ID: 1070802500

View in Genome Browser
Species Human (GRCh38)
Location 10:79251823-79251845
Sequence ATGGCTTCTGTCCGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070802500_1070802505 -6 Left 1070802500 10:79251823-79251845 CCTGGAAAACGGACAGAAGCCAT 0: 1
1: 0
2: 1
3: 25
4: 277
Right 1070802505 10:79251840-79251862 AGCCATTGTCCCAGGGGGTCAGG No data
1070802500_1070802506 -5 Left 1070802500 10:79251823-79251845 CCTGGAAAACGGACAGAAGCCAT 0: 1
1: 0
2: 1
3: 25
4: 277
Right 1070802506 10:79251841-79251863 GCCATTGTCCCAGGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070802500 Original CRISPR ATGGCTTCTGTCCGTTTTCC AGG (reversed) Intronic
901014321 1:6219254-6219276 ATGTCTTCTCTCTCTTTTCCGGG - Exonic
903956352 1:27028811-27028833 ATGGCTTATGTCTGTAATCCCGG - Intergenic
906232254 1:44173804-44173826 ATGGCCTTTATCAGTTTTCCAGG - Intergenic
909232650 1:73110310-73110332 ATGTCATCTGTCCCTTTACCGGG + Intergenic
911530682 1:99039703-99039725 CTGGCTTCTGCCCGCTTTCCAGG - Intergenic
912076747 1:105884666-105884688 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
912150500 1:106853413-106853435 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
914967145 1:152270127-152270149 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
914969222 1:152291990-152292012 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
916625615 1:166552397-166552419 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
916878742 1:168998549-168998571 CTGGCTTCAGCCCGCTTTCCAGG + Intergenic
918684380 1:187396977-187396999 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
919146796 1:193645376-193645398 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
921346608 1:214192492-214192514 ATGGTTTCTTTTCTTTTTCCTGG + Intergenic
921676583 1:217982913-217982935 ATGACTGCTGTGCGGTTTCCCGG - Intergenic
921842781 1:219846405-219846427 ATGAATTCTTTCAGTTTTCCTGG - Intronic
922066191 1:222145936-222145958 ATGGCTTCTGCCCCCTTTCCAGG - Intergenic
922599429 1:226838418-226838440 ATTGCTTCTGTCGGTTTCCCGGG - Intergenic
923789946 1:237103535-237103557 TTGGTTTCTGCCCATTTTCCAGG + Intronic
924829031 1:247573148-247573170 CTGGCTTCAGCCCCTTTTCCAGG + Intronic
1065776004 10:29120961-29120983 AGGGCTTCTGTCCCTTTGGCTGG - Intergenic
1067162186 10:43836534-43836556 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
1067234189 10:44434733-44434755 GTGGATTCTCTCCGCTTTCCGGG + Intergenic
1070802500 10:79251823-79251845 ATGGCTTCTGTCCGTTTTCCAGG - Intronic
1071789375 10:88938242-88938264 ATGGCCTGTGTCTCTTTTCCAGG - Exonic
1072375710 10:94813763-94813785 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
1072389586 10:94969415-94969437 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
1072404386 10:95136345-95136367 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1073547940 10:104368527-104368549 ACGCCTTCTGTTGGTTTTCCTGG - Exonic
1073916060 10:108404633-108404655 ATTGTTTCTGTCCCTTCTCCAGG - Intergenic
1074795530 10:116939143-116939165 CTGGCTTCTGCCCCCTTTCCAGG + Intronic
1076202452 10:128569323-128569345 ATGGCTGCTGTCGTTTTTGCTGG + Intergenic
1079120817 11:17683627-17683649 ATGGCTTCAGACCTGTTTCCTGG - Intergenic
1079425747 11:20340815-20340837 CTGGCTTTTGTCAGTTTCCCTGG - Intergenic
1079544415 11:21615196-21615218 CTGGCTTCTGTCCATTATTCAGG + Intergenic
1081094979 11:38921294-38921316 CTGGCTTCAGCCCATTTTCCAGG + Intergenic
1081118264 11:39232242-39232264 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1083499157 11:63087589-63087611 ATGGCCTCAGCCCCTTTTCCAGG - Intronic
1083544170 11:63536869-63536891 ATGGCTTCGGTAAGTTTCCCAGG + Exonic
1084064715 11:66697206-66697228 ATGACTTCTGTCCCTTCTCATGG + Intronic
1086297556 11:85387923-85387945 GTGGATTCTCTCAGTTTTCCTGG - Intronic
1086952429 11:92904946-92904968 AGGACTTCTGTCCCTTTACCTGG + Intergenic
1088702527 11:112426220-112426242 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1091317988 11:134629161-134629183 CTGGGCTCTGTCCGTTTGCCAGG - Intergenic
1092304018 12:7281036-7281058 ATGGCCTATGTCGGTTTTCCAGG - Intergenic
1093584919 12:20823122-20823144 ATGGCCTATATCAGTTTTCCAGG - Intronic
1094757836 12:33492732-33492754 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1095646978 12:44558837-44558859 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1095778855 12:46037043-46037065 CTGGCTTCAGTCCCTTTTTCAGG - Intergenic
1097412107 12:59268069-59268091 TTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1099238948 12:80116027-80116049 CTGGCTTCTGCCCCCTTTCCAGG + Intergenic
1099798032 12:87422634-87422656 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1106234690 13:27851962-27851984 ATTGCTTCTGCCCGTCTGCCAGG - Intergenic
1106355950 13:28983338-28983360 ATGGCTTCTGGCCACTGTCCTGG - Intronic
1107314846 13:39119972-39119994 CTGGCTTCTGCCCCCTTTCCGGG + Intergenic
1109374747 13:61477477-61477499 TTGGTTTCAGTCTGTTTTCCGGG - Intergenic
1110142755 13:72150980-72151002 ATGGAGTCTGTCAGCTTTCCCGG + Intergenic
1111056061 13:82952763-82952785 ATGGCTTCAGGCCCCTTTCCAGG - Intergenic
1111114191 13:83754592-83754614 CTGGCTTCAGTCCCGTTTCCGGG - Intergenic
1111195249 13:84867911-84867933 ACGGCTTATATCAGTTTTCCAGG - Intergenic
1111419301 13:87990195-87990217 ATGGCCTATATCAGTTTTCCAGG + Intergenic
1111627931 13:90813356-90813378 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1111635053 13:90892849-90892871 CTGGCTTCAGCTCGTTTTCCAGG - Intergenic
1112031129 13:95457744-95457766 ATGGTTTCTGCCCTTTTTCTAGG + Intronic
1113131580 13:107042910-107042932 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1113518531 13:110921472-110921494 ATGGCTTCTGCCGATATTCCTGG + Intergenic
1113709291 13:112453256-112453278 GGGGCTTCTCTCCGTTTTCTCGG - Intergenic
1116013363 14:39377258-39377280 ATGGCCTTTGTCAGTTTTCCAGG - Intronic
1117740188 14:58810547-58810569 ATGGCTTCTGTCAGTTCACAGGG - Intergenic
1117850091 14:59958602-59958624 CTGGCTTCAGTCCGCTTTGCAGG + Intronic
1118163827 14:63316746-63316768 ATGGCGTCTGCCTGCTTTCCTGG - Intronic
1119463710 14:74835112-74835134 ATGGCTTTTCCCAGTTTTCCTGG + Intronic
1119992252 14:79212149-79212171 AGGGGCTCTGTCTGTTTTCCTGG - Intronic
1120663590 14:87279424-87279446 TTGATTTCTGTCCATTTTCCAGG - Intergenic
1121026726 14:90621450-90621472 ATGGCTTCTGCCACTTGTCCCGG - Intronic
1122800020 14:104224806-104224828 GTGGCTTCAGCCCATTTTCCAGG + Intergenic
1125322803 15:38506795-38506817 ATGGCTTATGTACATTTTTCTGG + Intronic
1125690142 15:41589454-41589476 ATAGCTATTGTCCGTGTTCCCGG + Intergenic
1126500570 15:49340094-49340116 CTGGCTTCTGCCCCCTTTCCAGG + Intronic
1127677277 15:61253156-61253178 ATTTCTTCTGTCCCTTTTCATGG + Intergenic
1128857540 15:71031971-71031993 CTGGCTTCAGACCGCTTTCCAGG + Intronic
1130659590 15:85820185-85820207 AGGGCTGCTGTCCATTATCCTGG + Intergenic
1130850769 15:87791566-87791588 ATGGCTGCTGTGTGTTTTCAGGG - Intergenic
1133947164 16:10358240-10358262 AAAGATTCTGTCCTTTTTCCTGG + Intronic
1137970009 16:52975545-52975567 CTGGCTTCTGCCCCATTTCCAGG + Intergenic
1138891135 16:61145442-61145464 ATGGCTTCTATCCATGTACCAGG + Intergenic
1139215302 16:65121320-65121342 CTGGGGTCTTTCCGTTTTCCCGG + Intronic
1140932759 16:79642931-79642953 ATTGCCTCTGTCCATTCTCCTGG + Intergenic
1140964573 16:79952566-79952588 ATGGCTTCTGTCCACATCCCAGG + Intergenic
1141997222 16:87643269-87643291 ATGGCGTCTGTCCATTTACCAGG + Intronic
1144276865 17:13678531-13678553 CTGGCTTCTGTCCCTTTCCTTGG + Intergenic
1145890590 17:28412455-28412477 ATGTCTTCTCTCTGTTGTCCTGG - Intergenic
1150722680 17:67626897-67626919 ATGCCTTCTGTTAGTTCTCCAGG + Intronic
1153059401 18:980072-980094 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1153210585 18:2759239-2759261 TTTGCTTCTGTCCGTTGTCTGGG + Intronic
1153251490 18:3126732-3126754 TTGGCTTCTCTCCATTTTCCTGG + Exonic
1153702592 18:7711495-7711517 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1153769684 18:8405377-8405399 CTGGCTTCTGCCTGTTGTCCTGG - Intronic
1154135507 18:11774288-11774310 CTGCCTTCTGTCAGTTTTCAAGG + Intronic
1154168436 18:12033605-12033627 GTGGCTTGTGTCCTTTTCCCAGG - Intergenic
1154800082 18:19106234-19106256 AATGCTTCTGTCCGTTTTTATGG - Intergenic
1154821163 18:19396084-19396106 AATGCTTCTGTCCGTTTTTATGG - Intergenic
1155831329 18:30518069-30518091 ATGGCTTCTCTCCTTTCTACTGG + Intergenic
1156020765 18:32597318-32597340 GTGAATTCTTTCCGTTTTCCTGG - Intergenic
1157069606 18:44390662-44390684 ATGCCTGCTGACCCTTTTCCAGG - Intergenic
1157671748 18:49535934-49535956 ATGGCCTGTATCAGTTTTCCGGG + Intergenic
1158276554 18:55774833-55774855 ATGGTTGTTGTTCGTTTTCCAGG + Intergenic
1158919254 18:62171553-62171575 ATGAATGCTGTCAGTTTTCCAGG + Intronic
1159259861 18:65999958-65999980 ATGTCTTCTGTCTTCTTTCCAGG - Intergenic
1159690613 18:71482986-71483008 CTGGCTTCAGCCCGTTTTCCAGG + Intergenic
1160446139 18:78928223-78928245 AAGGCCTCTGTCCGTGTTCCAGG + Intergenic
1161023559 19:2023728-2023750 CTGGCTTCTCTCTGTTTTCATGG - Intronic
1161544679 19:4873120-4873142 AGGGTTTCTGTCCGTTGGCCAGG - Intergenic
1162405559 19:10471077-10471099 ATGGTCTCTCTCTGTTTTCCAGG + Intergenic
1164353337 19:27382455-27382477 AAGGCTTCTGTCTAGTTTCCAGG - Intergenic
1165254611 19:34568193-34568215 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
925484528 2:4313321-4313343 CTGGCTTCAGTCTCTTTTCCAGG + Intergenic
928308249 2:30189177-30189199 ATGGCTTCTGACTGTTCTCATGG - Intergenic
929010354 2:37436242-37436264 ATGGCTTTTGACCTTTTTACTGG + Intergenic
930452086 2:51554695-51554717 TTGGCTTCAGTCTGTTTTCTAGG - Intergenic
930831114 2:55744206-55744228 TTGGCTTCTTTACATTTTCCTGG + Intergenic
931212110 2:60207308-60207330 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
933317857 2:80736863-80736885 TTGGCTTCAGTCCCCTTTCCAGG - Intergenic
933434147 2:82223913-82223935 ATTGCTTATGTCCGCTCTCCTGG - Intergenic
934737673 2:96698209-96698231 AGGGCTTTTATTCGTTTTCCAGG - Intergenic
934983013 2:98862302-98862324 TTAGCTTCTGTCCTTTTCCCAGG - Intronic
935051938 2:99531531-99531553 GTGGCTTCTGCCCTTGTTCCTGG + Intergenic
935153319 2:100459877-100459899 ATGGCCTATGTCAATTTTCCAGG + Intergenic
937143110 2:119618749-119618771 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
937562703 2:123244924-123244946 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
939254885 2:139730041-139730063 ATGGCTTCTATCAGTTTTCCAGG + Intergenic
940054554 2:149500191-149500213 ATGGCTTCAGCCCCCTTTCCAGG + Intergenic
940124826 2:150311456-150311478 CTGGCTTCAGCCTGTTTTCCAGG - Intergenic
940423794 2:153508729-153508751 ATGGATTCTCTCAGCTTTCCTGG + Intergenic
941076353 2:161010451-161010473 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
941518743 2:166511556-166511578 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
941687528 2:168462568-168462590 AGGGCTTCACTCCGTTGTCCAGG + Intronic
942495408 2:176534808-176534830 CTGGCTGCTGTCCTGTTTCCAGG + Intergenic
943085022 2:183300781-183300803 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
944396273 2:199270890-199270912 ATCTCTCCTGTCCCTTTTCCTGG - Exonic
944635392 2:201671230-201671252 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
948721858 2:239905720-239905742 ATGCCTTCTGTCCTCTGTCCTGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169026016 20:2372155-2372177 ATGGCTTCTGTCCCAACTCCAGG + Intergenic
1170659975 20:18328725-18328747 ATGGCCTATATCAGTTTTCCAGG + Intergenic
1170807016 20:19641120-19641142 ATGGCTTCTGCCTGTTCTCTTGG + Intronic
1174297211 20:49557042-49557064 ATGGCCTCTATCAGTTTTCCAGG + Intronic
1175110334 20:56643615-56643637 GTGGCTTCTCAACGTTTTCCAGG + Intergenic
1178533010 21:33390867-33390889 CTGCCTTCTGGCCGTTTTGCTGG + Intergenic
1178732798 21:35120386-35120408 ATGGATTCTCTCGGCTTTCCTGG - Intronic
1179615472 21:42580482-42580504 TTGGCTTCTGTGTCTTTTCCAGG - Exonic
1181265182 22:21626969-21626991 GTGGCTTCAGTCCCTTTTTCTGG - Intergenic
1185022110 22:48382670-48382692 CTGGCTTCTGTCCCTTCTCCTGG - Intergenic
949157015 3:840755-840777 ATTTCTTCTGTCCCTTTTCCTGG - Intergenic
949580629 3:5384253-5384275 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
950524870 3:13517717-13517739 GTGCCTCCTGTCCTTTTTCCTGG - Intergenic
952634551 3:35511771-35511793 AGTGCTTCAGTCCGTTCTCCAGG - Intergenic
952732421 3:36652994-36653016 ATGGGTTCTCTCAGTTTTCCTGG - Intergenic
953555803 3:43946036-43946058 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
954508215 3:51097583-51097605 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
954651396 3:52166092-52166114 ATGGCCTATATCAGTTTTCCAGG + Intergenic
954997088 3:54891669-54891691 TTGGCTTCTGTCCACTGTCCTGG + Intronic
955034253 3:55250859-55250881 ATGGATTCTCACCTTTTTCCAGG - Intergenic
955452059 3:59079077-59079099 ATGGTTTCAGTCCTTTATCCTGG + Intergenic
955750195 3:62179118-62179140 AAGGGTTCTGTCCATATTCCTGG - Intronic
956743947 3:72296719-72296741 ATGGCTTCATTCCCTTTCCCGGG - Intergenic
956767362 3:72495026-72495048 ATGGCTTATGTAAGTTTTACAGG + Intergenic
957249647 3:77756907-77756929 CTGGCTTCAGCCCTTTTTCCAGG - Intergenic
957474825 3:80709593-80709615 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
957570318 3:81939099-81939121 ATGGCTACTGTAGCTTTTCCAGG - Intergenic
958586227 3:96091353-96091375 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
958694588 3:97511154-97511176 ATGGCTTCAGCCCCCTTTCCAGG + Intronic
959881223 3:111447083-111447105 CTGGCTTCAGTCCCTTTTCCAGG + Intronic
962746395 3:138400151-138400173 ATGACTTCTGTCCCTCTTTCTGG - Intronic
962765691 3:138560535-138560557 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
962960632 3:140308173-140308195 ATTGCTACTGTCAGTGTTCCAGG - Intronic
963756035 3:149235740-149235762 ATGGCAGCTGCCCCTTTTCCTGG - Intergenic
965511085 3:169568381-169568403 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
967343560 3:188427889-188427911 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
967417103 3:189231202-189231224 AAGGTTTCTGTCAGTTTTTCTGG - Intronic
969666804 4:8562431-8562453 ATGGCCTATGTCAGTTTTCCAGG - Intronic
971673625 4:29595653-29595675 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
971960034 4:33473660-33473682 CTGGCTTCTGTCTGTTGCCCAGG + Intergenic
973545347 4:51975739-51975761 AGGGCCTCTGTCTGTTATCCAGG + Intergenic
973562627 4:52151661-52151683 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
973715244 4:53669794-53669816 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
974813941 4:66981907-66981929 ATGGCTTCAGCCCCCTTTCCAGG - Intergenic
975212994 4:71722665-71722687 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
975620355 4:76290614-76290636 CTGGCTTCAGTCCTCTTTCCAGG + Intronic
975764662 4:77654908-77654930 CTGGCTTCAGCCCGCTTTCCAGG - Intergenic
976715918 4:88122328-88122350 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
977792611 4:101125750-101125772 ATGGTTTCAGTGAGTTTTCCAGG - Intronic
978186082 4:105858387-105858409 CTGGCTTCTGTCCCCTTTCCAGG + Intronic
978371488 4:108033931-108033953 ATGGCTTCTGTCAGTGTACTTGG + Intronic
979819404 4:125151831-125151853 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
981443455 4:144809043-144809065 CTGGCTTCTGCCCCCTTTCCAGG - Intergenic
982284604 4:153722176-153722198 ATGTCTTCAGTCCCCTTTCCAGG + Intronic
983167718 4:164497694-164497716 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
983840839 4:172455371-172455393 ATGGCTTCAGCCCCCTTTCCAGG - Intronic
984168076 4:176326725-176326747 TTGGCTCTTGTCTGTTTTCCTGG + Intronic
984863841 4:184263816-184263838 CTGGCTTCTGCCATTTTTCCTGG - Intergenic
986161727 5:5235822-5235844 AGGGCTTCTGTCATTTTTTCGGG - Intronic
987769698 5:22284865-22284887 CTGGCTTCTTTCCCTTTTCCTGG - Intronic
988002172 5:25362863-25362885 GTGGATTCTGTCGGCTTTCCTGG - Intergenic
988194571 5:27986572-27986594 GTGGCTTCTGTCTGTTTTAAAGG + Intergenic
988628039 5:32898842-32898864 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
989073252 5:37534021-37534043 ATGGATTCTCTCAGCTTTCCTGG + Intronic
989880939 5:46782717-46782739 AATGCTTCTGTCTATTTTCCAGG - Intergenic
990673903 5:58162298-58162320 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
990796678 5:59550643-59550665 ATGGATTGTGTTCATTTTCCTGG + Intronic
992254900 5:74911744-74911766 CTGGCTTCTGCCCCCTTTCCAGG + Intergenic
992758534 5:79931761-79931783 CTGGCTTCTACCCATTTTCCAGG - Intergenic
992765332 5:79993437-79993459 TTGGCTCCTGTGCCTTTTCCTGG + Intronic
993911530 5:93690216-93690238 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
994220933 5:97193745-97193767 ATGGATTCTCTTGGTTTTCCTGG + Intergenic
994871124 5:105351368-105351390 ATGGATTCTCTCAGTTTTCCTGG + Intergenic
994918063 5:106004849-106004871 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
994991334 5:107000235-107000257 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
995108179 5:108398944-108398966 CTGGCTTCAGTCCCTTTTCAGGG - Intergenic
995480340 5:112586499-112586521 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
996426640 5:123320305-123320327 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
998378373 5:141706478-141706500 ATGGTTTCTGCCCATTCTCCTGG - Intergenic
999375704 5:151085361-151085383 ATTGCTTCTCTCCTTTTTCCAGG + Intronic
999602572 5:153283062-153283084 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
999688299 5:154122318-154122340 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
1001576248 5:172765869-172765891 ATGGCTTCTGGCAGTTCTTCTGG - Intergenic
1004808981 6:19238857-19238879 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1007399635 6:41596460-41596482 ATGGCTTCCCTCCATTCTCCAGG - Intronic
1008402372 6:51078530-51078552 GTGGATTCTCTCCGCTTTCCTGG + Intergenic
1008896860 6:56566173-56566195 ATGGCTTCAGCCCCCTTTCCAGG + Intronic
1008916582 6:56794511-56794533 ATTGCTTCTCTCAGCTTTCCTGG - Intronic
1009305922 6:62089198-62089220 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1010276318 6:73972268-73972290 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1010993987 6:82512442-82512464 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1011020720 6:82809470-82809492 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1011831262 6:91374687-91374709 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1012083093 6:94785417-94785439 CTGGCCTCTGTCCCCTTTCCAGG + Intergenic
1012597141 6:101054126-101054148 CTGGCTTCAGTCCTCTTTCCAGG + Intergenic
1012922440 6:105233981-105234003 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1013452973 6:110303327-110303349 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1016483512 6:144508215-144508237 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1016542148 6:145178111-145178133 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1018108692 6:160513851-160513873 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1020044428 7:5030618-5030640 ATGGCTCCTCTCCTTCTTCCTGG + Intronic
1020339003 7:7089251-7089273 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1020349496 7:7202238-7202260 ATGGATTCTCTCGGCTTTCCTGG + Intronic
1020608617 7:10367714-10367736 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1022058871 7:26770432-26770454 CTGGCTTCAGTCCCTTTTCCAGG + Intronic
1022456116 7:30559721-30559743 CTGGCTTCTTTCCTGTTTCCAGG + Intergenic
1024235688 7:47395884-47395906 ATGGCTCCTCTCTGTTGTCCTGG - Intronic
1024542628 7:50491267-50491289 ACGGTTTATGTCAGTTTTCCAGG + Intronic
1024665654 7:51544425-51544447 ATGGATTCTCTCAGCTTTCCTGG + Intergenic
1026116035 7:67496388-67496410 AGGACTTTTCTCCGTTTTCCAGG - Intergenic
1029816954 7:103106413-103106435 ATGGCTTCAGCCCCCTTTCCAGG - Intronic
1031233102 7:119135529-119135551 ATGGCTTCACTCTGTTTTCCAGG - Intergenic
1031710983 7:125046464-125046486 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1031717312 7:125125195-125125217 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1033617640 7:143032177-143032199 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1034462635 7:151206330-151206352 CTCCCTTCTGTCCGTTTCCCTGG - Intergenic
1036104597 8:5826205-5826227 ATAGCTACTGTCCATGTTCCCGG - Intergenic
1039111929 8:34050578-34050600 ATGGATGCTTTCAGTTTTCCTGG - Intergenic
1040470566 8:47732680-47732702 ATGGATTCTGTCAGTTTTCTGGG + Intronic
1041323326 8:56637294-56637316 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1041630593 8:60082912-60082934 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1044897421 8:96907328-96907350 ATGTTCTCTGTCCCTTTTCCAGG - Intronic
1045199649 8:99967394-99967416 ATGGCTTCAGCCCCCTTTCCAGG - Intronic
1045783660 8:105897136-105897158 CTGGCTTCTGCCCCCTTTCCAGG - Intergenic
1046153500 8:110257856-110257878 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1047121280 8:121908083-121908105 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1049482353 8:142832572-142832594 ATGGTTTCTGTTCGCTTCCCAGG - Intergenic
1050973933 9:11912388-11912410 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1053201697 9:36156359-36156381 ATGGCTTCACTCTGTTGTCCAGG - Intronic
1054889105 9:70232660-70232682 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1055239207 9:74163658-74163680 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1055571753 9:77623931-77623953 CTGGCTTCAGCCCCTTTTCCAGG - Intronic
1055849425 9:80608522-80608544 ATAGCTTCTGTAAGTTTTCAGGG - Intergenic
1056318828 9:85417667-85417689 ATGGATTCTGTTTGTTTTTCAGG - Intergenic
1058013145 9:100000243-100000265 ATGGATTCTTGCTGTTTTCCAGG - Intronic
1058918670 9:109592559-109592581 ATGTCTCCTTTCCTTTTTCCAGG + Intergenic
1059258223 9:112950177-112950199 ATGGATTCTGTTGGTTTTACAGG - Intergenic
1062447760 9:136602755-136602777 ATGGCTCCTGCCCTTTTCCCAGG - Intergenic
1185538791 X:885382-885404 ATGGCGTCTGTCTGTTATCTGGG - Intergenic
1187936753 X:24343610-24343632 CTGGCTTCTATCAGTTTCCCTGG - Intergenic
1190127400 X:47719006-47719028 AGGGCTCCAGTCCATTTTCCAGG - Intergenic
1191088734 X:56597643-56597665 TTGGCTTCAGTCCTTTTTCCAGG + Intergenic
1191094369 X:56659129-56659151 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1191168553 X:57418206-57418228 CTGGCTTCAGCCCTTTTTCCAGG + Intronic
1191730906 X:64334374-64334396 ATTGCTTCTGTCTTTTTTTCAGG + Intronic
1192635031 X:72808046-72808068 CTGGCTTCCCTCCGTTGTCCTGG - Intronic
1192646684 X:72912757-72912779 CTGGCTTCCCTCCGTTGTCCTGG + Intronic
1192953195 X:76039592-76039614 CTGGTTTCAGCCCGTTTTCCAGG + Intergenic
1193065412 X:77254209-77254231 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1193284643 X:79697262-79697284 CTGGCTTCTGTCCCCTTTCCAGG + Intergenic
1193547987 X:82852764-82852786 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1193705168 X:84812631-84812653 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1194237732 X:91405425-91405447 ATGTCTTGTGCCAGTTTTCCAGG - Intergenic
1194515347 X:94845169-94845191 CTGGCTTCAGCCCCTTTTCCAGG + Intergenic
1195250358 X:103038371-103038393 ATGGCTCATGTCTGTTATCCCGG - Intergenic
1196476466 X:116092168-116092190 CTGGCTTCAGCCCTTTTTCCAGG + Intergenic
1196571259 X:117268530-117268552 CTGGCTTCAGCCCCTTTTCCAGG - Intergenic
1197565478 X:128079118-128079140 ATGGCTTATGCCAGTTTTCCAGG - Intergenic
1200087923 X:153619098-153619120 TTGCCTTCTGACAGTTTTCCGGG + Intergenic
1201611854 Y:15851881-15851903 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1201946362 Y:19514962-19514984 ATGGCTTCAGCCCCCTTTCCAGG - Intergenic