACCCGG - Exonic
1049694535 8:143976907-143976929 GAGCGGCGGGGCTGGGGCCCGGG + Intergenic
1049756582 8:144313691-144313713 GGGCGGCGGCGCGGGGAGGCGGG - Intronic
1049762756 8:144338387-144338409 CGGCCGCGCCGCGCGGGTCCTGG + Intergenic
1049766637 8:144358210-144358232 TGGCCGCGGCGCTGGGGCCCCGG + Exonic
1049784734 8:144444795-144444817 CGGCGGGGACGCGGGAGGCCGGG + Intergenic
1049844288 8:144792537-144792559 GTGCGCCTGCGCGGGGGCCCTGG - Exonic
1050357063 9:4793250-4793272 CGGCGTGGGCGCGGGGGCTGAGG + Intronic
1051079695 9:13279668-13279690 CGGAGGCGGTGGCGGGGCCCAGG + Intergenic
1052362152 9:27573197-27573219 CGGCGGCGGCGCAGGGACAAGGG - Intronic
1052888939 9:33677382-33677404 CGGCGGCGGCGGCGGCGGCCCGG - Intergenic
1053034106 9:34810004-34810026 CGGCGGCGGCGCGTGGGCGGCGG - Intergenic
1053070208 9:35096585-35096607 CGGCGGCGGCGCCTGCGACCTGG + Intronic
1053166337 9:35846425-35846447 CGGGGGTGGCCCGGGGCCCCAGG + Intronic
1053240029 9:36487696-36487718 CGGCGGCGGCGGAGGGGGCGGGG + Intergenic
1054440861 9:65258899-65258921 CGGCGGCGGCGGGGGGGGGTGGG + Intergenic
1054489416 9:65762588-65762610 CGGCGGCGGCGGGGGGGGGGTGG - Intergenic
1054798627 9:69325384-69325406 CGGCGGCGGCAGCGGCGCCCGGG - Intronic
1055266313 9:74498826-74498848 CGGCGGCGGCGGCGGGACCCCGG + Intronic
1055611774 9:78031576-78031598 CGGCGGCGGCTCGGGGGGCGAGG - Intergenic
1056243261 9:84669844-84669866 CGCCGGCGGCGCCTGGGTCCAGG - Exonic
1056799540 9:89681489-89681511 CGGTGGCGGGGCGGGGGCAGCGG - Intergenic
1057208077 9:93184980-93185002 CGGGCGCGGCGCGGGGCCCGCGG + Exonic
1057259664 9:93576666-93576688 CGGCGGGGGCGGCGGGGCGCAGG - Exonic
1057432227 9:95004935-95004957 GGGCGGCGGCGCGGGCGGGCGGG - Intronic
1057488649 9:95506150-95506172 CGGGGGCGGGACGGGGGCGCGGG - Intronic
1057619104 9:96619418-96619440 CGGCGGGCGCGCGGGCGCGCGGG - Exonic
1057801245 9:98192637-98192659 CGGCGGCGGCTCTGGGCGCCGGG - Intronic
1057869712 9:98708696-98708718 CGGCGGCGGCCCGGGCTGCCCGG + Exonic
1057922066 9:99105407-99105429 AGGTGGCGGCGCCGGGGCCCGGG + Intronic
1058053284 9:100427242-100427264 CGGCGGCGGCGGCGCGCCCCCGG - Intronic
1058053328 9:100427368-100427390 CAGCGGCGGCGCGGCAGCCGCGG - Intronic
1058058463 9:100472974-100472996 GGGCAGGGGCGCGGGGGCCGGGG - Intronic
1058413845 9:104764399-104764421 CGGCGGCGGCGCGGGGCCCCAGG - Intronic
1059102441 9:111483668-111483690 CGGCGGCGGCGGGCGGGCCTCGG - Intronic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1059769796 9:117414665-117414687 CGGCGCCCGCGCCGGGGCCGGGG - Exonic
1060209082 9:121699423-121699445 CGGCGGCGGCGGCGGCGCTCCGG - Exonic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1060527761 9:124330071-124330093 CAGAGGCGGGGAGGGGGCCCAGG - Intronic
1060555319 9:124504839-124504861 GGCTGGCGGCGCGGGGGCCTCGG + Intronic
1060849196 9:126860686-126860708 CGGCGGCGGAGGGGGCGCCGCGG + Intronic
1061095834 9:128456404-128456426 GGTGGGCGGGGCGGGGGCCCAGG - Exonic
1061299661 9:129697386-129697408 CGGCGGCGGCGCGGGCAGCGCGG + Intronic
1061415571 9:130445220-130445242 CGGCGGGGGCGCGAGTCCCCGGG + Intronic
1061541048 9:131277949-131277971 CGGCGGCGGCGAGCGGACGCGGG - Intergenic
1061714112 9:132508202-132508224 AGTCGGCGGCGCGGGGGGCGGGG - Intronic
1061725557 9:132580401-132580423 AGGCGGGAGGGCGGGGGCCCAGG - Intergenic
1061961673 9:133991971-133991993 CGGCGGCGGCCCAGGCGCCCTGG - Intronic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1061975853 9:134067797-134067819 CGGCGGCGGCCCCGGGCGCCCGG + Intronic
1062022423 9:134325935-134325957 CGGTGGCCGCGAGGGGACCCCGG - Intronic
1062162474 9:135087840-135087862 CGGCGGCGGCGGGCGGGCGGCGG + Exonic
1062272233 9:135714807-135714829 CGGCGGCTGCGGGGGCGCGCGGG - Intronic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1062347001 9:136119446-136119468 GGGCGGCGGGGGGGCGGCCCTGG - Intergenic
1062421072 9:136483052-136483074 CGTCGGCGGCGCGGCGGCCGCGG - Intronic
1062421411 9:136484237-136484259 CGTCGGTGGCGAGTGGGCCCGGG + Exonic
1062472442 9:136712454-136712476 CGGCGGAGGCGCGCGGGGGCGGG - Intergenic
1062491869 9:136808602-136808624 CGGCGGCGGCGGGGTTGGCCCGG + Intronic
1062491891 9:136808672-136808694 CGTCGGGGGCGCGGCGCCCCGGG - Intronic
1062499521 9:136846276-136846298 CGGCGCCAGCGCGGGGGCCCCGG - Exonic
1062527594 9:136984584-136984606 GGGCTGTGGCGTGGGGGCCCTGG + Intronic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062574569 9:137200226-137200248 CGGCGGCGGCGGCGGGGGGCGGG + Exonic
1062574663 9:137200591-137200613 GGGCGGGGGCGCGGGGCCCGGGG - Exonic
1062621248 9:137423445-137423467 AGGCGGCGGCGCGGGGCTGCGGG - Exonic
1062656340 9:137605976-137605998 CGGCGGCGCCGGGGAGGTCCGGG + Intronic
1062659094 9:137619068-137619090 GGGGGGCGGCGCGGGGGCGGCGG + Intronic
1062659124 9:137619146-137619168 CGGCGGGCGGGCGGGGCCCCGGG + Intronic
1062659126 9:137619163-137619185 CGGCGGCGGCGGGGGGACCCGGG - Intronic
1062659193 9:137619350-137619372 CGGCGGCGGCACGGGGTCCGTGG - Intronic
1062696335 9:137877978-137878000 CGGCGGCGGAGAGCGGGCCCGGG + Exonic
1062696352 9:137878008-137878030 GGCCGGCGGGGCGGGGGGCCCGG + Exonic
1203697120 Un_GL000214v1:109173-109195 CGGCTGCAGCTCGGGTGCCCAGG + Intergenic
1203468560 Un_GL000220v1:106878-106900 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203469727 Un_GL000220v1:111274-111296 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1203469878 Un_GL000220v1:111676-111698 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203470779 Un_GL000220v1:114463-114485 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203476381 Un_GL000220v1:150850-150872 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203477548 Un_GL000220v1:155246-155268 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1203477699 Un_GL000220v1:155648-155670 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203478600 Un_GL000220v1:158435-158457 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203552092 Un_KI270743v1:171856-171878 CGGCTGCAGCTCGGGTGCCCAGG - Intergenic
1203664874 Un_KI270754v1:15374-15396 CGGCGTGGGAGCGGGGGCCGCGG + Intergenic
1203665719 Un_KI270754v1:19600-19622 CGGCGTGGGAGCGGGGGCCGCGG + Intergenic
1203666868 Un_KI270754v1:25238-25260 CGGCGTGGGAGCGGGGGCCGCGG + Intergenic
1203668017 Un_KI270754v1:30877-30899 CGGCGTGGGAGCGGGGGCCGCGG + Intergenic
1185432916 X:19794-19816 CGGCGGAGGCTCGCGGCCCCTGG + Intergenic
1185442268 X:232616-232638 CGGCGGAGGCTCGCGGCCCCTGG + Intergenic
1185621484 X:1453405-1453427 CGGGGGCGGGGACGGGGCCCGGG - Intronic
1185747463 X:2584180-2584202 CGGGGGGCGCGCGGGGGCGCGGG + Intergenic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186350079 X:8731769-8731791 CGGCCGCGGCGTGGGCGCACCGG - Intronic
1186426087 X:9465193-9465215 CGGCGGCGGGGCGGGGGCGCTGG - Exonic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1186496379 X:10015322-10015344 CGGCGGCGGCGGCGGCTCCCGGG + Intergenic
1187281291 X:17860477-17860499 CGTCGGCGCCCCGGGAGCCCCGG - Intronic
1187281613 X:17861473-17861495 CGTGGGCGGCGCGGGGTGCCAGG + Intergenic
1187419544 X:19122528-19122550 CGGGGGCGGCGCCGAGGCCGCGG - Exonic
1187464364 X:19514825-19514847 AGGGGGCGGGGCGGGTGCCCTGG + Intronic
1187518140 X:19990912-19990934 CGGCGGCGGCGGGGGCTTCCCGG - Intergenic
1188004079 X:25005479-25005501 CCGCGGCGGCGCGGGTGGCCCGG - Intronic
1189325738 X:40109635-40109657 CTGGGGAGGCGCGGGGGCTCCGG - Intronic
1189331444 X:40146965-40146987 GGCCGGCGGCGTGCGGGCCCGGG + Intronic
1189474017 X:41334986-41335008 CGGCTGCGGCGCAGGGCCCCCGG - Intronic
1189534519 X:41923183-41923205 GGGCGGCGGGGCCGGGGCGCGGG + Intronic
1189821585 X:44873797-44873819 CGGCGGCGGGGCGGGCACCTCGG + Intronic
1190041816 X:47078248-47078270 CGGGGACGGGGCGGGGTCCCAGG + Intergenic
1190214002 X:48468337-48468359 AGGGGGTGGCGCGGGGGACCGGG - Intronic
1190279289 X:48918775-48918797 TGGCGGCGGCGTGGGGGTCCCGG + Exonic
1190385625 X:49879948-49879970 CGGGGCCGGGGCGGGGGCCGGGG - Exonic
1191719882 X:64220475-64220497 CGGCGGGAGGGCGGGGACCCAGG + Intergenic
1195716842 X:107826307-107826329 CGGCGGCGGCGACCGGGGCCCGG + Exonic
1196001985 X:110795955-110795977 AGGCGCGGGCGCGGCGGCCCGGG + Intergenic
1196393450 X:115233903-115233925 CGGCGGCGGCGGCGGGACCCTGG - Exonic
1197415263 X:126165963-126165985 CGGCGGCGGCGGCGGCGGCCCGG + Intergenic
1197415266 X:126165972-126165994 CGGCGGCGGCCCGGCGGCGGTGG + Intergenic
1197754432 X:129984096-129984118 CGGCGGCGGGGCGGGCGGGCGGG + Intronic
1198767098 X:140091354-140091376 CGGCGGCGGCTGGGAGGCCGCGG + Intergenic
1199500383 X:148500722-148500744 CAGCGGCGGCGGGGGCGGCCGGG - Exonic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic
1200092934 X:153644260-153644282 CGGCGGAGGCCCGGGGCGCCCGG + Intronic
1200129008 X:153830926-153830948 CGGCGGCGGGGGAGGGGCGCGGG + Intergenic
1200292617 X:154886836-154886858 CGGCGGCGGCCGGCTGGCCCAGG - Exonic
1200339461 X:155382576-155382598 CGGCGGCGGCCGGCTGGCCCAGG - Exonic
1200347009 X:155458117-155458139 CGGCGGCGGCCGGCTGGCCCAGG + Exonic
1201153371 Y:11107429-11107451 CGGCTGCAGCTCGGGTGCCCAGG - Intergenic