ID: 1070805233

View in Genome Browser
Species Human (GRCh38)
Location 10:79266951-79266973
Sequence CACTGTGTCCAGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 258}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070805233_1070805242 -6 Left 1070805233 10:79266951-79266973 CCCACCTCCTTCTGGACACAGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1070805242 10:79266968-79266990 ACAGTGGAATGGGGCTGAGGAGG No data
1070805233_1070805246 2 Left 1070805233 10:79266951-79266973 CCCACCTCCTTCTGGACACAGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1070805246 10:79266976-79266998 ATGGGGCTGAGGAGGGGCTTGGG No data
1070805233_1070805245 1 Left 1070805233 10:79266951-79266973 CCCACCTCCTTCTGGACACAGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1070805245 10:79266975-79266997 AATGGGGCTGAGGAGGGGCTTGG No data
1070805233_1070805244 -4 Left 1070805233 10:79266951-79266973 CCCACCTCCTTCTGGACACAGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1070805244 10:79266970-79266992 AGTGGAATGGGGCTGAGGAGGGG No data
1070805233_1070805241 -9 Left 1070805233 10:79266951-79266973 CCCACCTCCTTCTGGACACAGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1070805241 10:79266965-79266987 GACACAGTGGAATGGGGCTGAGG No data
1070805233_1070805243 -5 Left 1070805233 10:79266951-79266973 CCCACCTCCTTCTGGACACAGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1070805243 10:79266969-79266991 CAGTGGAATGGGGCTGAGGAGGG No data
1070805233_1070805247 20 Left 1070805233 10:79266951-79266973 CCCACCTCCTTCTGGACACAGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1070805247 10:79266994-79267016 TTGGGCTCTGCCCACCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070805233 Original CRISPR CACTGTGTCCAGAAGGAGGT GGG (reversed) Intronic
900011236 1:111072-111094 CACTGTGTCCAGCCAGTGGTGGG - Intergenic
900027340 1:287636-287658 CACTGTGTCCAGCCAGTGGTGGG - Intergenic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
903260838 1:22131151-22131173 CACTGTGGCCAGAAGCTGCTGGG + Intronic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
910083916 1:83374895-83374917 CACTGTGTCCAGTATGCAGTTGG - Intergenic
910134582 1:83952182-83952204 CTCTGCCTCAAGAAGGAGGTAGG - Exonic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
915590334 1:156866838-156866860 CACTCTGACCAGAATGAGGGAGG - Intronic
916247143 1:162699580-162699602 CACACTGTCCAGCAGGTGGTTGG + Intronic
916399660 1:164432987-164433009 TACTGTGTTTAGATGGAGGTAGG - Intergenic
920106448 1:203556631-203556653 CACTGTGGCATGCAGGAGGTGGG - Intergenic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
920682858 1:208085741-208085763 CACAGAGTTCAGAGGGAGGTAGG - Intronic
920881219 1:209882158-209882180 GACTGTGTCTAGAAGAAGGAAGG - Intergenic
921814411 1:219547715-219547737 CACTTAGTAAAGAAGGAGGTTGG - Intergenic
923539220 1:234876162-234876184 CACTGTCTCTGGAAGGAAGTGGG + Intergenic
924303169 1:242660550-242660572 CTCTGTGTCTAGAAGAAGGTTGG - Intergenic
1062901358 10:1149078-1149100 CATTCTCTCCAGAAGGAGGCTGG - Intergenic
1062919818 10:1271328-1271350 CACTGTTTCCATGGGGAGGTTGG - Intronic
1063607849 10:7538758-7538780 CACTATGCCCAGCAAGAGGTAGG - Intergenic
1063815511 10:9767235-9767257 CAATGTGACCTGATGGAGGTGGG + Intergenic
1065044410 10:21733818-21733840 GACTCTGCCCAGCAGGAGGTGGG - Exonic
1066335826 10:34477404-34477426 CACTGGGTCCAGAATGAGGGTGG + Intronic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1069088907 10:64175718-64175740 CACAGTGTAGGGAAGGAGGTGGG - Intergenic
1069884484 10:71615257-71615279 CACAGAGACCAGAAGGAGATTGG + Intronic
1069921559 10:71818799-71818821 AACAGTTTCCAGAAGGAGCTAGG + Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1072160185 10:92759257-92759279 CACAGTGTCTGGATGGAGGTAGG + Intergenic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1075397458 10:122137927-122137949 GACTTTGGACAGAAGGAGGTGGG + Intronic
1075558825 10:123453371-123453393 CACTGAGCCCAGAAGTGGGTAGG - Intergenic
1076019439 10:127059931-127059953 CACTTTGTCTAGAAGAAGGCAGG - Intronic
1076166086 10:128284043-128284065 CACTGGGTACAGAAAGAGGCTGG + Intergenic
1077030370 11:462789-462811 CAGGGTGTCCAGAAGGCTGTGGG + Intronic
1078247494 11:9588614-9588636 CACAGTGTTCAGGGGGAGGTGGG - Exonic
1078292767 11:10030330-10030352 CACTGAGTTCAGAAGGAGGTAGG + Intronic
1078439593 11:11353172-11353194 CACTGTGTTCAGAAGCAGCTTGG + Exonic
1078673642 11:13388866-13388888 CACTGTTGCCAGAAGGGGGATGG + Exonic
1079326365 11:19495986-19496008 CACTGTGTCAGAAGGGAGGTGGG - Intronic
1081951070 11:47043442-47043464 CACTGTACCCCTAAGGAGGTTGG - Intronic
1083198928 11:61107902-61107924 AACTGGGGCCAGAAGGAGGGAGG - Intronic
1083779654 11:64911241-64911263 CATGGTGTCCAGGAGGGGGTTGG + Exonic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1088913837 11:114212070-114212092 CACACTGTACAAAAGGAGGTGGG - Intronic
1099642106 12:85303670-85303692 CACTGTGTAAAAAAGGAAGTTGG - Intergenic
1100739029 12:97570830-97570852 CACTGTCTGCATAAGGATGTGGG - Intergenic
1102855993 12:116294251-116294273 CTCTGTGGCCAGCAGGAGCTTGG + Intergenic
1103303544 12:119946389-119946411 CACTGTGGGCAGCAGGAGCTCGG - Intergenic
1104477757 12:129084492-129084514 CATCGTCTCCAGCAGGAGGTGGG - Exonic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1106394081 13:29363487-29363509 CACTCTGAGAAGAAGGAGGTTGG - Intronic
1108831506 13:54484984-54485006 CACTGTGTCCAGGTGCAAGTTGG + Intergenic
1112114783 13:96339902-96339924 AATTATTTCCAGAAGGAGGTGGG + Intronic
1114536478 14:23426080-23426102 CCCTGTGGCAAGAAGGAAGTAGG + Exonic
1114542821 14:23475229-23475251 GGCTTTGTCCAGAATGAGGTGGG - Exonic
1114643382 14:24239847-24239869 CACCGTGGCCAGAAGGGGGTAGG + Exonic
1114660215 14:24339027-24339049 CTCTGGGTCCAGCAGGACGTTGG + Exonic
1117973880 14:61279841-61279863 CTCAGTGTCGTGAAGGAGGTGGG + Exonic
1118819855 14:69338167-69338189 AACTGGGTCAAGAGGGAGGTTGG + Intronic
1119655088 14:76411584-76411606 CACAGTGTCTAGTAGGAAGTGGG - Intronic
1119770250 14:77216200-77216222 CAATGTTTCCAGGAGGAGGGAGG - Intronic
1119977662 14:79043357-79043379 CCCAGAGTCCAGAAGGATGTGGG + Intronic
1120716095 14:87842181-87842203 TTCTCTGTCCTGAAGGAGGTAGG - Intronic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1122466684 14:101938538-101938560 CACTGGGGCGGGAAGGAGGTTGG - Intergenic
1122634287 14:103122999-103123021 CACCGTGGCCACAAGGAGGCAGG - Intergenic
1123132085 14:105995513-105995535 GACTGTGTGGTGAAGGAGGTTGG - Intergenic
1123468206 15:20531416-20531438 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1123649909 15:22469648-22469670 CACTGTGTCCAGCCGGGGGAAGG - Intergenic
1123728522 15:23126626-23126648 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1123740312 15:23278467-23278489 CACTGTGTCCAGCCGGGGGAAGG - Intergenic
1123746686 15:23324091-23324113 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1124125858 15:26937653-26937675 CACTGTTTAAAGCAGGAGGTGGG - Intronic
1124278954 15:28347407-28347429 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1124303745 15:28564201-28564223 CACTGTGTCCAGCCGGGGGAAGG - Intergenic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1127808902 15:62546134-62546156 CACAGTGTGGAGAGGGAGGTCGG + Intronic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1129161372 15:73749849-73749871 CACTGTGTTCAGAATGGGATAGG - Intronic
1129685290 15:77682676-77682698 CTTTGTGCCCAGAAGGGGGTGGG - Intronic
1130611301 15:85363673-85363695 TACTGTGGCCAGAAGCAAGTAGG - Intergenic
1130895080 15:88163667-88163689 TAATGTGGCCAGAAGGAGGCAGG + Intronic
1131290557 15:91103128-91103150 CTCTGTGTTTAGAAGAAGGTTGG + Intronic
1131498652 15:92937991-92938013 GATTGTGTAGAGAAGGAGGTAGG + Intronic
1131784876 15:95901628-95901650 ATCTCTGTCCAGAAGGATGTTGG - Intergenic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1135705183 16:24668876-24668898 CACTCTGTTCAAAGGGAGGTTGG - Intergenic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1137010495 16:35315818-35315840 CACTGTGTCCACAGGAGGGTAGG - Intergenic
1137068895 16:35881228-35881250 CATGGTGGCCAGAAGGAGGTAGG - Intergenic
1137646928 16:50083596-50083618 TACTGTGTCAAGAAGTAGCTGGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137698224 16:50477119-50477141 CACTTTGTCCAGCAAGAAGTGGG + Intergenic
1138008890 16:53360121-53360143 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1139323760 16:66135613-66135635 CTCTGAGCCCAGAAGGAGTTTGG + Intergenic
1139600864 16:67986179-67986201 CACTGTGCCCAGATGGAGTAGGG - Intergenic
1140017458 16:71201423-71201445 CATTGTTTCCAGCAAGAGGTTGG - Intronic
1140220695 16:73041667-73041689 CAGTGTGTGCGGCAGGAGGTTGG - Intronic
1142315028 16:89338262-89338284 CACTGTGTCCTCCAGGATGTGGG + Intronic
1142453113 16:90195834-90195856 CACTGTGTCCAGCCAGTGGTGGG + Intergenic
1143323522 17:6083353-6083375 CACTGTGCCCTGGAGGAGCTCGG + Intronic
1143502455 17:7347269-7347291 CACTGTGGCCCGAAGGAGTGGGG - Intronic
1143552063 17:7636410-7636432 CACAGTGTCCTGGAGAAGGTGGG - Intergenic
1146617179 17:34366159-34366181 GACTGTGGCCACAGGGAGGTGGG - Intergenic
1147377891 17:40033616-40033638 CACTGTTTCCAGAAGGGGGGTGG + Intronic
1147395103 17:40136412-40136434 GACTTTGTTGAGAAGGAGGTTGG + Intronic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1149466110 17:56880430-56880452 CTCAGTGTCCAGAATGAAGTGGG - Intergenic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151354209 17:73548873-73548895 AACTGGGGCCAGAAGGAGGCTGG - Intronic
1151975197 17:77480529-77480551 CACTCTGCCCAGAAGGTGGGAGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1153730661 18:8008244-8008266 AGCTGTGTACAGTAGGAGGTCGG + Intronic
1154140650 18:11821722-11821744 CACTGTTTGCAGAGGCAGGTGGG + Intronic
1157295713 18:46441278-46441300 CACTGTGCCCAGACGCAGGCTGG + Intronic
1157520190 18:48340236-48340258 TACTTGTTCCAGAAGGAGGTTGG - Intronic
1158911396 18:62066333-62066355 CACTGTGGCCCTAAGGAGATTGG - Intronic
1160832477 19:1110231-1110253 CCCTGTGTCCAGATGAGGGTCGG - Intronic
1160969700 19:1762145-1762167 CACTGCGTCCAGGGGGAGATGGG - Intronic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1162805416 19:13135766-13135788 GACAGTGGCCAGAAGGAGGCTGG + Exonic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163709821 19:18839968-18839990 CACTTTGCCTAGAAGGAGGGAGG + Intronic
1165454208 19:35901252-35901274 TACTGGGTCCAGAGGGAGGCAGG + Intronic
1166092054 19:40515733-40515755 CACTGTGCCCGGAAGAATGTTGG - Intronic
1166099363 19:40562064-40562086 CACTGTGGCCAGATGGAGGGAGG + Intronic
1167674909 19:50877935-50877957 CACTGAGGCCAGATGGAGGATGG - Intronic
1168346077 19:55650827-55650849 CCCTCTGTCTAGATGGAGGTGGG + Intronic
1168564574 19:57412281-57412303 CATTGGGTCCAGACGGGGGTAGG + Intronic
931925142 2:67064334-67064356 TTCTCTGTCCAGAAGTAGGTGGG - Intergenic
933217009 2:79642668-79642690 CACCATGTCCAAATGGAGGTGGG - Intronic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
934034696 2:88079223-88079245 CACTGTGACCAGGAGAAGGCTGG - Intronic
934753763 2:96810973-96810995 CACTGGGTGCAGCAGGAGCTGGG + Exonic
935460670 2:103329375-103329397 TACTGTGTCTTCAAGGAGGTGGG - Intergenic
935734406 2:106095634-106095656 CCCTGTGTCCAGCAGGAGCCCGG - Intronic
936169085 2:110152488-110152510 CTCTGAGTCCAGAAGGAGCATGG + Intronic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
942046921 2:172104903-172104925 CACCGTGCCCAGCAGGCGGTTGG - Intergenic
942068783 2:172296550-172296572 CAGTAGGTCCAGGAGGAGGTGGG - Intergenic
948446814 2:238039628-238039650 CTCTGGAGCCAGAAGGAGGTGGG - Intronic
948629605 2:239293592-239293614 CCCTGTGTCCATAAGCAGGTGGG - Intronic
1168782796 20:508604-508626 CACTGTGTTCAGAAGCAGCTGGG + Exonic
1170341135 20:15328280-15328302 CACTGTGGCCAGAGGGAGAGAGG + Intronic
1170427769 20:16252391-16252413 CCCTGTGTCCAGAAGAGTGTTGG + Intergenic
1170700904 20:18702592-18702614 CACAGTGACCAGGAGCAGGTTGG + Intronic
1170827078 20:19805873-19805895 CACTGTGGCCTGTTGGAGGTTGG - Intergenic
1173339019 20:42137392-42137414 CATCTTTTCCAGAAGGAGGTGGG - Intronic
1174009621 20:47439147-47439169 AGCTGTTTCCAGAAGGAGGAGGG - Intergenic
1174049950 20:47760550-47760572 CACTGTTTTCAGAGGCAGGTGGG - Intronic
1175345692 20:58272994-58273016 ACCTGTGTCCAGAAGGAGGACGG + Intergenic
1175682064 20:60996107-60996129 CCCTGTGTGCACAAGGAGTTGGG + Intergenic
1177178079 21:17719640-17719662 CACCCCGTCCTGAAGGAGGTGGG - Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1180968591 22:19803191-19803213 CACTGTGCCCTGCAGGATGTGGG + Intronic
1181276961 22:21693532-21693554 CCCTGTGCCCAGAACCAGGTTGG - Intronic
1181324783 22:22036477-22036499 CTCTGTGCCCAGGAGAAGGTAGG + Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183683468 22:39348966-39348988 CACTGGTTCCAGGAGCAGGTTGG - Intergenic
1185309687 22:50147196-50147218 CACTCTGTGCAGAAGCAGGGAGG + Intronic
950483004 3:13256257-13256279 CACCGTGTACAGAAGAATGTGGG - Intergenic
950811860 3:15656943-15656965 CACTCCGGCCAGAAAGAGGTGGG - Intergenic
951041748 3:17995555-17995577 CACTGAGTCCAAAAGTAGGGAGG - Intronic
952116782 3:30191730-30191752 AACTACCTCCAGAAGGAGGTAGG + Intergenic
952159398 3:30678586-30678608 AACTGTGTGCAGAAGGATGATGG + Intronic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
954150119 3:48653113-48653135 CACCTGGTCCAGAAGGAGATGGG + Exonic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
955950554 3:64238641-64238663 CACTGTGTCAGGCAGGAGGTGGG + Intronic
956486253 3:69724988-69725010 TACTCTGACCAGAAGGAGTTGGG + Intergenic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
959252169 3:103962998-103963020 TACTGTGTTCAGAAAGAAGTGGG + Intergenic
960739538 3:120817781-120817803 CACGTTGTCCAGAACAAGGTCGG + Intergenic
961497288 3:127304150-127304172 CACTGTGCCCGGGAGGGGGTGGG - Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
965632600 3:170748423-170748445 CGTTGTTTCCAGATGGAGGTAGG + Intronic
966226641 3:177604995-177605017 CACTGTGCCCAGAAGTATGGAGG - Intergenic
966407648 3:179614966-179614988 CACTGTGTCGAACAGGAGCTGGG - Exonic
966778438 3:183563008-183563030 CACTGTCTCTGGAAGGAAGTGGG + Intergenic
968798081 4:2722473-2722495 TGCTGTGTCCAGAAGGGGCTGGG + Intronic
969484862 4:7466607-7466629 CACGGGGTCCTGTAGGAGGTGGG + Intronic
972385523 4:38562107-38562129 CACACTGTCCAGAAGGAGAAAGG + Intergenic
973555794 4:52081418-52081440 CCCTGAGGCCAGAAGGAGGAGGG - Intronic
974712694 4:65621308-65621330 CACTGTGGCCAGAAGTGGGATGG + Intronic
975400319 4:73929949-73929971 CACTGGGTCCTCAAGGAGGGTGG + Intergenic
976334220 4:83866995-83867017 CGCTGTCTCAGGAAGGAGGTGGG - Intergenic
977991094 4:103443293-103443315 CACTGTGGGCAGAAGTAGTTTGG + Intergenic
979197096 4:117932963-117932985 CATTCTCTCCAGAAGGGGGTTGG - Intergenic
979529586 4:121755022-121755044 CACTGGGTCCAGTTGGAGGTGGG + Intergenic
981570156 4:146143063-146143085 CTCTGAGTCCAGAAGTAGGTGGG - Intergenic
982222514 4:153137125-153137147 CACTGGATGCAGAAGGAGTTGGG - Intergenic
982746072 4:159104300-159104322 AACTGTGTCAGGAAGGAGGTGGG - Intronic
987183147 5:15386977-15386999 AACTGAGTCCAGAAGCTGGTGGG - Intergenic
987769798 5:22286972-22286994 CACTGTTTCCATAACCAGGTGGG + Intronic
992223393 5:74594781-74594803 CACTGTGTCCAGGAGAAGATAGG - Intergenic
993842466 5:92897474-92897496 CACTGTTTCTAGAATGAGTTTGG - Intergenic
995564869 5:113423822-113423844 CCCTGAGTCCAGAAGCAAGTGGG - Intronic
995800023 5:115984001-115984023 TGCTGTCTCCAGCAGGAGGTTGG + Intronic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
996150614 5:120029997-120030019 AGCTGAGTCCAGAGGGAGGTGGG + Intergenic
997001861 5:129771184-129771206 CTCTGTGTCAGGAAGGAGTTTGG + Intergenic
1000028885 5:157384617-157384639 CACCATTTTCAGAAGGAGGTTGG - Intronic
1001492206 5:172163885-172163907 CACTGTGGCCAGAGGGAGCGCGG - Intronic
1001926590 5:175641539-175641561 CACTGATGCCAGAAAGAGGTAGG + Intergenic
1002667509 5:180836427-180836449 CACTGTGTGAAGACTGAGGTAGG - Intergenic
1004366843 6:15019991-15020013 CACTGTGTCCAGCCGAAGTTAGG + Intergenic
1004744208 6:18493650-18493672 CACTGTGTCCTGAATGAAATAGG + Intergenic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1006147215 6:31966866-31966888 CAGTGTGTGGAGCAGGAGGTTGG + Intronic
1006397582 6:33797127-33797149 GCCTGTGTCCAGTGGGAGGTGGG + Intronic
1006614625 6:35318070-35318092 TACTTTGTCCAGCGGGAGGTTGG + Intronic
1007122142 6:39391246-39391268 CACTGGTTCCAGAAGTAGGAAGG + Intronic
1007124251 6:39411588-39411610 TATTGTGTGCAGAAGGAGGCTGG + Intronic
1007488694 6:42200869-42200891 CACTGATTCTAGAAGGAGTTTGG - Intergenic
1007760826 6:44132719-44132741 ACCTGTGTCCAGGAGGAGCTAGG - Intronic
1008286781 6:49662685-49662707 GACTATGTCCAGAAGGTGATAGG - Intergenic
1011783185 6:90813448-90813470 CACTGGGGCCTGTAGGAGGTTGG - Intergenic
1012584286 6:100903827-100903849 CACTGTGTCCAGACAGATATAGG + Intergenic
1015620355 6:135125878-135125900 AACTGTGCCCTGAAAGAGGTTGG - Intergenic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1019236803 6:170624167-170624189 CACTGTGTCCAGCCAGTGGTGGG + Intergenic
1025049588 7:55723128-55723150 GAATGTGTGCAGAGGGAGGTGGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1027300746 7:76831034-76831056 CACTGTGTCCAGTATGCAGTTGG - Intergenic
1030110759 7:106024592-106024614 AACAGTGTCCTAAAGGAGGTGGG - Intronic
1030689980 7:112522394-112522416 CCCTGATTCCAGAAGGAGGCAGG + Intergenic
1031100542 7:117474819-117474841 AACTGTGTCCAGATGGAATTTGG - Intronic
1031100790 7:117478070-117478092 CACTCTTTCCAGAAGGAGATTGG + Intronic
1033214545 7:139483811-139483833 GGCTGTGTCCCGAAGGGGGTCGG - Intergenic
1034162395 7:149002942-149002964 ACCTGTGTCTGGAAGGAGGTGGG + Intergenic
1035324841 7:158058452-158058474 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324879 7:158058785-158058807 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324932 7:158059266-158059288 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324934 7:158059303-158059325 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324949 7:158059451-158059473 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324951 7:158059488-158059510 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035325026 7:158060261-158060283 CACTGTGTGCAGATGGAGTGTGG - Intronic
1036707480 8:11056096-11056118 CACTGGGTCCAGGAGGAGTCGGG - Intronic
1037671022 8:21015476-21015498 CTCTGTGTCCAGGAAGACGTTGG + Intergenic
1037882539 8:22579990-22580012 CACTTTGCCAAGAACGAGGTGGG + Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1048335664 8:133500318-133500340 CACGGGGGCCAGAAGGAGGGAGG + Intronic
1048883404 8:138888539-138888561 CACTTTGCCCTGAAGGTGGTAGG - Intronic
1049347636 8:142147238-142147260 CACTGTGCCCTGAAGAAGGCCGG + Intergenic
1049386105 8:142343908-142343930 CACTCTGTCCAGCAGGAGGGGGG - Intronic
1050095653 9:2062919-2062941 AACTGTTTCCAGTTGGAGGTGGG + Intronic
1050519683 9:6484452-6484474 CACTGCATCCAGGAGGAGGGGGG - Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051446791 9:17148973-17148995 CACTGGGTCCTGTCGGAGGTGGG - Intronic
1051972576 9:22908468-22908490 TACTGTGTCCTTATGGAGGTAGG - Intergenic
1054796751 9:69309308-69309330 CACTGTGTGCAAAAGGAGTCTGG - Intergenic
1054941646 9:70749171-70749193 CACTGTGTCCAGACAAAAGTTGG + Intronic
1056825737 9:89875170-89875192 CACTGTGTCCAGAGGGACATGGG + Intergenic
1058002141 9:99876690-99876712 CACTGTGCCTAGGAGAAGGTAGG - Intergenic
1059384525 9:113953963-113953985 CCCTGTGGCCTGGAGGAGGTGGG + Intronic
1059999852 9:119948405-119948427 CACTGGTTCCAGGAGGAGGATGG - Intergenic
1061087145 9:128405799-128405821 TACAGTGTCCAGAAGGAGAGTGG + Intergenic
1061935364 9:133854622-133854644 CGCTGTGACCAGAAGCAGGCTGG + Intronic
1185593133 X:1291711-1291733 CACTGGGTCCAAGTGGAGGTGGG - Intronic
1185593247 X:1292265-1292287 CACTGGGTCCAGGTAGAGGTGGG - Intronic
1185593459 X:1293615-1293637 CGCTGGGTCCAGGTGGAGGTGGG - Intronic
1185593479 X:1293702-1293724 CACTGGGTCCAGGTGGAGATGGG - Intronic
1185593499 X:1293789-1293811 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593520 X:1293875-1293897 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593549 X:1294005-1294027 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593569 X:1294089-1294111 CACTGGGTCCAGGTAGAGGTGGG - Intronic
1185593581 X:1294132-1294154 CACTGGGTCCAGGTGGAGATGGG - Intronic
1186331013 X:8534316-8534338 CACTGTGTGCTGAAGAGGGTGGG + Exonic
1190505233 X:51119601-51119623 CACCCTGTCCAGGAGGAGGGAGG - Intergenic
1190634140 X:52417880-52417902 CCCTGTTTCAAAAAGGAGGTTGG + Intergenic
1195776728 X:108414489-108414511 CACTGTGTCCAGCCAGGGGTAGG - Intronic
1199473509 X:148221095-148221117 CAGTCTGTTCAGAAGGAGTTAGG - Intergenic
1199896990 X:152135934-152135956 CACTTTGTCCTGGAGCAGGTGGG + Intronic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic
1201431597 Y:13908294-13908316 CACTGTGTGCTGAAGAGGGTGGG - Intergenic